How Human H1 Histone Recognizes DNA
Abstract
:1. Introduction
2. Results
Affinity H1 Histone for Different Single-Stranded Oligonucleotides
3. Discussion
4. Materials and Methods
4.1. Chemicals
4.2. Analysis of the Binding of Histones to DNA on Membrane Filters
4.3. Preparation of Oligonucleotides Duplexes
4.4. Determination of H1 Histone Affinity for Different Oligonucleotides
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
Abbreviations
AP-EN | human apurinic/apyrimidinic endonuclease |
Fpg | E. coli formamidopyrimidine or 8-oxoguanine DNA glycosylase |
I50 | inhibitor concentration reducing complexation by 50% |
dNMPs | 5′-dexosimononucleotides |
d(pN)n and ON | oligodeoxyribonucleotide |
ss and ds | single- and double-stranded |
SILC | stepwise increase in ligand complexity |
topoisomerase I | human topoisomerase I |
Pi | inorganic orthophosphate |
kDa | kilo Daltons |
dNMPs | nucleoside monophosphate |
RA | relative activity |
References
- Youngson, R.M. Collins Dictionary of Human Biology; HarperCollins: Glasgow, UK, 2006. [Google Scholar]
- Cox, M.; Nelson, D.R.; Lehninger, A.L. Lehninger Principles of Biochemistry; Freeman, W.H., Ed.; Macmillan: San Francisco, CA, USA, 2005. [Google Scholar]
- Mariño-Ramírez, L.; Kann, M.G.; Shoemaker, B.A.; Landsman, D. Histone structure and nucleosome stability. Expert Rev. Proteom. 2005, 2, 719–729. [Google Scholar]
- Luger, K.; Mäder, A.W.; Richmond, R.K.; Sargent, D.F.; Richmond, T.J. Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature 1997, 389, 251–260. [Google Scholar] [CrossRef] [PubMed]
- Zlatanova, J.; Bishop, T.C.; Victor, J.M.; Jackson, V.; van Holde, K. The nucleosome family: Dynamic and growing. Structure 2009, 17, 160–171. [Google Scholar] [CrossRef] [Green Version]
- Armeev, G.A.; Gribkova, A.K.; Pospelova, I.; Komarova, G.A.; Shaytan, A.K. Linking chromatin composition and structural dynamics at the nucleosome level. Curr. Opin. Struct. Biol. 2019, 56, 46–55. [Google Scholar] [CrossRef] [PubMed]
- Bartley, J.; Chalkley, R. Further studies of a thymus nucleohistone-associated protease. J. Biol. Chem. 1970, 245, 4286–4292. [Google Scholar]
- Murray, K. The acid extraction of histones from calf thymus deoxyribonucleoprotein. J. Mol. Biol. 1966, 15, 409–419. [Google Scholar] [CrossRef]
- Muyldermans, S.; Lasters, I.; Wyns, L. Histone H1 can be removed selectively from chicken erythrocyte chromatin at near physiological conditions. Nucleic Acids Res. 1980, 8, 731–739. [Google Scholar] [PubMed]
- Panyim, S.; Chalkley, R. A new histone found only in mammalian tissues with little cell division. Biochem. Biophys. Res. Commun. 1969, 37, 1042–1049. [Google Scholar] [CrossRef]
- Bucci, L.R.; Brock, W.A.; Meistrich, M.L. Distribution and synthesis of histone 1 subfractions during spermatogenesis in the rat. Exp. Cell Res. 1982, 140, 111–118. [Google Scholar] [CrossRef]
- Lennox, R.W. Differences in evolutionary stability among mammalian H1 subtypes. Implications for the roles of H1 subtypes in chromatin. J. Biol. Chem. 1984, 259, 669–672. [Google Scholar]
