Genetic Polymorphism of GSTP-1 Affects Cyclophosphamide Treatment of Autoimmune Diseases
Abstract
1. Introduction
2. Results and Discussion
2.1. Patient Characteristics and Cyclophosphamide Treatment
2.2. Allele Frequencies
2.3. Blood Glutathione Levels
2.4. Other Parameters
3. Patients and Methods
3.1. Cyclophosphamide Treatment
3.2. DNA Sample Preparation
3.3. PCR
3.4. Determination of Blood Glutathione Content
3.5. Statistical Analysis
4. Conclusions
Author Contributions
Funding
Conflicts of Interest
Appendix A
| Study Population Ancestry | GSTP1 I105V Frequency [%] | Ref. |
|---|---|---|
| Tanzanian | 16 | [43] |
| South African Venda | 12 | |
| Zimbabwean | 21 | |
| Gambian | 53 | [44] |
| Dutch | 53 | [4] |
| French | 46 | [7] |
| Serbian | 61 * | [45] |
| Turkish | 29 ** | [46] |
| Han Chinese | 20.5 | [31] |
| Bangladeshi | 29 | [26] |
| Delhi | 32 | [47] |
| Genetic Variations | Reverse and Forward Primers (5′-3′) | Ann. Temp. (°C) | Polymerization Length (sec) | Product Length |
|---|---|---|---|---|
| CYP3A4*1B (-289A->G) | GGAAACAGGCGTGGAAACAC and CCTTTGAGTTCATATTCTATGAGGTATGAT or CCTTTGAGTTCATATTCTATGAGGTATGAC | 59 | 30 | 416 bp |
| CYP3A4*2 (S222P) | TTTGATTTTTTGGATCCATTCTTTCACT or TTTGATTTTTTGGATCCATTCTTTCACC and CAATGCCCTAATCTCTTTGCCT | 58 | 60 | 867 bp |
| CYP3A4*3 (M445T) | ACCCAGAAACTGCATTGGTAT or ACCCAGAAACTGCATTGGTAC and TGGGCCTAATTGATTCTTTGGC | 60 | 20 | 237 bp |
| CYP2B6 (Q172H) | CAGTGCTGAGCCTGGTGTAT and ATGATGTTGGCGGTAATGCAC or ATGATGTTGGCGGTAATGCAA | 54 | 60 | 931 bp |
| CYP2B6 (K262R) | GGCGGTCTGATCTGGAAAGT and GGTAGGTGTCGATGAGGTTCT or GGTAGGTGTCGATGAGGTTCC | 60 | 60 | 859 bp |
| GSTP1 (I105V) | GGACCTCCGCTGCAAATCCA or GGACCTCCGCTGCAAATCCG and ACATAGTCATCCTTGCCCGC | 60 | 60 | 928 bp |
| GSTM1 del | GAACTCCCTGAAAAGCTAAAGC and GTTGGGCTCAAATATACGGTGG | 57 | 20 | 219 bp [48] |
| GSTT1 del | TTCCTTACTGGTCCTCACATCTC and TCACCGGATCATGGCCAGCA | 60.8 | 30 | 480 bp [49] |
References
- Emadi, A.; Jones, R.J.; Brodsky, R.A. Cyclophosphamide and cancer: Golden anniversary. Nat. Rev. Clin. Oncol. 2009, 6, 638–647. [Google Scholar] [CrossRef] [PubMed]
- Povirk, L.F.; Shuker, D.E. DNA damage and mutagenesis induced by nitrogen mustards. Mutat. Res. Genet. Toxicol. 1994, 318, 205–226. [Google Scholar] [CrossRef]
- Roy, P.; Yu, L.J.; Crespi, C.L.; Waxman, D.J. Development of a substrate-activity based approach to identify the major human liver P-450 catalysts of cyclophosphamide and ifosfamide activation based on cDNA-expressed activities and liver microsomal P-450 profiles. Drug Metab. Dispos. 1999, 27, 655–666. [Google Scholar] [PubMed]
- Ekhart, C.; Doodeman, V.D.; Rodenhuis, S.; Smits, P.H.M.; Beijnen, J.H.; Huitema, A.D.R. Influence of polymorphisms of drug metabolizing enzymes (CYP2B6, CYP2C9, CYP2C19, CYP3A4, CYP3A5, GSTA1, GSTP1, ALDH1A1 and ALDH3A1) on the pharmacokinetics of cyclophosphamide and 4-hydroxycyclophosphamide. Pharmacogenet. Genomics 2008, 18, 515–523. [Google Scholar] [CrossRef] [PubMed]
- de Jonge, M.E.; Huitema, A.D.R.; Rodenhuis, S.; Beijnen, J.H. Clinical Pharmacokinetics of Cyclophosphamide. Clin. Pharmacokinet. 2005, 44, 1135–1164. [Google Scholar] [CrossRef]
