Chitosan (CTS) Alleviates Heat-Induced Leaf Senescence in Creeping Bentgrass by Regulating Chlorophyll Metabolism, Antioxidant Defense, and the Heat Shock Pathway
Abstract
:1. Introduction
2. Results
2.1. Effects of the CTS on Water Status, Photochemical Efficiency, and Chl Metabolism
2.2. Effects of the CTS on Oxidative Damage and Antioxidant Enzyme Activities
2.3. Effects of the CTS on Expression Level of Genes Involved in HSF Pathway and Senescence
3. Discussion
4. Materials and Methods
4.1. Plant Material and Treatment
4.2. Determination of Water Status and Photosynthetic Parameters
4.3. Determination of Oxidative Damage and Antioxidant Enzyme Activities
4.4. Genes Expression Analyses
4.5. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Sample Availability
References
- Li, B.; Gao, K.; Ren, H.; Tang, W. Molecular mechanisms governing plant responses to high temperatures. J. Integr. Plant. Biol. 2018, 60, 757–779. [Google Scholar] [CrossRef]
- Lobell, D.B.; Schlenker, W.; Costa-Roberts, J. Climate trends and global crop production since 1980. Science 2011, 333, 616–620. [Google Scholar] [CrossRef] [Green Version]
- Jespersen, D.; Zhang, J.; Huang, B. Chlorophyll loss associated with heat-induced senescence in bentgrass. Plant Sci. 2016, 249, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Xu, Q.; Huang, B. Lowering soil temperatures improves creeping bentgrass growth under heat stress. Crop Sci. 2001, 41, 1878–1883. [Google Scholar] [CrossRef]
- Tang, S.; Zhang, H.; Li, L.; Liu, X.; Chen, L.; Chen, W.; Ding, Y. Exogenous spermidine enhances the photosynthetic and antioxidant capacity of rice under heat stress during early grain-filling period. Funct. Plant Biol. 2018, 45, 911–921. [Google Scholar] [CrossRef]
- Sang, Q.Q.; Shu, S.; Shan, X.; Guo, S.R.; Sun, J. Effects of exogenous spermidine on antioxidant system of tomato seedlings exposed to high temperature stress. Russ. J. Plant Physiol. 2016, 63, 645–655. [Google Scholar] [CrossRef]
- Gong, H.L.; Chen, Q.Q. Exogenous sucrose protects potato seedlings against heat stress by enhancing the antioxidant defense system. J. Soil Sci. Plant Nutr. 2021, 21, 1511–1519. [Google Scholar] [CrossRef]
- Chen, Y.E.; Mao, J.J.; Sun, L.Q.; Huang, B.; Ding, C.B.; Gu, Y.; Liao, J.Q.; Hu, C.; Zhang, Z.W.; Yuan, S.; et al. Exogenous melatonin enhances salt stress tolerance in maize seedlings by improving antioxidant and photosynthetic capacity. Physiol. Plant. 2018, 164, 349–363. [Google Scholar] [CrossRef] [PubMed]
- Ma, X.; Zhang, J.; Burgess, P.; Rossi, S.; Huang, B. Interactive effects of melatonin and cytokinin on alleviating drought-induced leaf senescence in creeping bentgrass (Agrostis stolonifera). Environ. Exp. Bot. 2018, 145, 1–11. [Google Scholar] [CrossRef]
- Zhang, J.; Shi, Y.; Zhang, X.; Du, H.; Xu, B.; Huang, B. Melatonin suppression of heat-induced leaf senescence involves changes in abscisic acid and cytokinin biosynthesis and signaling pathways in perennial ryegrass (Lolium perenne L.). Environ. Exp. Bot. 2017, 138, 36–45. [Google Scholar] [CrossRef]
- Su, Y.; Huang, Y.; Dong, X.; Wang, R.; Tang, M.; Cai, J.; Chen, J.; Zhang, X.; Nie, G. Exogenous methyl jasmonate improves heat tolerance of perennial ryegrass through alteration of osmotic adjustment, antioxidant defense, and expression of jasmonic acid-responsive genes. Front. Plant Sci. 2021, 12, 664519. [Google Scholar] [CrossRef]
- Rinaudo, M. Chitin and chitosan: Properties and applications. Prog. Polym. Sci. 2006, 31, 603–632. [Google Scholar] [CrossRef]