- Tanaka, M.; Hennebold, J.D.; Macfarlane, J.; Adashi, E.Y. A mammalian oocyte-specific linker histone gene H1oo: Homology with the genes for the oocyte-specific cleavage stage histone (CS-H1) of sea urchin and the B4/H1M histone of the frog. Development 2001, 128, 655–664. [Google Scholar] [PubMed]
- Khochbin, S. Histone H1 diversity: Bridging regulatory signals to linker histone function. Gene 2001, 27, 11–12. [Google Scholar] [CrossRef]
- Lennox, R.W.; Oshima, R.G.; Cohen, L.H. The H1 histones and their interphase phosphorylated states in differentiated and undifferentiated cell lines derived from murine teratocarcinomas. J. Biol. Chem. 1982, 257, 5183–5189. [Google Scholar]
- Hall, J.M.; Cole, R.D. Modulation in proportions of H1 histone subfractions by differential changes in synthesis and turnover during butyrate treatment of neuroblastoma cells. Biochemistry 1985, 24, 7765–7771. [Google Scholar] [CrossRef] [PubMed]
- Domínguez, V.; Piña, B.; Suau, P. Histone H1 subtype synthesis in neurons and neuroblasts. Development 1992, 115, 181–185. [Google Scholar]
- Liao, L.W.; Cole, R.D. Differences among fractions of H1 histones in their interactions with linear and superhelical DNA: Circular dichroism. J. Biol. Chem. 1981, 256, 10124–10128. [Google Scholar]
- Khadake, J.R.; Manchanahalli, R.; Rao, M.R.S. DNA- and chromatin-condensing properties of rat testes H1a and H1t compared to those of rat liver H1bdec; H1t is a poor condenser of chromatin. Biochemistry 1995, 34, 15792–15801. [Google Scholar] [CrossRef]
- Talasz, H.; Sapojnikova, N.; Helliger, W.; Linder, H.; Puschendorf, B. In vitro binding of H1 histone subtypes to nucleosomal organized mouse mammary tumor virus long terminal repeat promotor. J. Biol. Chem. 1998, 273, 32236–32243. [Google Scholar] [CrossRef] [Green Version]
- Vermaak, D.; Steinbach, O.C.; Dimitrov, S.; Rupp, R.A.; Wolffe, A.P. The globular domain of histone H1 is sufficient to direct specific gene repression in early Xenopus embryos. Curr. Biol. 1998, 8, 533–536. [Google Scholar] [CrossRef] [Green Version]
- Brown, D.T.; Alexander, B.T.; Sittman, A.B. Differential effect of H1 variant overexpression on cell cycle progression and gene expression. Nucleic Acids Res. 1996, 24, 486–493. [Google Scholar] [CrossRef] [Green Version]
- Steinbach, O.C.; Wolffe, A.P.; Rupp, R.A. Somatic linker histones cause loss of mesodermal competence in Xenopus. Nature 1997, 389, 395–399. [Google Scholar] [CrossRef] [PubMed]
- Alami, R.; Fan, Y.; Pack, S.; Sonbuchner, T.M.; Besse, A.; Lin, Q.; Greally, J.M.; Skoultchi, A.I.; Bouhassira, E.E. Mammalian linker-histone subtypes differentially affect gene expression in vivo. Proc. Natl. Acad. Sci. USA 2006, 100, 5920–5925. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hartman, P.G.; Chapman, G.E.; Moss, T.; Bradbury, E.M. Studies on the role and mode of operation of the very-lysine-rich histone H1 in eukaryote chromatin. The three structural regions of the histone H1 molecule. Eur. J. Biochem. 1977, 77, 45–51. [Google Scholar] [CrossRef] [PubMed]
- Orrego, M.; Ponte, I.; Roque, A.; Buschati, N.; Mora, X.; Suau, P. Differential affinity of mammalian histone H1 somatic subtypes for DNA and chromatin. BMC Biol. 2007, 5, 22. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Korolev, N.; Allahverdi, A.; Lyubartsev, A.P.; Lars Nordenskii, L. The polyelectrolyte properties of chromatin. Soft Matter 2012, 8, 9322. [Google Scholar] [CrossRef]