- Raccor, B.S.; Claessens, A.J.; Dinh, J.C.; Park, J.R.; Hawkins, D.S.; Thomas, S.S.; Makar, K.W.; McCune, J.S.; Totah, R.A. Potential contribution of cytochrome P450 2B6 to hepatic 4-hydroxycyclophosphamide formation in vitro and in vivo. Drug Metab. Dispos. 2012, 40, 54–63. [Google Scholar] [CrossRef]
- Audemard-Verger, A.; Martin Silva, N.; Verstuyft, C.; Costedoat-Chalumeau, N.; Hummel, A.; Le Guern, V.; Sacré, K.; Meyer, O.; Daugas, E.; Goujard, C.; et al. Glutathione S Transferases Polymorphisms Are Independent Prognostic Factors in Lupus Nephritis Treated with Cyclophosphamide. PLoS ONE 2016, 11, e0151696. [Google Scholar] [CrossRef]
- Dirven, H.A.A.M.; van Ommen, B.; van Bladeren, P.J. Involvement of human glutathione S-transferase isoenzymes in the conjugation of cyclophosphamide metabolites with glutathione. Cancer Res. 1994, 54, 6215–6220. [Google Scholar]
- Huitema, A.D.R.; Spaander, M.; Mathôt, R.A.A.; Tibben, M.M.; Holtkamp, M.J.; Beijnen, J.H.; Rodenhuis, S. Relationship between exposure and toxicity in high-dose chemotherapy with cyclophosphamide, thiotepa and carboplatin. Ann. Oncol. 2002, 13, 374–384. [Google Scholar] [CrossRef]
- Fairweather, D.; Frisancho-Kiss, S.; Rose, N.R. Sex differences in autoimmune disease from a pathological perspective. Am. J. Pathol. 2008, 173, 600–609. [Google Scholar] [CrossRef]
- Ekins, S.; Bravi, G.; Wikel, J.H.; Wrighton, S.A. Three-dimensional-quantitative structure activity relationship analysis of cytochrome P-450 3A4 substrates. J. Pharmacol. Exp. Ther. 1999, 291, 424–433. [Google Scholar] [PubMed]
- Labib, R.M.; Abdelrahim, M.E.A.; Elnadi, E.; Hesham, R.M.; Yassin, D. CYP2B6rs2279343 is associated with improved survival of pediatric Rhabdomyosarcoma treated with cyclophosphamide. PLoS ONE 2016, 11, e0158890. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.C.; Chu, S.K.; Huang, C.L.; Kuo, H.W.; Wang, S.C.; Liu, S.W.; Ho, I.K.; Liu, Y.L. Genome-Wide Pharmacogenomic Study on Methadone Maintenance Treatment Identifies SNP rs17180299 and Multiple Haplotypes on CYP2B6, SPON1, and GSG1L Associated with Plasma Concentrations of Methadone R- and S-enantiomers in Heroin-Dependent Patients. PLoS Genet. 2016, 12, e1005910. [Google Scholar] [CrossRef] [PubMed]
- Tomaz, P.R.X.; Santos, J.R.; Issa, J.S.; Abe, T.O.; Gaya, P.V.; Krieger, J.E.; Pereira, A.C.; Santos, P.C.J.L. CYP2B6 rs2279343 polymorphism is associated with smoking cessation success in bupropion therapy. Eur. J. Clin. Pharmacol. 2015, 71, 1067–1073. [Google Scholar] [CrossRef] [PubMed]
- Harrison, D.J.; Cantlay, A.M.; Rae, F.; Lamb, D.; Smith, C.A.D. Frequency of glutathione S-transferase M1 deletion in smokers with emphysema and lung cancer. Hum. Exp. Toxicol. 1997, 16, 356–360. [Google Scholar] [CrossRef]
- Arruda, V.R.; Grignolli, C.E.; Gonçalves, M.S.; Soares, M.C.; Menezes, R.; Saad, S.T.; Costa, F.F. Prevalence of homozygosity for the deleted alleles of glutathione S-transferase mu (GSTM1) and theta (GSTT1) among distinct ethnic groups from Brazil: Relevance to environmental carcinogenesis? Clin. Genet. 1998, 54, 210–214. [Google Scholar]