- Katiyar, D.; Hemantaranjan, A.; Singh, B.; Bhanu, A.N. A future perspective in crop protection: Chitosan and its oligosaccharides. Advan. Plants Agric. Res. 2014, 1, 6. [Google Scholar]
- Yang, F.; Hu, J.; Li, J.; Wu, X.; Qian, Y. Chitosan enhances leaf membrane stability and antioxidant enzyme activities in apple seedlings under drought stress. Plant Growth Regul. 2009, 58, 131–136. [Google Scholar] [CrossRef]
- ALKahtani, M.D.F.; Attia, K.A.; Hafez, Y.M.; Khan, N.; Eid, A.M.; Ali, M.A.M.; Abdelaal, K.A.A. Chlorophyll fluorescence parameters and antioxidant defense system can display salt tolerance of salt acclimated sweet pepper plants treated with chitosan and plant growth promoting rhizobacteria. Agronomy 2020, 10, 1180. [Google Scholar] [CrossRef]
- Pongprayoon, W.; Roytrakul, S.; Pichayangkura, R.; Chadchawan, S. The role of hydrogen peroxide in chitosan-induced resistance to osmotic stress in rice (Oryza sativa L.). Plant Growth Regul. 2013, 70, 159–173. [Google Scholar] [CrossRef]
- Li, Z.; Zhang, Y.; Zhang, X.; Merewitz, E.; Peng, Y.; Ma, X.; Huang, L.; Yan, Y. Metabolic pathways regulated by chitosan contributing to drought resistance in white clover. J. Proteome Res. 2017, 16, 3039–3052. [Google Scholar] [CrossRef]
- Liu, Z.; Liu, T.; Liang, L.; Li, Z.; Hassan, M.J.; Peng, Y.; Wang, D. Enhanced photosynthesis, carbohydrates, and energy metabolism associated with chitosan-induced drought tolerance in creeping bentgrass. Crop Sci. 2020, 60, 1064–1076. [Google Scholar] [CrossRef]
- Ibrahim, E.A.; Ramadan, W.A. Effect of zinc foliar spray alone and combined with humic acid or/and chitosan on growth, nutrient elements content and yield of dry bean (Phaseolus vulgaris L.) plants sown at different dates. Sci. Hortic. 2015, 184, 101–105. [Google Scholar] [CrossRef]
- Chakraborty, N.; Bae, J.; Warnke, S.; Chang, T.; Jung, G. Linkage map construction in allotetraploid creeping bentgrass (Agrostis stolonifera L.). Theor. Appl. Genet. 2005, 111, 795–803. [Google Scholar] [CrossRef]
- Miller, G.L.; Brotherton, M.A. Creeping bentgrass summer decline as influenced by climatic conditions and cultural practices. Agron. J. 2020, 112, 3500–3512. [Google Scholar] [CrossRef]
- Zhu, X.; Shen, H.L. Effect of high temperature stress on cell membrane in celery seedlings. North. Hortic. 2014, 38, 15–20. [Google Scholar]
- Camejo, D.; Rodríguez, P.; Morales, M.A.; Dell’amico, J.M.; Torrecillas, A.; Alarcón, J.J. High temperature effects on photosynthetic activity of two tomato cultivars with different heat susceptibility. J. Plant Physiol. 2005, 162, 281–289. [Google Scholar] [CrossRef] [PubMed]
- Hidangmayum, A.; Dwivedi, P.; Katiyar, D.; Hemantaranjan, A. Application of chitosan on plant responses with special reference to abiotic stress. Physiol. Mol. Biol. Plants 2019, 25, 313–326. [Google Scholar] [CrossRef]
- Farouk, S.; Amany, A.R. Improving growth and yield of cowpea by foliar application of chitosan under water stress. Egypt. J. Biol. 2012, 14, 14–26. [Google Scholar] [CrossRef] [Green Version]
- Geng, W.; Li, Z.; Hassan, M.J.; Peng, Y. Chitosan regulates metabolic balance, polyamine accumulation, and Na+ transport contributing to salt tolerance in creeping bentgrass. BMC Plant Biol. 2020, 20, 506. [Google Scholar] [CrossRef]
- Krupinska, K. Fate and activities of plastids during leaf senescence. In The Structure and Function of Plastids; Hoober, J.K., Wise, R.R., Eds.; Springer: Dordrecht, The Netherlands, 2007; Volume 23, pp. 433–449. [Google Scholar]