- Cherstvy, A.G.; Teif, V.B. Electrostatic effect of H1-histone protein binding on nucleosome repeat length. Phys. Biol. 2014, 11, 044001. [Google Scholar] [CrossRef] [Green Version]
- Woodcock, C.L.; Skoultchi, A.I.; Fan, Y. Role of linker histone in chromatin structure and function: H1 stoichiometry and nucleosome repeat length. Chromosome Res. 2006, 14, 17–25. [Google Scholar] [CrossRef]
- Nevinsky, G.A. Structural, thermodynamic, and kinetic basis of DNA and RNA-dependent enzymes functioning: Important role of weak nonspecific additive interactions between enzymes and long nucleic acids for their recognition and transformation. In Protein Structures: Kaleidoscope of Structural Properties and Functions; Uversky, V.N., Ed.; Research Signpost: Kerala, India, 2003; pp. 133–222. [Google Scholar]
- Nevinsky, G.A. Structural, thermodynamic, and kinetic basis for the activities of some nucleic acid repair enzymes. J. Mol. Recognit. 2011, 24, 656–677. [Google Scholar] [CrossRef]
- Nevinsky, G.A. The role of weak specific and nonspecific interactions in enzymatic recognition and conversion of long DNAs. Mol. Biol. Mosk. 2004, 38, 636–662. [Google Scholar] [CrossRef]
- Zharkov, D.O.; Mechetin, G.V.; Nevinsky, G.A. Uracil-DNA glycosylase: Structural, thermodynamic and kinetic aspects of lesion search and recognition. Mutat. Res. 2010, 685, 11–20. [Google Scholar] [CrossRef] [Green Version]
- Nevinsky, G.A.; Veniaminova, A.G.; Levina, A.S.; Podust, V.N.; Lavrik, O.I.; Holler, E. Structure-function analysis of mononucleotides and short oligonucleotides in the priming of enzymatic DNA synthesis. Biochemistry 1990, 29, 1200–1207. [Google Scholar] [CrossRef] [PubMed]
- Kolocheva, T.I.; Nevinsky, G.A.; Levina, A.S.; Khomov, V.V.; Lavrik, O.I. The mechanism of recognition of templates by DNA polymerases from pro- and eukaryotes as revealed by affinity modification data. J. Biomol. Struct. Dyn. 1991, 9, 169–186. [Google Scholar] [CrossRef] [PubMed]
- Kolocheva, T.I.; Nevinsky, G.A.; Volchkova, V.A.; Levina, A.S.; Khomov, V.V.; Lavrik, O.I. DNA polymerase I (Klenow fragment): Role of the structure and length of a template in enzyme recognition. FEBS Lett. 1989, 248, 97–100. [Google Scholar] [CrossRef] [Green Version]
- Lavrik, O.I.; Nevinskii, G.A. Protein-nucleic acid interactions in reactions catalyzed by eukaryotic and prokaryotic DNA-polymerases. Biokhimiia 1989, 54, 757–764. [Google Scholar]
- Kolocheva, T.I.; Maksakova, G.A.; Bugreev, D.V.; Nevinsky, G.A. Interaction of endonuclease EcoRI with short specific and nonspecific oligonucleotides. IUBMB Life 2001, 51, 189–195. [Google Scholar] [CrossRef]
- Bugreev, D.V.; Baranova, S.; Zakharova, O.D.; Parissi, V.; Desjobert, C.; Sottofattori, E.; Balbi, A.; Litvak, S.; Tarrago-Litvak, L.; Nevinsky, G.A. Dynamic, thermodynamic, and kinetic basis for recognition and transformation of DNA by human immunodeficiency virus type 1 integrase. Biochemistry 2003, 42, 9235–9247. [Google Scholar] [CrossRef]
