Targeting TGF-β-Mediated SMAD Signaling Pathway via Novel Recombinant Cytotoxin II: A Potent Protein from Naja naja oxiana Venom in Melanoma
Abstract
1. Introduction
2. Results
2.1. The Expression and Characterizing of Protein Interest
2.2. Mapping of IgG-Binding Epitopes
2.3. Cell Viability
2.4. The mRNA Expression Levels of Caspase-8 and Caspase-9 and MMP-3 after Treatment by rCTII
2.5. The mRNA Expression Levels of SMAD-Dependent TGF-β Signaling-Related Genes after Treatment by rCTII
2.6. The Expression Level of miR-214 (melano-miR) after Treating with rCTII
3. Discussion
4. Materials and Methods
4.1. Bacterial Strain and Cell Culture
4.2. The Expression and Purification of CTII in SHuffle® T7 Express
4.3. Cleavage of SUMO Fusions, Quantification of rCTII, and SDS-PAGE
4.4. The Epitope Mapping of Cytotoxin-II
4.5. Proliferation Assay
4.6. RNA Extraction, cDNA Synthesis, and qRT-PCR
4.7. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Dimitriou, F.; Krattinger, R.; Ramelyte, E.; Barysch, M.J.; Micaletto, S.; Dummer, R.; Goldinger, S.M. The world of melanoma: Epidemiologic, genetic, and anatomic differences of melanoma across the globe. Curr. Oncol. Rep. 2018, 20, 87. [Google Scholar] [CrossRef] [PubMed]
- Schadendorf, D.; van Akkooi, A.C.; Berking, C.; Griewank, K.G.; Gutzmer, R.; Hauschild, A.; Stang, A.; Roesch, A.; Ugurel, S. Melanoma. Lancet 2018, 392, 971–984. [Google Scholar] [CrossRef]
- Erdei, E.; Torres, S.M. A new understanding in the epidemiology of melanoma. Expert Rev. Anticancer Ther. 2010, 10, 1811–1823. [Google Scholar] [CrossRef] [PubMed]
- Davis, L.E.; Shalin, S.C.; Tackett, A.J. Current state of melanoma diagnosis and treatment. Cancer Biol. Ther. 2019, 20, 1366–1379. [Google Scholar] [CrossRef]
- Turkson, J. Cancer drug discovery and anticancer drug development. In The Molecular Basis of Human Cancer; Humana Press: New York, NY, USA, 2017; pp. 695–707. [Google Scholar]
- Derakhshani, A.; Silvestris, N.; Hajiasgharzadeh, K.; Mahmoudzadeh, S.; Fereidouni, M.; Paradiso, A.V.; Brunetti, O.; Atarod, D.; Safarpour, H.; Baradaran, B. Expression and characterization of a novel recombinant cytotoxin II from Naja naja oxiana venom: A potential treatment for breast cancer. Int. J. Biol. Macromol. 2020, 162, 1283–1292. [Google Scholar] [CrossRef]
- Al-Asmari, A.K.; Riyasdeen, A.; Al-Shahrani, M.H.; Islam, M. Snake venom causes apoptosis by increasing the reactive oxygen species in colorectal and breast cancer cell lines. Oncotargets Ther. 2016, 9, 6485–6498. [Google Scholar] [CrossRef]
- Samy, R.P.; Sethi, G.; Lim, L.H. A brief update on potential molecular mechanisms underlying antimicrobial and wound-healing potency of snake venom molecules. Biochem. Pharmacol. 2016, 115, 1–9. [Google Scholar] [CrossRef]
- Gasanov, S.E.; Shrivastava, I.H.; Israilov, F.S.; Kim, A.A.; Rylova, K.A.; Zhang, B.; Dagda, R.K. Naja naja oxiana cobra venom cytotoxins CTI and CTII disrupt mitochondrial membrane integrity: Implications for basic three-fingered cytotoxins. PLoS ONE 2015, 10, e0129248. [Google Scholar] [CrossRef]
- Ebrahim, K.; Vatanpour, H.; Zare, A.; Shirazi, F.H.; Nakhjavani, M. Anticancer activity a of caspian cobra (Naja Naja Oxiana) snake venom in human cancer cell lines via induction of apoptosis. Iran. J. Pharm. Res. IJPR 2016, 15, 101–112. [Google Scholar]
- Zhao, M.; Mishra, L.; Deng, C.X. The role of TGF-β/SMAD4 signaling in cancer. Int. J. Biol. Sci. 2018, 14, 111–123. [Google Scholar] [CrossRef]
