Carvone Decreases Melanin Content by Inhibiting Melanoma Cell Proliferation via the Cyclic Adenosine Monophosphate (cAMP) Pathway
Abstract
:1. Introduction
2. Results
2.1. Carvone Decreases Melanin Content of B16F10 Melanoma Cells
2.2. Carvone Suppresses B16F10 Melanoma Cell Proliferation
2.3. Carvone Activates the cAMP Pathway in B16F10 Melanoma Cells
2.4. Carvone Has No Effect on Melanogenesis-Related Gene Expression
2.5. Carvone Decreases Melanin Content through the cAMP Pathway
2.6. Carvone Affects Cell Cycle-Related Protein Expression via the cAMP Signaling Pathway
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. A Melanin Quantification Assay
4.3. A Cell Proliferation/Cytotoxicity Assay
4.4. Measurement of Intracellular cAMP Levels
4.5. Western Blotting
4.6. Quantitative PCR
4.7. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Bagherani, N.; Gianfaldoni, S.; Smoller, B. An overview on melasma. Pigment. Disord. 2015, 2. [Google Scholar] [CrossRef] [Green Version]
- Riley, P. Melanin. Int. J. Biochem. Cell Biol. 1997, 29, 1235–1239. [Google Scholar] [CrossRef]
- Slominski, A.; Tobin, D.J.; Shibahara, S.; Wortsman, J. Melanin pigmentation in mammalian skin and its hormonal regulation. Physiol. Rev. 2004, 84, 1155–1228. [Google Scholar] [CrossRef] [PubMed]
- Tadokoro, T.; Kobayashi, N.; Zmudzka, B.Z.; Ito, S.; Wakamatsu, K.; Yamaguchi, Y.; Korossy, K.S.; Miller, S.A.; Beer, J.Z.; Hearing, V.J. UV-induced DNA damage and melanin content in human skin differing in racial/ethnic origin. FASEB J. 2003, 17, 1177–1179. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Atillasoy, E.S.; Seykora, J.T.; Soballe, P.W.; Elenitsas, R.; Nesbit, M.; Elder, D.E.; Montone, K.T.; Sauter, E.; Herlyn, M. UVB induces atypical melanocytic lesions and melanoma in human skin. Am. J. Pathol. 1998, 152, 1179. [Google Scholar] [PubMed]
- Hervieu, G. Melanin-concentrating hormone functions in the nervous system: Food intake and stress. Expert Opin. Ther. Targets 2003, 7, 495–511. [Google Scholar] [CrossRef] [PubMed]
- Almasi, B.; Jenni, L.; Jenni-Eiermann, S.; Roulin, A. Regulation of stress response is heritable and functionally linked to melanin-based coloration. J. Evol. Biol. 2010, 23, 987–996. [Google Scholar] [CrossRef] [Green Version]
- Manganiello, V.; Degerman, E. Cyclic nucleotide phosphodiesterases (PDEs): Diverse regulators of cyclic nucleotide signals and inviting molecular targets for novel therapeutic agents. Thromb. Haemost. 1999, 82, 407–411. [Google Scholar]
- Antoni, F.A. Molecular diversity of cyclic AMP signalling. Front. Neuroendocrinol. 2000, 21, 103–132. [Google Scholar] [CrossRef]
- Dumont, J.E.; Jauniaux, J.-C.; Roger, P.P. The cyclic AMP-mediated stimulation of cell proliferation. Trends Biochem. Sci. 1989, 14, 67–71. [Google Scholar] [CrossRef]
- Chen, Z.; Li, J.-L.; Lin, S.; Cao, C.; Gimbrone, N.T.; Yang, R.; Fu, D.A.; Carper, M.B.; Haura, E.B.; Schabath, M.B. cAMP/CREB-regulated LINC00473 marks LKB1-inactivated lung cancer and mediates tumor growth. J. Clin. Investig. 2016, 126, 2267–2279. [Google Scholar] [CrossRef] [PubMed]