- Gildenhuys, S.; Wallace, L.A.; Burke, J.P.; Balchin, D.; Sayed, Y.; Dirr, H.W. Class Pi glutathione transferase unfolds via a dimeric and not monomeric intermediate: Functional implications for an unstable monomer. Biochemistry 2010, 49, 5074–5081. [Google Scholar] [CrossRef]
- Fabrini, R.; De Luca, A.; Stella, L.; Mei, G.; Orioni, B.; Ciccone, S.; Federici, G.; Lo Bello, M.; Ricci, G. Monomer−Dimer Equilibrium in Glutathione Transferases: A Critical Re-Examination. Biochemistry 2009, 48, 10473–10482. [Google Scholar] [CrossRef]
- Debes, J.D.; Yokomizo, A.; McDonnell, S.K.; Hebbring, S.J.; Christensen, G.B.; Cunningham, J.M.; Jacobsen, S.J.; Tindall, D.J.; Liu, W.; Schaid, D.J.; et al. Gluthatione-S-transferase P1 polymorphism I105V in familial and sporadic prostate cancer. Cancer Genet. Cytogenet. 2004, 155, 82–86. [Google Scholar] [CrossRef]
- Helzlsouer, K.J.; Selmin, O.; Huang, H.Y.; Strickland, P.T.; Hoffman, S.; Alberg, A.J.; Watson, M.; Comstock, G.W.; Bell, D. Association between glutathione S-transferase M1, P1, and T1 genetic polymorphisms and development of breast cancer. J. Natl. Cancer Inst. 1998, 90, 512–518. [Google Scholar] [CrossRef]
- Lecomte, T.; Landi, B.; Beaune, P.; Laurent-Puig, P.; Loriot, M.A. Glutathione S-transferase P1 polymorphism (Ile105Val) predicts cumulative neuropathy in patients receiving oxaliplatin-based chemotherapy. Clin. Cancer Res. 2006, 12, 3050–3056. [Google Scholar] [CrossRef]
- Lavigne, J.A.; Helzlsouer, K.J.; Huang, H.Y.; Strickland, P.T.; Bell, D.A.; Selmin, O.; Watson, M.A.; Hoffman, S.; Comstock, G.W.; Yager, J.D. An association between the allele coding for a low activity variant of catechol-O-methyltransferase and the risk for breast cancer. Cancer Res. 1997, 57, 5493–5497. [Google Scholar] [PubMed]
- Sailaja, K.; Surekha, D.; Rao, D.N.; Rao, D.R.; Vishnupriya, S. Association of the GSTP1 gene (Ile105Val) polymorphism with chronic myeloid leukemia. Asian Pac. J. Cancer Prev. 2010, 11, 461–464. [Google Scholar]
- Pinto, N.; Ludeman, S.M.; Dolan, M.E. Drug focus: Pharmacogenetic studies related to cyclophosphamide-based therapy. Pharmacogenomics 2009, 10, 1897–1903. [Google Scholar] [CrossRef] [PubMed]
- Marsh, S.; McLeod, H.L. Cancer pharmacogenetics. Br. J. Cancer 2004, 90, 8–11. [Google Scholar] [CrossRef][Green Version]
- Islam, M.S.; Islam, M.S.; Parvin, S.; Ahmed, M.U.; Sayeed, M.S.B.; Uddin, M.M.N.; Hussain, S.M.A.; Hasnat, A. Effect of GSTP1 and ABCC4 gene polymorphisms on response and toxicity of cyclophosphamide-epirubicin-5-fluorouracil-based chemotherapy in Bangladeshi breast cancer patients. Tumor Biol. 2015, 36, 5451–5457. [Google Scholar] [CrossRef] [PubMed]
- Sweeney, C.; McClure, G.Y.; Fares, M.Y.; Stone, A.; Coles, B.F.; Thompson, P.A.; Korourian, S.; Hutchins, L.F.; Kadlubar, F.F.; Ambrosone, C.B. Association between survival after treatment for breast cancer and glutathione S-transferase P1 Ile105Val polymorphism. Cancer Res. 2000, 60, 5621–5624. [Google Scholar]
- Hohaus, S.; Di Ruscio, A.; Di Febo, A.; Massini, G.; D’Alo’, F.; Guidi, F.; Mansueto, G.; Voso, M.T.; Leone, G. Glutathione S-transferase P1 genotype and prognosis in Hodgkin’s lymphoma. Clin. Cancer Res. 2005, 11, 2175–2179. [Google Scholar] [CrossRef][Green Version]