- Nagaraj, N.S.; Datta, P.K. Targeting the transforming growth factor-beta signaling pathway in human cancer. Expert Opin. Investig. Drugs 2010, 19, 77–91. [Google Scholar] [CrossRef] [PubMed]
- Samanta, D.; Datta, P.K. Alterations in the Smad pathway in human cancers. Front. Biosci. (Landmark Ed.) 2012, 17, 1281–1293. [Google Scholar] [CrossRef] [PubMed]
- Shadbad, M.A.; Hajiasgharzadeh, K.; Baradaran, B. Cross-talk between myeloid-derived suppressor cells and Mucin1 in breast cancer vaccination: On the verge of a breakthrough. Life Sci. 2020, 118128. [Google Scholar] [CrossRef] [PubMed]
- Vannini, I.; Fanini, F.; Fabbri, M. Emerging roles of microRNAs in cancer. Curr. Opin. Genet. Dev. 2018, 48, 128–133. [Google Scholar] [CrossRef]
- Gnoni, A.; Santini, D.; Scartozzi, M.; Russo, A.; Licchetta, A.; Palmieri, V.; Lupo, L.; Faloppi, L.; Palasciano, G.; Memeo, V. Hepatocellular carcinoma treatment over sorafenib: Epigenetics, microRNAs and microenvironment. Is there a light at the end of the tunnel? Expert Opin. Ther. Targets 2015, 19, 1623–1635. [Google Scholar] [CrossRef]
- Orso, F.; Quirico, L.; Virga, F.; Penna, E.; Dettori, D.; Cimino, D.; Coppo, R.; Grassi, E.; Elia, A.R.; Brusa, D. miR-214 and miR-148b targeting inhibits dissemination of melanoma and breast cancer. Cancer Res. 2016, 76, 5151–5162. [Google Scholar] [CrossRef]
- Penna, E.; Orso, F.; Cimino, D.; Tenaglia, E.; Lembo, A.; Quaglino, E.; Poliseno, L.; Haimovic, A.; Osella-Abate, S.; De Pittà, C. microRNA-214 contributes to melanoma tumour progression through suppression of TFAP2C. EMBO J. 2011, 30, 1990–2007. [Google Scholar] [CrossRef]
- Prabhakar, K.; Rodrίguez, C.I.; Jayanthy, A.S.; Mikheil, D.M.; Bhasker, A.I.; Perera, R.J.; Setaluri, V. Role of miR-214 in regulation of β-catenin and the malignant phenotype of melanoma. Mol. Carcinog. 2019, 58, 1974–1984. [Google Scholar] [CrossRef]
- Derakhshani, A.; Keshavarz, K.; Banadkoki, S.B.; Shirazi, F.H.; Barati, M.; Fereidouni, M.; Safarpour, H. Optimization of induction parameters, structure quality assessment by ATR-FTIR and in silico characterization of expressed recombinant polcalcin in three different strains of Escherichia coli. Int. J. Biol. Macromol. 2019, 138, 97–105. [Google Scholar] [CrossRef]
- Ebrahim, K.; Shirazi, F.H.; Vatanpour, H.; Kobarfard, F.; Rabiei, H. Anticancer activity of cobra venom polypeptide, cytotoxin-II, against human breast adenocarcinoma cell line (MCF-7) via the induction of apoptosis. J. Breast Cancer 2014, 17, 314–322. [Google Scholar] [CrossRef]
- Elmore, S. Apoptosis: A review of programmed cell death. Toxicol. Pathol. 2007, 35, 495–516. [Google Scholar] [CrossRef]
- Dlamini, Z.; Mbita, Z.; Zungu, M. Genealogy, expression, and molecular mechanisms in apoptosis. Pharmacol. Ther. 2004, 101, 1–15. [Google Scholar] [CrossRef] [PubMed]
- Park, M.H.; Son, D.J.; Kwak, D.H.; Song, H.S.; Oh, K.-W.; Yoo, H.-S.; Lee, Y.M.; Song, M.J.; Hong, J.T. Snake venom toxin inhibits cell growth through induction of apoptosis in neuroblastoma cells. Arch. Pharmacal Res. 2009, 32, 1545. [Google Scholar] [CrossRef] [PubMed]
- Park, M.H.; Jo, M.; Won, D.; Song, H.S.; Han, S.B.; Song, M.J.; Hong, J.T. Snake venom toxin from Vipera lebetina turanica induces apoptosis of colon cancer cells via upregulation of ROS-and JNK-mediated death receptor expression. BMC Cancer 2012, 12, 228. [Google Scholar] [CrossRef] [PubMed]