- Whitfield, J.F.; Durkin, J.P.; Franks, D.J.; Kleine, L.P.; Raptis, L.; Rixon, R.H.; Sikorska, M.; Walker, P.R. Calcium, cyclic AMP and protein kinase C—partners in mitogenesis. Cancer Metastasis Rev. 1987, 5, 205–250. [Google Scholar] [CrossRef] [PubMed]
- Boynton, A.L.; Whitfield, J.F. The role of cyclic AMP in cell proliferation: A critical assessment of the evidence. In Advances in Cyclic Nucleotide Research; Greengard, P., Robinson, G.A., Eds.; Raven Press: New York, NY, USA, 1983; pp. 193–294. [Google Scholar]
- Lyons, J.; Bastian, B.C.; McCormick, F. MC1R and cAMP signaling inhibit cdc25B activity and delay cell cycle progression in melanoma cells. Proc. Natl. Acad. Sci. USA 2013, 110, 13845–13850. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hiramoto, K.; Murata, T.; Shimizu, K.; Morita, H.; Inui, M.; Manganiello, V.C.; Tagawa, T.; Arai, N. Role of phosphodiesterase 2 in growth and invasion of human malignant melanoma cells. Cell. Signal. 2014, 26, 1807–1817. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ahn, M.-J.; Hur, S.-J.; Kim, E.-H.; Lee, S.H.; Shin, J.S.; Kim, M.-K.; Uchizono, J.A.; Whang, W.-K.; Kim, D.-S. Scopoletin from Cirsium setidens increases melanin synthesis via CREB phosphorylation in B16F10 cells. Korean J. Physiol. Pharmacol. 2014, 18, 307–311. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Oh, J.; Kim, J.; Jang, J.H.; Lee, S.; Park, C.M.; Kim, W.-K.; Kim, J.-S. Novel (1E, 3E, 5E)-1, 6-bis (substituted phenyl) hexa-1, 3, 5-triene analogs inhibit melanogenesis in B16F10 cells and zebrafish. Int. J. Mol. Sci. 2018, 19, 1067. [Google Scholar] [CrossRef] [Green Version]
- Kokkini, S.; Karousou, R.; Lanaras, T. Essential oils of spearmint (Carvone-rich) plants from the island of Crete (Greece). Biochem. Syst. Ecol. 1995, 23, 425–430. [Google Scholar] [CrossRef]
- Zheng, G.-q.; Kenney, P.M.; Lam, L.K. Anethofuran, carvone, and limonene: Potential cancer chemoprotective agents from dill weed oil and caraway oil. Planta Med. 1992, 58, 338–341. [Google Scholar] [CrossRef]
- Rajeshwari, T.; Raja, B. Antioxidant and free radical scavenging effect of D-carvone in hypertensive rats. In vivo and in vitro study. Int. Lett. Nat. Sci. 2015, 8, 6–12. [Google Scholar]
- Wu, C.; Thach, T.T.; Kim, Y.-J.; Lee, S.-J. Olfactory receptor 43 reduces hepatic lipid accumulation and adiposity in mice. Biochim. Biophys. Acta (BBA)-Mol. Cell Biol. Lipids 2019, 1864, 489–499. [Google Scholar] [CrossRef]
- Aggarwal, K.; Khanuja, S.; Ahmad, A.; Santha Kumar, T.; Gupta, V.K.; Kumar, S. Antimicrobial activity profiles of the two enantiomers of limonene and carvone isolated from the oils of Mentha spicata and Anethum sowa. Flavour Fragr. J. 2002, 17, 59–63. [Google Scholar] [CrossRef]
- Tyson, J.J.; Csikasz-Nagy, A.; Novak, B. The dynamics of cell cycle regulation. Bioessays 2002, 24, 1095–1109. [Google Scholar] [CrossRef] [Green Version]
- Sánchez-Martínez, C.; Gelbert, L.M.; Lallena, M.J.; de Dios, A. Cyclin dependent kinase (CDK) inhibitors as anticancer drugs. Bioorganic Med. Chem. Lett. 2015, 25, 3420–3435. [Google Scholar] [CrossRef] [PubMed]