- Appenroth, K.J.; Stöckel, J.; Srivastava, A.; Strasser, R.J. Multiple effects of chromate on the photosynthetic apparatus of Spirodela polyrhiza as probed by OJIP chlorophyll a fluorescence measurements. Environ. Pollut. 2001, 115, 49–64. [Google Scholar] [CrossRef]
- Strasser, R.J.; Tsimilli-Michael, M.; Srivastava, A. Analysis of the chlorophyll a fluorescence transient. In Chlorophyll a Fluorescence; Papageorgiou, G.C., Govindjee, Eds.; Springer: Dordrecht, The Netherlands, 2004; Volume 19, pp. 321–362. [Google Scholar]
- Feng, B.; Liu, P.; Li, G.; Dong, S.T.; Wang, F.H.; Kong, L.A.; Zhang, J.W. Effect of heat stress on the photosynthetic characteristics in flag leaves at the grain-filling stage of different heat-resistant winter wheat varieties. J. Agron. Crop Sci. 2014, 200, 143–155. [Google Scholar] [CrossRef]
- Luo, L.; Li, Z.; Tang, M.Y.; Cheng, B.Z.; Zeng, W.H.; Peng, Y.; Nie, G.; Zhang, X.Q. Metabolic regulation of polyamines and γ-aminobutyric acid in relation to spermidine-induced heat tolerance in white clover. Plant Biol. 2020, 22, 794–804. [Google Scholar] [CrossRef]
- Bollivar, D.W. Recent advances in chlorophyll biosynthesis. Photosynth. Res. 2006, 90, 173–194. [Google Scholar] [CrossRef] [PubMed]
- Tewari, A.K.; Tripathy, B.C. Temperature-stress-induced impairment of chlorophyll biosynthetic reactions in cucumber and wheat. Plant Physiol. 1998, 117, 851–858. [Google Scholar] [CrossRef] [Green Version]
- Schelbert, S.; Aubry, S.; Burla, B.; Agne, B.; Kessler, F.; Krupinska, K.; Hörtensteiner, S. Pheophytin pheophorbide hydrolase (pheophytinase) is involved in chlorophyll breakdown during leaf senescence in Arabidopsis. Plant Cell 2009, 21, 767–785. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Büchert, A.M.; Civello, P.M.; Martínez, G.A. Chlorophyllase versus pheophytinase as candidates for chlorophyll dephytilation during senescence of broccoli. J. Plant Physiol. 2011, 168, 337–343. [Google Scholar] [CrossRef] [PubMed]
- Gan, L.; Han, L.; Yin, S.; Jiang, Y. Chlorophyll metabolism and gene expression in response to submergence stress and subsequent recovery in perennial ryegrass accessions differing in growth habits. J. Plant Physiol. 2020, 251, 153195. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Yu, G.; Wen, W.; Ma, X.; Xu, B.; Huang, B. Functional characterization and hormonal regulation of the PHEOPHYTINASE gene LpPPH controlling leaf senescence in perennial ryegrass. J. Exp. Bot. 2016, 67, 935–945. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rossi, S.; Burgess, P.; Jespersen, D.; Huang, B. Heat-induced leaf senescence associated with chlorophyll metabolism in bentgrass lines differing in heat tolerance. Crop Sci. 2017, 57, S-169–S-178. [Google Scholar] [CrossRef]
- Zhao, S.Y.; Zeng, W.H.; Li, Z.; Peng, Y. Mannose regulates water balance, leaf senescence, and genes related to stress tolerance in white clover under osmotic stress. Biol. Plant. 2020, 64, 406–416. [Google Scholar] [CrossRef]
- Pal, L.; Kar, R.K. Role of reactive oxygen species in cotyledon senescence during early seedling stage of mung bean [Vigna radiata (L.) Wilczek]. J. Plant Growth Regul. 2019, 38, 315–324. [Google Scholar] [CrossRef]
- Schopfer, P.; Plachy, C.; Frahry, G. Release of reactive oxygen intermediates (superoxide radicals, hydrogen peroxide, and hydroxyl radicals) and peroxidase in germinating radish seeds controlled by light, gibberellin, and abscisic acid. Plant Physiol. 2001, 125, 1591–1602. [Google Scholar] [CrossRef] [Green Version]
