Isopsoralen Enhanced Osteogenesis by Targeting AhR/ERα
Abstract
:1. Introduction
2. Results
2.1. IPRN Promoted the Osteogenic Differentiation and Mineralization of MC3T3-E1 Cells
2.2. IPRN Limited the Nucleocytoplasmic Shuttling of AhR
2.3. AhR Could Directly Bind to IPRN
2.4. AhR Agonists Inhibited IPRN-Induced Osteogenic Activity
2.5. IPRN Promoted the Expression of ERα in An AhR-Dependent Manner
3. Discussion
4. Materials and Methods
4.1. Animals and Chemicals
4.2. MC3T3-E1 Cell Culture
4.3. Alizarin Red and ALP Staining
4.4. ALP Activity Measurement
4.5. RT-qPCR
4.6. Western Blotting
4.7. Immunochemical Staining
4.8. DARTS Analysis
4.9. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Helmrich, G. Screening for osteoporosis. Clin. Obstet. Gynecol. 2013, 56, 659–666. [Google Scholar] [CrossRef] [PubMed]
- Coughlan, T.; Dockery, F. Osteoporosis and fracture risk in older people. Clin. Med. 2014, 14, 187–191. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sonigo, C.; Dray, G.; Chabbert-Buffet, N. Hormone replacement therapy: Practical aspects. J. Gynecol. Obst. Bio. R 2012, 41, F3–F12. [Google Scholar] [CrossRef] [PubMed]
- Wei, D.Z.; Guo, X.Y.; Lin, L.N.; Lin, M.X.; Gong, Y.Q.; Ying, B.Y.; Huang, M.Y. Effects of Angelicin on Ovalbumin (OVA)-Induced Airway Inflammation in a Mouse Model of Asthma. Inflammation 2016, 39, 1876–1882. [Google Scholar] [CrossRef] [PubMed]
- Lu, H.; Zhang, L.; Liu, D.; Tang, P.; Song, F. Isolation and purification of psoralen and isopsoralen and their efficacy and safety in the treatment of osteosarcoma in nude rats. Afr. Health Sci. 2014, 14, 641–647. [Google Scholar] [CrossRef] [PubMed]
- Yuan, X.; Bi, Y.; Yan, Z.; Pu, W.; Li, Y.; Zhou, K. Psoralen and Isopsoralen Ameliorate Sex Hormone Deficiency-Induced Osteoporosis in Female and Male Mice. BioMed Res. Int. 2016, 2016, 6869452. [Google Scholar] [CrossRef] [PubMed]
- Li, X.M.; Yang, Q.; Li, X.B.; Cheng, Q.; Zhang, K.; Han, J.; Zhao, J.N.; Liu, G.; Zhao, M.G. Estrogen-like neuroprotection of isopsoralen against spinal cord injury through estrogen receptor ERalpha. Metab. Brain Dis. 2017, 32, 259–265. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.H.; Oh, K.N.; Han, Y.; Choi, Y.H.; Lee, K.Y. Estrogen Receptor alpha Regulates Dlx3-Mediated Osteoblast Differentiation. Mol. Cells 2016, 39, 156–162. [Google Scholar] [CrossRef] [PubMed]
- Borjesson, A.E.; Lagerquist, M.K.; Windahl, S.H.; Ohlsson, C. The role of estrogen receptor alpha in the regulation of bone and growth plate cartilage. Cell Mol. Life Sci. 2013, 70, 4023–4037. [Google Scholar] [CrossRef] [PubMed]
- Yu, T.Y.; Pang, W.J.; Yang, G.S. Aryl hydrocarbon receptors in osteoclast lineage cells are a negative regulator of bone mass. PLoS ONE 2015, 10, e0117112. [Google Scholar] [CrossRef] [PubMed]