- Stanulla, M.; Schrappe, M.; Brechlin, A.M.; Zimmermann, M.; Welte, K. Polymorphisms within glutathione S-transferase genes (GSTM1, GSTT1, GSTP1) and risk of relapse in childhood B-cell precursor acute lymphoblastic leukemia: A case-control study. Blood 2000, 95, 1222–1228. [Google Scholar] [CrossRef]
- Dasgupta, R.K.; Adamson, P.J.; Davies, F.E.; Rollinson, S.; Roddam, P.L.; Ashcroft, A.J.; Dring, A.M.; Fenton, J.A.L.; Child, J.A.; Allan, J.M.; et al. Polymorphic variation in GSTP1 modulates outcome following therapy for multiple myeloma. Blood 2003, 102, 2345–2350. [Google Scholar] [CrossRef]
- Zhong, S.; Huang, M.; Yang, X.; Liang, L.; Wang, Y.; Romkes, M.; Duan, W.; Chan, E.; Zhou, S.F. Relationship of glutathione S-transferase genotypes with side-effects of pulsed cyclophosphamide therapy in patients with systemic lupus erythematosus. Br. J. Clin. Pharmacol. 2006, 62, 457–472. [Google Scholar] [CrossRef] [PubMed]
- Allan, J.M.; Wild, C.P.; Rollinson, S.; Willett, E.V.; Moorman, A.V.; Dovey, G.J.; Roddam, P.L.; Roman, E.; Cartwright, R.A.; Morgan, G.J. Polymorphism in glutathione S-transferase P1 is associated with susceptibility to chemotherapy-induced leukemia. Proc. Natl. Acad. Sci. USA 2001, 98, 11592–11597. [Google Scholar] [CrossRef] [PubMed]
- van ‘t Erve, T.J.; Wagner, B.A.; Ryckman, K.K.; Raife, T.J.; Buettner, G.R. The concentration of glutathione in human erythrocytes is a heritable trait. Free Radic. Biol. Med. 2013, 65, 742–749. [Google Scholar] [CrossRef] [PubMed]
- Michelet, F.; Gueguen, R.; Leroy, P.; Wellman, M.; Nicolas, A.; Siest, G. Blood and plasma glutathione measured in healthy subjects by HPLC: Relation to sex, aging, biological variables, and life habits. Clin. Chem. 1995, 41, 1509–1517. [Google Scholar] [CrossRef] [PubMed]
- Yang, C.-S.; Chou, S.-T.; Liu, L.; Tsai, P.-J.; Kuo, J.-S. Effect of ageing on human plasma glutathione concentrations as determined by high-performance liquid chromatography with fluorimetric detection. J. Chromatogr. B Biomed. Sci. Appl. 1995, 674, 23–30. [Google Scholar] [CrossRef]
- Dessi, M.; Noce, A.; Dawood, K.F.; Galli, F.; Taccone-Gallucci, M.; Fabrini, R.; Bocedi, A.; Massoud, R.; Fucci, G.; Pastore, A.; et al. Erythrocyte glutathione transferase: A potential new biomarker in chronic kidney diseases which correlates with plasma homocysteine. Amino Acids 2012, 43, 347–354. [Google Scholar] [CrossRef] [PubMed]
- Bocedi, A.; Fabrini, R.; Lai, O.; Alfieri, L.; Roncoroni, C.; Noce, A.; Pedersen, J.; Ricci, G. Erythrocyte glutathione transferase: A general probe for chemical contaminations in mammals. Cell Death Discov. 2016, 2, 16029. [Google Scholar] [CrossRef]
- Fabrini, R.; Bocedi, A.; Massoud, R.; Federici, G.; Ricci, G. Spectrophotometric assay for serum glutathione transferase: A re-examination. Clin. Biochem. 2012, 45, 668–671. [Google Scholar] [CrossRef]
- Highley, M.S.; Harper, P.G.; Slee, P.H.; DeBruijn, E. Preferential location of circulating activated cyclophosphamide within the erythrocyte. Int. J. cancer 1996, 65, 711–712. [Google Scholar]
