Marine Toxin Okadaic Acid Affects the Immune Function of Bay Scallop (Argopecten irradians)
Abstract
:1. Introduction
2. Results
2.1. Non-Specific Immune Responses
2.1.1. Total Hemocyte Count (THC)
2.1.2. Reactive Oxygen Species (ROS) Level
2.1.3. Malondialdehyde (MDA) Level
2.1.4. Nitric Oxide (NO) Level
2.1.5. Glutathione (GSH) Level
2.1.6. Lactate Dehydrogenase (LDH) Activity
2.2. Expression of Immune-System-Related Genes
2.2.1. Expression of CTL-6 Gene
2.2.2. Expression of FREP Gene
2.2.3. Expression of HSP90 Gene
2.2.4. Expression of MT Gene
2.2.5. Expression of Cu/ZnSOD Gene
3. Discussion
4. Materials and Methods
4.1. Okadaic Acid
4.2. Animals
4.3. Measurement of Non-Specific Immune Responses
4.3.1. Total Hemocyte Count
4.3.2. Measurement of Reactive Oxygen Species Production
4.3.3. Measurement of Malondialdehyde Content
4.3.4. Measurement of Nitric Oxide Assay
4.3.5. Measurement of Glutathione Assay
4.3.6. Measurement of Lactate Dehydrogenase Assay
4.4. RNA Extraction and Reverse Transcription
4.5. Real-Time Quantitative PCR Analyses of Gene Expression
4.6. Statistical Analysis
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Simões, E.; Vieira, R.C.; Schramm, M.A.; Mello, D.F.; Pontinha, V.D.A.; da Silva, P.M.; Barracco, M.A. Impact of harmful algal blooms (Dinophysis acuminata) on the immune system of oysters and mussels from Santa Catarina, Brazil. J. Mar. Biol. Assoc. UK 2015, 95, 773–781. [Google Scholar] [CrossRef]
- Li, D.; Zhang, H.; Fu, L.; An, X.; Zhang, B.; Li, Y.; Cheng, Z.; Zheng, W.; Yi, L.; Zheng, T. A novel algicide: Evidence of the effect of a fatty acid compound from the marine bacterium, Vibrio sp. Bs02 on the harmful dinoflagellate, Alexandrium tamarense. PLoS ONE 2014, 9, e91201. [Google Scholar] [CrossRef] [PubMed]
- Huang, L.; Zou, Y.; Weng, H.W.; Li, H.Y.; Liu, J.S.; Yang, W.D. Proteomic profile in Perna viridis after exposed to Prorocentrum lima, a dinoflagellate producing DSP toxins. Environ. Pollut. 2015, 196, 350–357. [Google Scholar] [CrossRef] [PubMed]
- Gerssen, A.; Pol-Hofstad, I.E.; Poelman, M.; Mulder, P.P.J.; van den Top, H.J.; de Boer, J. Marine toxins: Chemistry, toxicity, occurrence and detection, with special reference to the Dutch situation. Toxins 2010, 2, 878–904. [Google Scholar] [CrossRef] [PubMed]
- Espiña, B.; Louzao, M.; Cagide, E.; Alfonso, A.; Vieytes, M.R.; Yasumoto, T.; Botana, L.M. The methyl ester of okadaic acid is more potent than okadaic acid in disrupting the actin cytoskeleton and metabolism of primary cultured hepatocytes. Br. J. Pharmacol. 2010, 159, 337–344. [Google Scholar] [CrossRef] [PubMed]
- Prado-Alvarez, M.; Flórez-Barrós, F.; Méndez, J.; Fernandez-Tajes, J. Effect of okadaic acid on carpet shell clam (Ruditapes decussatus) haemocytes by in vitro exposure and harmful algal bloom simulation assays. Cell Biol. Toxicol. 2013, 29, 189–197. [Google Scholar] [CrossRef] [PubMed]
- Mat, A.M.; Haberkorn, H.; Bourdineaud, J.P.; Massabuau, J.C.; Tran, D. Genetic and genotoxic impacts in the oyster Crassostrea gigas exposed to the harmful alga Alexandrium minutum. Aquat. Toxicol. 2013, 140–141, 458–465. [Google Scholar] [CrossRef] [PubMed]