- Buolamwini, J.K. Cell cycle molecular targets in novel anticancer drug discovery. Curr. Pharm. Des. 2000, 6, 379–392. [Google Scholar] [CrossRef]
- Hochegger, H.; Takeda, S.; Hunt, T. Cyclin-dependent kinases and cell-cycle transitions: Does one fit all? Nat. Rev. Mol. Cell Biol. 2008, 9, 910–916. [Google Scholar] [CrossRef]
- Collins, I.; Garrett, M.D. Targeting the cell division cycle in cancer: CDK and cell cycle checkpoint kinase inhibitors. Curr. Opin. Pharmacol. 2005, 5, 366–373. [Google Scholar] [CrossRef]
- Rodríguez, C.I.; Setaluri, V. Cyclic AMP (cAMP) signaling in melanocytes and melanoma. Arch. Biochem. Biophys. 2014, 563, 22–27. [Google Scholar] [CrossRef]
- Pirino, G.; Wescott, M.P.; Donovan, P.J. Protein kinase A regulates resumption of meiosis by phosphorylation of Cdc25B in mammalian oocytes. Cell Cycle 2009, 8, 665–670. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, Q.-Y.; Wong, Z.C.-F.; Wang, C.; Fung, A.H.-Y.; Wong, E.O.-Y.; Chan, G.K.-L.; Dong, T.T.-X.; Chen, Y.; Tsim, K.W.-K. Isoorientin derived from Gentiana veitchiorum Hemsl. flowers inhibits melanogenesis by down-regulating MITF-induced tyrosinase expression. Phytomedicine 2019, 57, 129–136. [Google Scholar] [CrossRef]
- Yang, C.H.; Huang, Y.C.; Tsai, M.L.; Cheng, C.Y.; Liu, L.L.; Yen, Y.W.; Chen, W.L. Inhibition of melanogenesis by β-caryophyllene from lime mint essential oil in mouse B16 melanoma cells. Int. J. Cosmet. Sci. 2015, 37, 550–554. [Google Scholar] [CrossRef]
- Jin, S.-L.C.; Lan, L.; Zoudilova, M.; Conti, M. Specific role of phosphodiesterase 4B in lipopolysaccharide-induced signaling in mouse macrophages. J. Immunol. 2005, 175, 1523–1531. [Google Scholar] [CrossRef] [Green Version]
- Kang, W.; Choi, D.; Park, T. Decanal Protects against UVB-Induced Photoaging in Human Dermal Fibroblasts via the cAMP Pathway. Nutrients 2020, 12, 1214. [Google Scholar] [CrossRef]
- Oki, N.; Takahashi, S.-I.; Hidaka, H.; Conti, M. Short Term Feedback Regulation of cAMP in FRTL-5 Thyroid Cells ROLE OF PDE4D3 PHOSPHODIESTERASE ACTIVATION. J. Biol. Chem. 2000, 275, 10831–10837. [Google Scholar] [CrossRef]
- Adipietro, K.A.; Mainland, J.D.; Matsunami, H. Functional evolution of mammalian odorant receptors. PLoS Genet 2012, 8, e1002821. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Saito, H.; Chi, Q.; Zhuang, H.; Matsunami, H.; Mainland, J.D. Odor coding by a Mammalian receptor repertoire. Sci. Signal. 2009, 2, ra9. [Google Scholar] [CrossRef] [Green Version]
- Selbie, L.A.; Hill, S.J. G protein-coupled-receptor cross-talk: The fine-tuning of multiple receptor-signalling pathways. Trends Pharmacol. Sci. 1998, 19, 87–93. [Google Scholar] [CrossRef]
- Thomsen, W.; Frazer, J.; Unett, D. Functional assays for screening GPCR targets. Curr. Opin. Biotechnol. 2005, 16, 655–665. [Google Scholar] [CrossRef]