- Highley, M.S.; Schrijvers, D.; Van Oosterom, A.T.; Harper, P.G.; Momerency, G.; Van Cauwenberghe, K.; Maes, R.A.A.; De Bruijn, E.A.; Edelstein, M.B. Activated oxazaphosphorines are transported predominantly by erythrocytes. Ann. Oncol. 1997, 8, 1139–1144. [Google Scholar] [CrossRef]
- Lőrincz, T.; Szarka, A. The determination of hepatic glutathione at tissue and subcellular level. J. Pharmacol. Toxicol. Methods 2017, 88, 32–39. [Google Scholar] [CrossRef] [PubMed]
- Hajdinák, P.; Czobor, Á.; Lőrincz, T.; Szarka, A. The Problem of Glutathione Determination: A Comparative Study on the Measurement of Glutathione from Plant Cells. Period. Polytech. Chem. Eng. 2018, 63, 1–10. [Google Scholar] [CrossRef]
- Dandara, C.; Sayi, J.; Masimirembwa, C.M.; Magimba, A.; Kaaya, S.; De Sommers, K.; Snyman, J.R.; Hasler, J.A. Genetic polymorphism of cytochrome P450 1A1 (Cyp1A1) and glutathione transferases (M1, T1 and P1) among Africans. Clin. Chem. Lab. Med. 2002, 40, 952–957. [Google Scholar] [CrossRef] [PubMed]
- Wild, C.P.; Yin, F.; Turner, P.C.; Chemin, I.; Chapot, B.; Mendy, M.; Whittle, H.; Kirk, G.D.; Hall, A.J. Environmental and genetic determinants of aflatoxin–albumin adducts in The Gambia. Int. J. Cancer 2000, 86, 1–7. [Google Scholar] [CrossRef]
- Simeunovic, D.; Odanovic, N.; Pljesa-Ercegovac, M.; Radic, T.; Radovanovic, S.; Coric, V.; Milinkovic, I.; Matic, M.; Djukic, T.; Ristic, A.; et al. Glutathione transferase P1 polymorphism might be a risk determinant in heart failure. Dis. Markers 2019, 2019, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Karaca, S.; Karaca, M.; Cesuroglu, T.; Erge, S.; Polimanti, R. GSTM1, GSTP1, and GSTT1 genetic variability in Turkish and worldwide populations. Am. J. Hum. Biol. 2015, 27, 310–316. [Google Scholar] [CrossRef] [PubMed]
- Sharma, A.; Pandey, A.; Sharma, S.; Chatterjee, I.; Mehrotra, R.; Sehgal, A.; Sharma, J.K. Genetic polymorphism of glutathione S-transferase P1 (GSTP1) in Delhi population and comparison with other global populations. Meta Gene 2014, 2, 134–142. [Google Scholar] [CrossRef]
- Kíran, B.; Karkucak, M.; Ozan, H.; Yakut, T.; Ozerkan, K.; Sag, S.; Ture, M. GST (GSTM1, GSTT1, and GSTP1) polymorphisms in the genetic susceptibility of Turkish patients to cervical cancer. J. Gynecol. Oncol. 2010, 21, 169–173. [Google Scholar] [CrossRef]
- Pemble, S.; Schroeder, K.R.; Spencer, S.R.; Meyer, D.J.; Hallier, E.; Bolt, H.M.; Ketterer, B.; Taylor, J.B. Human glutathione S-transferase theta (GSTT1): cDNA cloning and the characterization of a genetic polymorphism. Biochem. J. 1994, 300, 271–276. [Google Scholar] [CrossRef]
Sample Availability: In accordance with the Act CXII of 2011 on the Right of Informational Self-Determination and on Freedom of Information, and with the Act XXI of 2008 on the Protection of Human Genetic Data, samples of the patients are not available from the authors. |

| Clinical characteristics (n = 33) | |
|---|---|
| Sex, n | 29 female/ 4 male |
| Ethnic origin, Caucasian, [%] (n) | 100.00 (33) |
| Age at sample collection, mean ± SD | 50.81 ± 15.24 [24–82] |
| Treatment | |
| Cumulative dose of CYC, mean ± SD [g] | 3.66 ± 3.42 [0.5–12.6] |
| CYC pulses, mean ± SD | 3.03 ± 2.44 [1–8] |
| Response to CYC treatment, [%] (n) | 42.42% (14) |
| Biological characteristics | |