- Petrov, V.; Hille, J.; Mueller-Roeber, B.; Gechev, T.S. ROS-mediated abiotic stress-induced programmed cell death in plants. Front. Plant Sci. 2015, 6, 69. [Google Scholar] [CrossRef] [Green Version]
- Khanna-Chopra, R. Leaf senescence and abiotic stresses share reactive oxygen species-mediated chloroplast degradation. Protoplasma 2012, 249, 469–481. [Google Scholar] [CrossRef] [PubMed]
- Correia-Melo, C.; Hewitt, G.; Passos, J.F. Telomeres, oxidative stress and inflammatory factors: Partners in cellular senescence? Longev. Healthspan 2014, 3, 1. [Google Scholar] [CrossRef] [Green Version]
- Victorelli, S.; Passos, J.F. Reactive oxygen species detection in senescent cells. In Cellular Senescence; Demaria, M., Ed.; Humana Press: New York, NY, USA, 2019; pp. 21–29. [Google Scholar]
- Nagano, T.; Nakashima, A.; Onishi, K.; Kawai, K.; Awai, Y.; Kinugasa, M.; Iwasaki, T.; Kikkawa, U.; Kamada, S. Proline dehydrogenase promotes senescence through the generation of reactive oxygen species. J. Cell Sci. 2017, 130, 1413–1420. [Google Scholar]
- Zhang, J.; Li, H.; Xu, B.; Li, J.; Huang, B. Exogenous melatonin suppresses dark-induced leaf senescence by activating the superoxide dismutase-catalase antioxidant pathway and down-regulating chlorophyll degradation in excised leaves of perennial ryegrass (Lolium perenne L.). Front. Plant Sci. 2016, 7, 1500. [Google Scholar] [CrossRef] [Green Version]
- Xu, Q.; Huang, B. Antioxidant metabolism associated with summer leaf senescence and turf quality decline for creeping bentgrass. Crop Sci. 2004, 44, 553–560. [Google Scholar] [CrossRef]
- Jaleel, C.A.; Riadh, K.; Gopi, R.; Manivannan, P.; Inès, J.; Al-Juburi, H.J.; Zhao, C.X.; Shao, H.B.; Panneerselvam, R. Antioxidant defense responses: Physiological plasticity in higher plants under abiotic constraints. Acta Physiol. Plant. 2009, 31, 427–436. [Google Scholar] [CrossRef]
- Xie, W.; Xu, P.; Liu, Q. Antioxidant activity of water-soluble chitosan derivatives. Bioorg. Med. Chem. Lett. 2001, 11, 1699–1701. [Google Scholar] [CrossRef]
- Li, W.; Jiang, X.; Xue, P.; Chen, S. Inhibitory effects of chitosan on superoxide anion radicals and lipid free radicals. Chin. Sci. Bull. 2002, 47, 887–889. [Google Scholar] [CrossRef]
- Sun, T.; Xie, W.; Xu, P. Superoxide anion scavenging activity of graft chitosan derivatives. Carbohydr. Polym. 2004, 58, 379–382. [Google Scholar] [CrossRef]
- Prashanth, K.V.H.; Dharmesh, S.M.; Rao, K.S.J.; Tharanathan, R.N. Free radical-induced chitosan depolymerized products protect calf thymus DNA from oxidative damage. Carbohydr. Res. 2007, 342, 190–195. [Google Scholar] [CrossRef] [PubMed]
- González, L.M.; Guerrero, Y.R.; Rodríguez, A.F.; Vázquez, M.N. Effect of seed treatment with chitosan on the growth of rice (Oryza sativa L.) seedlings cv. INCA LP-5 in saline medium. Cultiv. Trop. 2015, 36, 136–142. [Google Scholar]
- Younas, H.S.; Abid, M.; Shaaban, M.; Ashraf, M. Influence of silicon and chitosan on growth and physiological attributes of maize in a saline field. Physiol. Mol. Biol. Plants 2021, 27, 387–397. [Google Scholar] [CrossRef] [PubMed]
- Razavizadeh, R.; Adabavazeh, F.; Komatsu, S. Chitosan effects on the elevation of essential oils and antioxidant activity of Carum copticum L. seedlings and callus cultures under in vitro salt stress. J. Plant Biochem. Biotechnol. 2020, 29, 473–483. [Google Scholar] [CrossRef]