- Park, H.-Y.; Wu, C.; Yonemoto, L.; Murphy-Smith, M.; Wu, H.; Stachur, C.M.; Gilchrest, B.A. MITF mediates cAMP-induced protein kinase C-β expression in human melanocytes. Biochem. J. 2006, 395, 571–578. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Newton, R.A.; Cook, A.L.; Roberts, D.W.; Leonard, J.H.; Sturm, R.A. Post-transcriptional regulation of melanin biosynthetic enzymes by cAMP and resveratrol in human melanocytes. J. Investig. Dermatol. 2007, 127, 2216–2227. [Google Scholar] [CrossRef]
- Chiang, H.-M.; Chien, Y.-C.; Wu, C.-H.; Kuo, Y.-H.; Wu, W.-C.; Pan, Y.-Y.; Su, Y.-H.; Wen, K.-C. Hydroalcoholic extract of Rhodiola rosea L.(Crassulaceae) and its hydrolysate inhibit melanogenesis in B16F0 cells by regulating the CREB/MITF/tyrosinase pathway. Food Chem. Toxicol. 2014, 65, 129–139. [Google Scholar] [CrossRef] [PubMed]
- Saha, B.; Singh, S.K.; Sarkar, C.; Bera, R.; Ratha, J.; Tobin, D.J.; Bhadra, R. Activation of the Mitf promoter by lipid-stimulated activation of p38-stress signalling to CREB. Pigment Cell Res. 2006, 19, 595–605. [Google Scholar] [CrossRef] [PubMed]
- Friedmann, P.; Wren, F.; Buffey, J.; MacNeil, S. α-MSH causes a small rise in cAMP but has no effect on basal or ultraviolet-stimulated melanogenesis in human melanocytes. Br. J. Dermatol. 1990, 123, 145–151. [Google Scholar] [CrossRef]
- Patel, P.B.; Thakkar, V.R. L-carvone induces p53, caspase 3 mediated apoptosis and inhibits the migration of breast cancer cell lines. Nutr. Cancer 2014, 66, 453–462. [Google Scholar] [CrossRef]
- Vinothkumar, R.; Nalini, N. Supplementation with D-carvone Induces Cytotoxicity and Mitochondrial-Mediated Apoptosis in Human Colon Cancer Cell Lines HT-29 and SW480. IJPBA 2013, 4, 502–510. [Google Scholar]
Sample Availability: Samples of all compounds are available from the authors. |
Gene Description | Sequence (5′→3′) |
---|---|
Microphthalmia-associated transcription factor (MITF) | F: AGCGTGTATTTTCCCCACAG R: TAGCTCCTTAATGCGGTCGT |
Tyrosinase | F: CCTCCTGGCAGATCATTTGT R: GGCAAATCCTTCCAGTGTGT |
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) | F: GTGATGGCATGGACTGTGGT R: GGAGCCAAAAGGGTCATCAT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kang, W.; Choi, D.; Park, S.; Park, T. Carvone Decreases Melanin Content by Inhibiting Melanoma Cell Proliferation via the Cyclic Adenosine Monophosphate (cAMP) Pathway. Molecules 2020, 25, 5191. https://doi.org/10.3390/molecules25215191
Kang W, Choi D, Park S, Park T. Carvone Decreases Melanin Content by Inhibiting Melanoma Cell Proliferation via the Cyclic Adenosine Monophosphate (cAMP) Pathway. Molecules. 2020; 25(21):5191. https://doi.org/10.3390/molecules25215191
Chicago/Turabian StyleKang, Wesuk, Dabin Choi, Soyoon Park, and Taesun Park. 2020. "Carvone Decreases Melanin Content by Inhibiting Melanoma Cell Proliferation via the Cyclic Adenosine Monophosphate (cAMP) Pathway" Molecules 25, no. 21: 5191. https://doi.org/10.3390/molecules25215191
APA StyleKang, W., Choi, D., Park, S., & Park, T. (2020). Carvone Decreases Melanin Content by Inhibiting Melanoma Cell Proliferation via the Cyclic Adenosine Monophosphate (cAMP) Pathway. Molecules, 25(21), 5191. https://doi.org/10.3390/molecules25215191