| Erythrocyte sedimentation rate, mean ± SD [mm/h] | 26.84 ± 17.17 [4–67] |
| C-reactive protein, mean ± SD [mg/L] | 8.43 ± 7.14 [1.15–34.12] |
| Diseases | |
| ANCA-associated vasculitis, [%] (n) | 18.18 (6) |
| Large vessel vasculitis, [%] (n) | 3.03 (1) |
| Systemic sclerosis, [%] (n) | 27.27 (9) |
| Interstitial lung disease, [%] (n) | 12.12 (4) |
| Systemic lupus erythematosus, [%] (n) | 21.21 (7) |
| Retroperitoneal fibrosis, [%] (n) | 6.06 (2) |
| Dermatomyositis, [%] (n) | 6.06 (2) |
| Sarcoidosis, [%] (n) | 6.06 (2) |
| . | WT Responders/All Carriers [n], (%) | Heterozygous Variant Responders/All Carriers [n], (%) | Homozygous Variant Responders/All Carriers [n], (%) | p |
|---|---|---|---|---|
| CYP3A4*2 (S222P) | 14/33 (42.42%) | — | — | N/A |
| CYP3A4*1B (-289A->G) | 14/33 (42.42%) | — | — | N/A |
| CYP3A4*3 (M445T) | 14/33 (42.42%) | — | — | N/A |
| CYP2B6 (Q172H) | 12/27 (44.44%) | 2/5 (40%) | 0/1 (0%) | 0.62 |
| CYP2B6 (K262R) | 4/14 (28.57%) | 9/16 (56.25%) | 1/3 (33%) | 0.12 |
| GSTM1 (deletion) | 7/16 (43.75%) | N/A 1 | 7/17 (41.17%) | 0.88 |
| GSTP1 (I105V) | 3/14 (21.42%) | 8/13 (61.53%) | 3/6 (50%) | 0.03* |
| GSTT1 (deletion) | 9/24 (37.5%) | N/A 1 | 4/8 (50%) | 0.41 |
| All Patients | p * | WT for GSTP1 | GSTP1 I105V Carriers | p ** | ||
|---|---|---|---|---|---|---|
| Plasma GSH content before treatment, mean ± SD | [µM] | 0.47 ± 0.56 | 0.68 | — | — | — |
| Plasma GSH content 8 h after treatment, mean ± SD | [µM] | 0.64 ± 0.82 | — | — | — | |
| Erythrocyte GSH content before treatment, mean ± SD | [µmol/L red blood cells] | 2285.50 ± 1822.34 | 0.73 | 2172.56 ± 1519.79 | 2271.03 ± 2069.04 | 0.90 |
| Erythrocyte GSH content 8 h after treatment, mean ± SD | [µmol/L red blood cells] | 2472.80 ± 2235.55 | 2334.50 ± 2076.64 | 2853.45 ± 2421.49 | 1.00 |
| Responder, Mean ± SD | Non-responder, Mean ± SD | p | |
|---|---|---|---|
| Age | 49.21 ± 19.06 | 52.05 ± 11.93 | 0.54 |
| Erythrocyte sedimentation rate, [mm/h] | 21.28 ± 13.28 | 31.16 ± 18.90 | 0.15 |
| C-reactive protein, [mg/L] | 5.05 ± 3.34 | 10.70 ± 8.48 | 0.08 |
| Cumulative dose of CYC [g] | 2.87 ± 3.12 | 4.47 ± 3.57 | 0.10 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hajdinák, P.; Szabó, M.; Kiss, E.; Veress, L.; Wunderlich, L.; Szarka, A. Genetic Polymorphism of GSTP-1 Affects Cyclophosphamide Treatment of Autoimmune Diseases. Molecules 2020, 25, 1542. https://doi.org/10.3390/molecules25071542
Hajdinák P, Szabó M, Kiss E, Veress L, Wunderlich L, Szarka A. Genetic Polymorphism of GSTP-1 Affects Cyclophosphamide Treatment of Autoimmune Diseases. Molecules. 2020; 25(7):1542. https://doi.org/10.3390/molecules25071542
Chicago/Turabian StyleHajdinák, Péter, Melinda Szabó, Emese Kiss, Lili Veress, Lívius Wunderlich, and András Szarka. 2020. "Genetic Polymorphism of GSTP-1 Affects Cyclophosphamide Treatment of Autoimmune Diseases" Molecules 25, no. 7: 1542. https://doi.org/10.3390/molecules25071542
APA StyleHajdinák, P., Szabó, M., Kiss, E., Veress, L., Wunderlich, L., & Szarka, A. (2020). Genetic Polymorphism of GSTP-1 Affects Cyclophosphamide Treatment of Autoimmune Diseases. Molecules, 25(7), 1542. https://doi.org/10.3390/molecules25071542