- Abu-Muriefah, S.S. Effect of chitosan on common bean (Phaseolus vulgaris L.) plants grown under water stress conditions. Int. Res. J. Agric. Sci. Soil Sci. 2013, 3, 192–199. [Google Scholar]
- Jiao, Z.; Li, Y.; Li, J.; Xu, X.; Li, H.; Lu, D.; Wang, J. Effects of exogenous chitosan on physiological characteristics of potato seedlings under drought stress and rehydration. Potato Res. 2012, 55, 293–301. [Google Scholar] [CrossRef]
- Ali, M.; Ayyub, C.M.; Silverman, E.; Hussain, Z.; Iqbal, S.; Ayyub, S.; Akram, B. Antioxidant, lipid peroxidation and cell membrane stability influence yield in Cucumis sativus L. by chitosan application under different sowing times. J. Pure Appl. Agric. 2020, 5, 59–69. [Google Scholar]
- Klaus-Dieter, S.; Thomas, B.; Ingo, E.; Lutz, N. The plant heat stress transcription factor (Hsf) family: Structure, function and evolution. Biochim. Biophys. Acta-Gene Regul. Mech. 2012, 1819, 104–119. [Google Scholar]
- Liu, H.C.; Liao, H.T.; Charng, Y.Y. The role of class A1 heat shock factors (HSFA1s) in response to heat and other stresses in Arabidopsis. Plant Cell Environ. 2011, 34, 738–751. [Google Scholar] [CrossRef]
- Yoshida, T.; Ohama, N.; Nakajima, J.; Kidokoro, S.; Mizoi, J.; Nakashima, K.; Maruyama, K.; Kim, J.M.; Seki, M.; Todaka, D.; et al. Arabidopsis HsfA1 transcription factors function as the main positive regulators in heat shock-responsive gene expression. Mol. Genet. Genom. 2011, 286, 321–332. [Google Scholar] [CrossRef]
- Huang, Y.C.; Niu, C.Y.; Yang, C.R.; Jinn, T.L. The heat stress factor HSFA6b connects ABA signaling and ABA-mediated heat responses. Plant Physiol. 2016, 172, 1182–1199. [Google Scholar] [CrossRef]
- Qian, Y.; Cao, L.; Zhang, Q.; Amee, M.; Chen, K.; Chen, L. SMRT and Illumina RNA sequencing reveal novel insights into the heat stress response and crosstalk with leaf senescence in tall fescue. BMC Plant Biol. 2020, 20, 366. [Google Scholar] [CrossRef]
- Baniwal, S.K.; Bharti, K.; Chan, K.Y.; Fauth, M.; Ganguli, A.; Kotak, S.; Mishra, S.K.; Nover, L.; Port, M.; Scharf, K.D.; et al. Heat stress response in plants: A complex game with chaperones and more than twenty heat stress transcription factors. J. Biosci. 2005, 29, 471–487. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Vinocur, B.; Shoseyov, O.; Altman, A. Role of plant heat-shock proteins and molecular chaperones in the abiotic stress response. Trends Plant Sci. 2004, 9, 244–252. [Google Scholar] [CrossRef] [PubMed]
- Zhao, D.; Xia, X.; Su, J.; Wei, M.; Wu, Y.; Tao, J. Overexpression of herbaceous peony HSP70 confers high temperature tolerance. BMC Genom. 2019, 20, 70. [Google Scholar] [CrossRef] [PubMed]
- Zeng, W.; Hassan, M.J.; Kang, D.; Peng, Y.; Li, Z. Photosynthetic maintenance and heat shock protein accumulation relating to γ-aminobutyric acid (GABA)-regulated heat tolerance in creeping bentgrass (Agrostis stolonifera). S. Afr. J. Bot. 2021, 141, 405–413. [Google Scholar] [CrossRef]
- Hoagland, D.R.; Arnon, D.I. The water-culture method for growing plants without soil. Calif. Agric. Exp. Stn. Circ. 1950, 347, 357–359. [Google Scholar]
- Barrs, H.D.; Weatherley, P.E. A re-examination of the relative turgidity technique for estimating water deficits in leaves. Aust. J. Biol. Sci. 1962, 15, 413–428. [Google Scholar] [CrossRef] [Green Version]
- Blum, A. Osmotic adjustment and growth of barley genotypes under drought stress. Crop Sci. 1989, 29, 230–233. [Google Scholar] [CrossRef]
- Arnon, D.I. Copper enzymes in isolated chloroplasts. Polyphenoloxidase in Beta vulgaris. Plant Physiol. 1949, 24, 1–15. [Google Scholar] [CrossRef] [Green Version]