- Yu, H.; Du, Y.; Zhang, X.; Sun, Y.; Li, S.; Dou, Y.; Li, Z.; Yuan, H.; Zhao, W. The aryl hydrocarbon receptor suppresses osteoblast proliferation and differentiation through the activation of the ERK signaling pathway. Toxicol. Appl. Pharmacol. 2014, 280, 502–510. [Google Scholar] [CrossRef] [PubMed]
- Zhuang, X.M.; Zhong, Y.H.; Xiao, W.B.; Li, H.; Lu, C. Identification and characterization of psoralen and isopsoralen as potent CYP1A2 reversible and time-dependent inhibitors in human and rat preclinical studies. Drug Metab. Dispos. 2013, 41, 1914–1922. [Google Scholar] [CrossRef] [PubMed]
- Watson, J.D.; Prokopec, S.D.; Smith, A.B.; Okey, A.B.; Pohjanvirta, R.; Boutros, P.C. TCDD dysregulation of 13 AHR-target genes in rat liver. Toxicol. Appl. Pharmacol. 2014, 274, 445–454. [Google Scholar] [CrossRef] [PubMed]
- Esser, C.; Rannug, A. The aryl hydrocarbon receptor in barrier organ physiology, immunology, and toxicology. Pharmacol. Rev. 2015, 67, 259–279. [Google Scholar] [CrossRef] [PubMed]
- Pai, M.Y.; Lomenick, B.; Hwang, H.; Schiestl, R.; McBride, W.; Loo, J.A.; Huang, J. Drug affinity responsive target stability (DARTS) for small-molecule target identification. Methods Mol. Biol. 2015, 1263, 287–298. [Google Scholar] [CrossRef] [PubMed]
- Lomenick, B.; Hao, R.; Jonai, N.; Chin, R.M.; Aghajan, M.; Warburton, S.; Wang, J.; Wu, R.P.; Gomez, F.; Loo, J.A.; et al. Target identification using drug affinity responsive target stability (DARTS). Proc. Natl. Acad. Sci. USA 2009, 106, 21984–21989. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ohtake, F.; Fujii-Kuriyama, Y.; Kato, S. AhR acts as an E3 ubiquitin ligase to modulate steroid receptor functions. Biochem. Pharmacol. 2009, 77, 474–484. [Google Scholar] [CrossRef] [PubMed]
- Ohtake, F.; Fujii-Kuriyama, Y.; Kato, S. Transcription factor AhR is a ligand-dependcnt E3 ubiquitin ligase. Tanpakushitsu Kakusan Koso 2007, 52, 1973–1979. [Google Scholar] [PubMed]
- Yu, T.Y.; Kondo, T.; Matsumoto, T.; Fujii-Kuriyama, Y.; Imai, Y. Aryl hydrocarbon receptor catabolic activity in bone metabolism is osteoclast dependent in vivo. Biochem. Biophys. Res. Commun. 2014, 450, 416–422. [Google Scholar] [CrossRef] [PubMed]
- Nebert, D.W. Aryl hydrocarbon receptor (AHR): “pioneer member” of the basic-helix/loop/helix per-Arnt-sim (bHLH/PAS) family of “sensors” of foreign and endogenous signals. Prog. Lipid Res. 2017, 67, 38–57. [Google Scholar] [CrossRef] [PubMed]
- Nukaya, M.; Moran, S.; Bradfield, C.A. The role of the dioxin-responsive element cluster between the Cyp1a1 and Cyp1a2 loci in aryl hydrocarbon receptor biology. Proc. Natl. Acad. Sci. USA 2009, 106, 4923–4928. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tong, Y.; Niu, M.; Du, Y.; Mei, W.; Cao, W.; Dou, Y.; Yu, H.; Du, X.; Yuan, H.; Zhao, W. Aryl hydrocarbon receptor suppresses the osteogenesis of mesenchymal stem cells in collagen-induced arthritic mice through the inhibition of beta-catenin. Exp. Cell Res. 2017, 350, 349–357. [Google Scholar] [CrossRef] [PubMed]