- Bugreev, D.V.; Buneva, V.N.; Sinitsyna, O.I.; Nevinsky, G.A. The mechanism of the supercoiled DNA recognition by the eukaryotic type I topoisomerases. I. The enzyme interaction with nonspecific oligonucleotides. Russ. J. Bioorg. Chem. 2003, 29, 143–153. [Google Scholar] [CrossRef]
- Bugreev, D.V.; Sinitsyna, O.I.; Buneva, V.N.; Nevinsky, G.A. The mechanism of supercoiled DNA recognition by eukaryotic type I topoisomerases. II. A comparison of the enzyme interaction with specific and nonspecific oligonucleotides. Russ. J. Bioorg. Chem. 2003, 29, 249–261. [Google Scholar] [CrossRef]
- Vinogradova, N.L.; Bulychev, N.V.; Maksakova, G.A.; Johnson, F.; Nevinskii, G.A. Uracil DNA glycosylase: Interpretation of X-ray data in the light of kinetic and thermodynamic studies. Mol. Biol. Mosk. 1998, 32, 400–409. [Google Scholar]
- Ishchenko, A.A.; Vasilenko, N.L.; Sinitsina, O.I.; Yamkovoy, V.I.; Fedorova, O.S.; Douglas, K.T.; Nevinsky, G.A. Thermodinamic, kinetic, and structural basis for recognition and repair of 8-oxoguanine in DNA by Fpg protein from Escherichia coli. Biochemistry 2002, 41, 7540–7548. [Google Scholar] [CrossRef]
- Zharkov, D.O.; Ishchenko, A.A.; Douglas, K.T.; Nevinsky, G.A. Recognition of damaged DNA by Escherichia coli Fpg protein: Insights from structural and kinetic data. Mutat. Res. 2003, 531, 141–156. [Google Scholar] [CrossRef] [PubMed]
- Kirpota, O.O.; Endutkin, A.V.; Ponomarenko, M.P.; Ponomarenko, P.M.; Zharkov, D.O.; Nevinsky, G.A. Thermodynamic and kinetic basis for recognition and repair of 8-oxoguanine in DNA by human 8-oxoguanine-DNA glycosylase. Nucleic Acids Res. 2011, 39, 4836–4850. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Beloglazova, N.G.; Kirpota, O.O.; Starostin, K.V.; Ishchenko, A.A.; Yamkovoy, V.I.; Zharkov, D.O.; Douglas, K.T.; Nevinsky, G.A. Thermodynamic, kinetic and structural basis for recognition and repair of abasic sites in DNA by apurinic/apyrimidinic endonuclease from human placenta. Nucleic Acids Res. 2004, 32, 5134–5146. [Google Scholar] [CrossRef] [PubMed]
- Bugreeva, I.P.; Bugreev, D.V.; Nevinsky, G.A. Formation of nucleoprotein RecA filament on single-stranded DNA: Analysis by stepwise increase in ligand complexity. FEBS J. 2005, 272, 2734–2745. [Google Scholar] [CrossRef] [PubMed]
- Bugreeva, I.P.; Bugreev, D.V.; Nevinsky, G.A. Interaction of single-stranded DNA with the second DNA-binding site of RecA nucleoprotein filament. Mol. Biol. Mosk. 2007, 41, 524–534. [Google Scholar] [CrossRef] [PubMed]
- Guschina, T.A.; Soboleva, S.E.; Nevinsky, G.A. Recognition of specific and nonspecific DNA by human lactoferrin. J. Mol. Recognit. 2013, 26, 136–148. [Google Scholar] [CrossRef] [PubMed]
- Nevinsky, G.A.; Alinovskaya, L.I.; Ivanisenko, N.V.; Soboleva, S.E.; Sedykh, S.E. How Human alpha-lactalbumin recognize DNA and RNA. Biochem. Anal. Biochem. 2018, 7, 4. [Google Scholar]
- Alinovskaya, L.I.; Sedykh, S.E.; Ivanisenko, N.V.; Soboleva, S.E.; Nevinsky, G.A. How human serum albumin recognizes DNA and RNA. Biol. Chem. 2018, 399, 347–360. [Google Scholar] [CrossRef] [PubMed]
- Andreev, S.L.; Buneva, V.N.; Nevinsky, G.A. How human IgGs against DNA recognize oligonucleotides and DNA. J. Mol. Recognit. 2016, 29, 596–610. [Google Scholar] [CrossRef]