- Elstner, E.F.; Heupel, A. Inhibition of nitrite formation from hydroxylammoniumchloride: A simple assay for superoxide dismutase. Anal. Biochem. 1976, 70, 616–620. [Google Scholar] [CrossRef]
- Velikova, V.; Yordanov, I.; Edreva, A. Oxidative stress and some antioxidant systems in acid rain-treated bean plants: Protective role of exogenous polyamines. Plant Sci. 2000, 151, 59–66. [Google Scholar] [CrossRef]
- Dhindsa, R.S.; Plumb-Dhindsa, P.; Thorpe, T.A. Leaf senescence: Correlated with increased levels of membrane permeability and lipid peroxidation, and decreased levels of superoxide dismutase and catalase. J. Exp. Bot. 1981, 32, 93–101. [Google Scholar] [CrossRef]
- Blum, A.; Ebercon, A. Cell membrane stability as a measure of drought and heat tolerance in wheat. Crop Sci. 1981, 21, 43–47. [Google Scholar] [CrossRef]
- Giannopolites, C.N.; Ries, S.K. Superoxide dismutase occurrence in higher plants. Plant Physiol. 1977, 59, 309–314. [Google Scholar] [CrossRef] [PubMed]
- Maehly, A.C. The assay of catalases and peroxidases. In Methods of Biochemical Analysis; Glick, D., Ed.; Interscience Publishers: New York, NY, USA, 1954; Volume 1, pp. 357–424. [Google Scholar]
- Nakano, Y.; Asada, K. Hydrogen peroxide is scavenged by ascorbate-specific peroxidase in spinach chloroplasts. Plant Cell Physiol. 1981, 22, 867–880. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative pcr and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Target Gene | Forward Primer (5′–3′) | Reverse Primer (5′–3′) | Tm (°C) |
---|---|---|---|
β-Actin | CCTTTTCCAGCCATCTTTCA | GAGGTCCTTCCTGATATCCA | 58 |
AsPBGD | TAGCGCTGCGGATTAGAACT | GAAGGATAACGAACCGCTGA | 55 |
AsCHLH | CATCAGGGCGGATAGAGAGA | TCTGCCACAATCAGCTTCAG | 56 |
AsPPH | GAATGTCATTGCCGTCTGAA | CAATGAAATGCTGGACCTGA | 53 |
AsHSFA-6a | CACCTTCGAGGAGCTGGCATTG | TGTCTATCTCCGCCTGCTCATCC | 62 |
AsHSP82 | GAGCCTGACGGACAAGAGCAAG | GGAGTGAAGCAGAGTAACGAGACG | 64 |
AsSAG12 | CCCAGCAGTTTACTGGCTTT | AAGCAGGTGCCTTGAAACTT | 54 |
AsSAG39 | CCTCGCTGTTCTTGCCGTGAG | CGTGCTCAGCCATCCACTTCTC | 63 |
Asl20 | GGGTAGACGGCAACGATACT | TACTTGGTTGAATCGTCGGA | 60 |
Ash36 | TGGGAATGTGTTCAGGGTAA | TCACCTCGATGAGGTAGTCG | 55 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huang, C.; Tian, Y.; Zhang, B.; Hassan, M.J.; Li, Z.; Zhu, Y. Chitosan (CTS) Alleviates Heat-Induced Leaf Senescence in Creeping Bentgrass by Regulating Chlorophyll Metabolism, Antioxidant Defense, and the Heat Shock Pathway. Molecules 2021, 26, 5337. https://doi.org/10.3390/molecules26175337
Huang C, Tian Y, Zhang B, Hassan MJ, Li Z, Zhu Y. Chitosan (CTS) Alleviates Heat-Induced Leaf Senescence in Creeping Bentgrass by Regulating Chlorophyll Metabolism, Antioxidant Defense, and the Heat Shock Pathway. Molecules. 2021; 26(17):5337. https://doi.org/10.3390/molecules26175337
Chicago/Turabian StyleHuang, Cheng, Yulong Tian, Bingbing Zhang, Muhammad Jawad Hassan, Zhou Li, and Yongqun Zhu. 2021. "Chitosan (CTS) Alleviates Heat-Induced Leaf Senescence in Creeping Bentgrass by Regulating Chlorophyll Metabolism, Antioxidant Defense, and the Heat Shock Pathway" Molecules 26, no. 17: 5337. https://doi.org/10.3390/molecules26175337
APA StyleHuang, C., Tian, Y., Zhang, B., Hassan, M. J., Li, Z., & Zhu, Y. (2021). Chitosan (CTS) Alleviates Heat-Induced Leaf Senescence in Creeping Bentgrass by Regulating Chlorophyll Metabolism, Antioxidant Defense, and the Heat Shock Pathway. Molecules, 26(17), 5337. https://doi.org/10.3390/molecules26175337