- Badr, G.; Sayed, D.; Maximous, D.; Mohamed, A.O.; Gul, M. Increased susceptibility to apoptosis and growth arrest of human breast cancer cells treated by a snake venom-loaded silica nanoparticles. Cell. Physiol. Biochem. 2014, 34, 1640–1651. [Google Scholar] [CrossRef]
- Chen, K.-C.; Lin, S.-R.; Chang, L.-S. Involvement of mitochondrial alteration and reactive oxygen species generation in Taiwan cobra cardiotoxin-induced apoptotic death of human neuroblastoma SK-N-SH cells. Toxicon 2008, 52, 361–368. [Google Scholar] [CrossRef] [PubMed]
- Gonzalez-Avila, G.; Sommer, B.; Mendoza-Posada, D.A.; Ramos, C.; Garcia-Hernandez, A.A.; Falfan-Valencia, R. Matrix metalloproteinases participation in the metastatic process and their diagnostic and therapeutic applications in cancer. Crit. Rev. Oncol. Hematol. 2019, 137, 57–83. [Google Scholar] [CrossRef]
- Longo, V.; Brunetti, O.; Gnoni, A.; Cascinu, S.; Gasparini, G.; Lorusso, V.; Ribatti, D.; Silvestris, N. Angiogenesis in pancreatic ductal adenocarcinoma: A controversial issue. Oncotarget 2016, 7, 58649–58658. [Google Scholar] [CrossRef]
- Bastian, A.; Nichita, L.; Zurac, S. Matrix Metalloproteinases in Melanoma with and without Regression. In The Role of Matrix Metalloproteinase in Human Body Pathologies; IntechOpen: London, UK, 2017; p. 145. [Google Scholar]
- Tang, N.; Xie, Q.; Wang, X.; Li, X.; Chen, Y.; Lin, X.; Lin, J. Inhibition of invasion and metastasis of MHCC97H cells by expression of snake venom cystatin through reduction of proteinases activity and epithelial-mesenchymal transition. Arch. Pharmacal Res. 2011, 34, 781–789. [Google Scholar] [CrossRef]
- Xie, Q.; Tang, N.; Lin, Y.; Wang, X.; Lin, X.; Lin, J. Recombinant adenovirus snake venom cystatin inhibits the growth, invasion, and metastasis of B16F10 cells in vitro and in vivo. Melanoma Res. 2013, 23, 444–451. [Google Scholar] [CrossRef]
- Ji, M.-K.; Shi, Y.; Xu, J.-W.; Lin, X.; Lin, J.-Y. Recombinant snake venom metalloproteinase inhibitor BJ46A inhibits invasion and metastasis of B16F10 and MHCC97H cells through reductions of matrix metalloproteinases 2 and 9 activities. Anti-Cancer Drugs 2013, 24, 461–472. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Liu, X.; Ren, X.; Tian, Y.; Chen, Z.; Xu, X.; Du, Y.; Jiang, C.; Fang, Y.; Liu, Z.; et al. Smad2 and Smad3 have differential sensitivity in relaying TGFβ signaling and inversely regulate early lineage specification. Sci. Rep. 2016, 6, 21602. [Google Scholar] [CrossRef]
- Itatani, Y.; Kawada, K.; Sakai, Y. Transforming growth factor-β signaling pathway in colorectal cancer and its tumor microenvironment. Int. J. Mol. Sci. 2019, 20, 5822. [Google Scholar] [CrossRef] [PubMed]
- Javelaud, D.; Van Kempen, L.; Alexaki, V.I.; Le Scolan, E.; Luo, K.; Mauviel, A. Efficient TGF-β/SMAD signaling in human melanoma cells associated with high c-SKI/SnoN expression. Mol. Cancer 2011, 10, 2. [Google Scholar] [CrossRef]
- Guo, C.; Liu, S.; Dong, P.; Zhao, D.; Wang, C.; Tao, Z.; Sun, M.-Z. Akbu-LAAO exhibits potent anti-tumor activity to HepG2 cells partially through produced H2O2 via TGF-β signal pathway. Sci. Rep. 2015, 5, 18215. [Google Scholar] [CrossRef]
- Penna, E.; Orso, F.; Cimino, D.; Vercellino, I.; Grassi, E.; Quaglino, E.; Turco, E.; Taverna, D. miR-214 coordinates melanoma progression by upregulating ALCAM through TFAP2 and miR-148b downmodulation. Cancer Res. 2013, 73, 4098–4111. [Google Scholar] [CrossRef] [PubMed]