- Fersht, A. Enzyme Structure and Mechanism, 2nd ed.; W.H. Freeman Company: New York, NY, USA, 1985. [Google Scholar]
- Zhou, B.R.; Bai, Y. Chromatin structures condensed by linker histones. Essays Biochem. 2019, 63, 75–87. [Google Scholar]
- Kavi, H.; Emelyanov, A.V.; Fyodorov, D.V.; Skoultchi, A.I. Independent biological and biochemical functions for individual structural domains of Drosophila linker histone H1. J. Biol. Chem. 2016, 291, 15143–15155. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Healton, S.E.; Pinto, H.D.; Mishra, L.N.; Hamilton, G.A.; Wheat, J.C.; Swist-Rosowska, K.; Shukeir, N.; Dou, Y.; Steidl, U.; Jenuwein, T.; et al. H1 linker histones silence repetitive elements by promoting both histone H3K9 methylation and chromatin compaction. Proc. Natl. Acad. Sci. USA 2020, 117, 14251–14258. [Google Scholar] [CrossRef] [PubMed]
- Bocharova, T.N.; Smirnova, E.A.; Volodin, A.A. Linker histone H1 stimulates DNA strand exchange between short oligonucleotides retaining high sensitivity to heterology. Biopolymers 2012, 97, 229–239. [Google Scholar] [CrossRef] [PubMed]
- Sambrook, J.; Fritsch, E.F.; Maniatis, T. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 1989; Chapter 6. [Google Scholar]
Sample Availability: Samples of the compounds are not available from the authors. |
Ligand | Kd, M * | Ligand | Kd, M * | Ligand | Kd, M |
---|---|---|---|---|---|
dAMP | 1.6 × 10−2 | dCMP | 1.0 × 10−2 | dTMP | 1.3 × 10−2 |
d(pA)4 | 2.4 × 10−4 | d(pC)2 | 4.4 × 10−3 | d(pT)4 | 9.6 × 10−5 |
d(pA)5 | 7.0 × 10−5 | d(pC)5 | 3.0 × 10−4 | d(pT)5 | 7.5 × 10−5 |
d(pA)6 | 5.7 × 10−5 | d(pC)6 | 6.1 × 10−5 | d(pT)6 | 4.8 × 10−5 |
d(pA)8 | 4.8 × 10−5 | d(pC)8 | 3.4 × 10−5 | d(pT)8 | 7.6 × 10−5 |
d(pA)10 | 2.8 × 10−5 | d(pC)10 | 2.5 × 10−5 | d(pT)10 | 2.5 × 10−5 |
d(pA)12 | 1.4 × 10−5 | d(pC)12 | 2.0 × 10−5 | d(pT)12 | 1.0 × 10−5 |
d(pA)16 | 1.0 × 10−5 | – | - | d(pT)16 | 5.0 × 10−6 |
d(pA)20 | 1.0 × 10−5 | d(pC)20 | 4.4 × 10−6 | d(pT)20 | 4.6 × 10−6 |
d(pATG) | 1.5 × 10−3 | d(TAAAATCAAA) | 3.0 × 10−5 | d(TCCCATCAAA) | 3.0 × 10−5 |
d(TATAATCTTA) | 2.8 × 10−5 | d(TAGAAGATCAAA) | 1.2 × 10−5 | ||
20-mer ODN1 d(CAGACGATCAGCGACGCGTC) | 4.0 × 10−6 | 20-mer ODN2 ** d(AGTGCCTGACCGTCGTCGAC) | 3.8 × 10−6 | 20-mer ODNcom1 ** d(GTCTGCTAGTCGCTGCGCAG) | 3.7 × 10−6 |
20-mer ODNcom2 d(TCACGGACTGGCAGCAGCTG) | 4.1 × 10−6 | - | - | - | - |
Oligonucleotide Mixtures and Duplexes | |||||
d(pA)3 × d(pT)3 | 1.0 × 10−3 | d(pA)6 × d(pT)6 | 5.5 × 10−5 | d(pA)12 × d(pT)12 | 7.5 × 10−6 |
d(pA)16 × d(pT)16 | 3.8 × 10−6 | d(pA)20 × d(pT)20 | 3.0 × 10−6 | - | - |
20-mer duplex d(CAGACGATCAGCGACGCGTC) × ODNcom1 *** | 2.7 × 10−6 | 20-mer duplex d(AGTGCCTGACCGTCGTCGAC) × ODNcom2 *** | 2.9 × 10−6 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Luzhetskaya, O.P.; Sedykh, S.E.; Nevinsky, G.A. How Human H1 Histone Recognizes DNA. Molecules 2020, 25, 4556. https://doi.org/10.3390/molecules25194556
Luzhetskaya OP, Sedykh SE, Nevinsky GA. How Human H1 Histone Recognizes DNA. Molecules. 2020; 25(19):4556. https://doi.org/10.3390/molecules25194556
Chicago/Turabian StyleLuzhetskaya, Olesya P., Sergey E. Sedykh, and Georgy A. Nevinsky. 2020. "How Human H1 Histone Recognizes DNA" Molecules 25, no. 19: 4556. https://doi.org/10.3390/molecules25194556