- Tiong, C.T.; Chen, C.; Zhang, S.J.; Li, J.; Soshilov, A.; Denison, M.S.; Lee, L.S.; Tam, V.H.; Wong, S.P.; Xu, H.E.; et al. A novel prenylflavone restricts breast cancer cell growth through AhR-mediated destabilization of ERalpha protein. Carcinogenesis 2012, 33, 1089–1097. [Google Scholar] [CrossRef] [PubMed]
- Melville, K.M.; Kelly, N.H.; Khan, S.A.; Schimenti, J.C.; Ross, F.P.; Main, R.P.; van der Meulen, M.C. Female mice lacking estrogen receptor-alpha in osteoblasts have compromised bone mass and strength. J. Bone Miner. Res. 2014, 29, 370–379. [Google Scholar] [CrossRef] [PubMed]
- Ellis, A.J.; Hendrick, V.M.; Williams, R.; Komm, B.S. Selective estrogen receptor modulators in clinical practice: A safety overview. Expert Opin. Drug Saf. 2015, 14, 921–934. [Google Scholar] [CrossRef] [PubMed]
- Yogui, F.C.; Momesso, G.A.C.; Faverani, L.P.; Polo, T.O.B.; Ramalho-Ferreira, G.; Hassumi, J.S.; Rossi, A.C.; Freire, A.R.; Prado, F.B.; Okamoto, R. A SERM increasing the expression of the osteoblastogenesis and mineralization-related proteins and improving quality of bone tissue in an experimental model of osteoporosis. J. Appl. Oral Sci. 2018, 26, e20170329. [Google Scholar] [CrossRef] [PubMed]
- Hsu, C.T.; Huang, Y.F.; Hsieh, C.P.; Wu, C.C.; Shen, T.S. JNK Inactivation Induces Polyploidy and Drug-Resistance in Coronarin D-Treated Osteosarcoma Cells. Molecules 2018, 23, 2121. [Google Scholar] [CrossRef] [PubMed]
Sample Availability: Samples of the compounds are not available from the authors. |
Name | Sequence |
---|---|
ALP | 3′→5′: ACGAGGTCACGRCCATCCT 5′→3′: CCGAGTGGTGGTCACGAT |
RUNX2 | 3′→5′: CCACAGAGCTATTAAAGTGACAGTG 5′→3′: ACAAACTAGGTTTAGAGTCATCAAGC |
COL1A1 | 3′→5′: GCATGGCCAAGAAGACATCC 5′→3′: CCTCGGGTTTCCACGTCTC |
CYP1A1 | 3′→5′: GGCCACTTTGACCCTTACAA 5′→3′: CAGGTAACGGAGGACAGGAA TCACGAT |
GAPDH | 3′→5′: TGGGAAGCTGGTCATCAAC 5′→3′: GCATCACCCCATTTGATGTT |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ge, L.; Cui, Y.; Cheng, K.; Han, J. Isopsoralen Enhanced Osteogenesis by Targeting AhR/ERα. Molecules 2018, 23, 2600. https://doi.org/10.3390/molecules23102600
Ge L, Cui Y, Cheng K, Han J. Isopsoralen Enhanced Osteogenesis by Targeting AhR/ERα. Molecules. 2018; 23(10):2600. https://doi.org/10.3390/molecules23102600
Chicago/Turabian StyleGe, Luna, Yazhou Cui, Kai Cheng, and Jinxiang Han. 2018. "Isopsoralen Enhanced Osteogenesis by Targeting AhR/ERα" Molecules 23, no. 10: 2600. https://doi.org/10.3390/molecules23102600
APA StyleGe, L., Cui, Y., Cheng, K., & Han, J. (2018). Isopsoralen Enhanced Osteogenesis by Targeting AhR/ERα. Molecules, 23(10), 2600. https://doi.org/10.3390/molecules23102600