- Chandrasekaran, K.S.; Sathyanarayanan, A.; Karunagaran, D. MicroRNA-214 suppresses growth, migration and invasion through a novel target, high mobility group AT-hook 1, in human cervical and colorectal cancer cells. Br. J. Cancer 2016, 115, 741–751. [Google Scholar] [CrossRef]
- Larsen, J.E.P.; Lund, O.; Nielsen, M. Improved method for predicting linear B-cell epitopes. Immunome Res. 2006, 2, 2. [Google Scholar] [CrossRef][Green Version]
- Ahmed, M.; Kim, D.R. pcr: An R package for quality assessment, analysis and testing of qPCR data. PeerJ 2018, 6, e4473. [Google Scholar] [CrossRef]
- Wickham, H. ggplot2: Elegant Graphics for Data Analysis; Springer: Berlin/Heidelberg, Germany, 2016. [Google Scholar]
Sample Availability: Samples of the compounds and their related data are available from Prof. Behzad Baradaran and Dr. Hossein Safarpour and could be published only with their Authorization. |






| Method | Region | Residues | Length | Color | Epitope |
|---|---|---|---|---|---|
| Bepipred Linear Epitope Prediction | 1–5 | LKCKK | 5 | Green | - |
| 6–16 | LVPLFYKTCPA | 10 | Purple | yes | |
| 17–18 | GK | 2 | Green | - | |
| 19–44 | NLCYKMFMVSNLTVPVKRGCIDVCPK | 26 | Yellow | yes | |
| 45–60 | SSLLVKYVCCNTDKCN | 15 | Green | - |
| Primers | Sequences (5′→3′) |
|---|---|
| Caspase-8 | CTGGTCTGAAGGCTGGTTGTT GTGACCAACTCAAGGGCTCAG |
| Caspase-9 | CCTTCCTCTCTTCATCTCCTGCT TTGCTGTGAGTCCCATTGGT |
| SMAD2 | AAGGGTGGGGAGCAGAATAC CTTGAGCAACGCACTGAAGG |
| SMAD3 | ACTACATCGGAGGGGAGGTC GGGTCAACTGGTAGACAGCC |
| MMP-3 | TACTGGAGATTTGATGAGAAGAG TACAGATTCACGCTCAAGTTCC |
| 18S rRNA | CTACCACATCCAAGGAAGGCA TTTTTCGTACTACCTCCCCG |
| miR-214 | AACAAGACAGCAGGCACAGA GTCGTATCCAGTGCAGGGT SL: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACTGCC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Derakhshani, A.; Silvestris, N.; Hemmat, N.; Asadzadeh, Z.; Abdoli Shadbad, M.; Nourbakhsh, N.S.; Mobasheri, L.; Vahedi, P.; Shahmirzaie, M.; Brunetti, O.; et al. Targeting TGF-β-Mediated SMAD Signaling Pathway via Novel Recombinant Cytotoxin II: A Potent Protein from Naja naja oxiana Venom in Melanoma. Molecules 2020, 25, 5148. https://doi.org/10.3390/molecules25215148
Derakhshani A, Silvestris N, Hemmat N, Asadzadeh Z, Abdoli Shadbad M, Nourbakhsh NS, Mobasheri L, Vahedi P, Shahmirzaie M, Brunetti O, et al. Targeting TGF-β-Mediated SMAD Signaling Pathway via Novel Recombinant Cytotoxin II: A Potent Protein from Naja naja oxiana Venom in Melanoma. Molecules. 2020; 25(21):5148. https://doi.org/10.3390/molecules25215148
Chicago/Turabian StyleDerakhshani, Afshin, Nicola Silvestris, Nima Hemmat, Zahra Asadzadeh, Mahdi Abdoli Shadbad, Niloufar Sadat Nourbakhsh, Leila Mobasheri, Parviz Vahedi, Morteza Shahmirzaie, Oronzo Brunetti, and et al. 2020. "Targeting TGF-β-Mediated SMAD Signaling Pathway via Novel Recombinant Cytotoxin II: A Potent Protein from Naja naja oxiana Venom in Melanoma" Molecules 25, no. 21: 5148. https://doi.org/10.3390/molecules25215148
APA StyleDerakhshani, A., Silvestris, N., Hemmat, N., Asadzadeh, Z., Abdoli Shadbad, M., Nourbakhsh, N. S., Mobasheri, L., Vahedi, P., Shahmirzaie, M., Brunetti, O., Safarpour, H., & Baradaran, B. (2020). Targeting TGF-β-Mediated SMAD Signaling Pathway via Novel Recombinant Cytotoxin II: A Potent Protein from Naja naja oxiana Venom in Melanoma. Molecules, 25(21), 5148. https://doi.org/10.3390/molecules25215148