- Pinto-Silva, C.R.; Creppy, E.E.; Matias, W.G. Micronucleus test in mussels Perna perna fed with the toxic dinoflagellate Prorocentrum lima. Arch. Toxicol. 2005, 79, 422–426. [Google Scholar] [CrossRef] [PubMed]
- Mello, D.F.; Proença, L.A.; Barracco, M.A. Comparative study of various immune parameters in three bivalve species during a natural bloom of Dinophysis acuminata in Santa Catarina Island, Brazil. Toxins 2010, 2, 1166–1178. [Google Scholar] [CrossRef] [PubMed]
- Galimany, E.; Sunila, I.; Hégaret, H.; Ramón, M.; Wikfors, G.H. Pathology and immune response of the blue mussel (Mytilus edulis L.) after an exposure to the harmful dinoflagellate Prorocentrum minimum. Harmful Algae 2008, 7, 630–638. [Google Scholar] [CrossRef]
- Galimany, E.; Sunila, I.; Hégaret, H.; Ramón, M.; Wikfors, G.H. Experimental exposure of the blue mussel (Mytilus edulis, L.) to the toxic dinoflagellate Alexandrium fundyense: Histopathology, immune responses, and recovery. Harmful Algae, 2008, 7, 702–711. [Google Scholar] [CrossRef]
- Gao, Q.; Zhao, J.; Song, L.; Qiu, L.; Yu, Y.; Zhang, H.; Ni, D. Molecular cloning, characterization and expression of heat shock protein 90 gene in the haemocytes of bay scallop Argopecten irradians. Fish Shellfish Immunol. 2008, 24, 379–385. [Google Scholar] [CrossRef] [PubMed]
- Hannam, M.L.; Bamber, S.D.; Moody, J.A.; Galloway, T.S.; Jones, M.B. Immune function in the Arctic Scallop, Chlamys islandica, following dispersed oil exposure. Aquat. Toxicol. 2009, 92, 187–194. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Mai, K.; Ma, H.; Wang, X.; Deng, D.; Liu, X.; Xu, W.; Liufu, Z.; Zhang, W.; Tan, B.; et al. Effects of dissolved oxygen on survival and immune responses of scallop (Chlamys farreri Jones et Preston). Fish Shellfish Immunol. 2007, 22, 272–281. [Google Scholar] [CrossRef] [PubMed]
- Frantzen, M.; Regoli, F.; Ambrose, W.G.; Nahrgang, J.; Geraudie, P.; Benedetti, M.; Locke, V.W.L.; Camus, L. Biological effects of mechanically and chemically dispersed oil on the Icelandic scallop (Chlamys islandica). Ecotoxicol. Environ. Saf. 2016, 127, 95–107. [Google Scholar] [CrossRef] [PubMed]
- Chi, C.; Jiang, B.; Yu, X.B.; Liu, T.Q.; Xia, L.; Wang, G.X. Effects of three strains of intestinal autochthonous bacteria and their extracellular products on the immune response and disease resistance of common carp, Cyprinus carpio. Fish Shellfish Immunol. 2014, 36, 9–18. [Google Scholar] [CrossRef] [PubMed]
- Senthil, N.S.; Kalaivani, K.; Chung, P.G.; Murugan, K. Effect of neem limonoids on lactate dehydrogenase (LDH) of the rice leaffolder, Cnaphalocrocis medinalis (Guenée) (Insecta: Lepidoptera: Pyralidae). Chemosphere 2006, 62, 1388–1393. [Google Scholar] [CrossRef] [PubMed]
- El-Demerdash, F.M. Oxidative stress and hepatotoxicity induced by synthetic pyrethroids-organophosphate insecticides mixture in rat. J. Environ. Sci. Health C 2011, 29, 145–158. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Q.; Zhou, Z.; Wang, L.; Shi, X.; Wang, J.; Yue, F.; Yi, Q.; Yang, C.; Song, L. The immunomodulation of inducible nitric oxide in scallop Chlamys farreri. Fish Shellfish Immunol. 2013, 34, 100–108. [Google Scholar] [CrossRef] [PubMed]
- Ravindran, J.; Gupta, N.; Agrawal, M.; Bala Bhaskar, A.S.; Lakshmana Rao, P.V. Modulation of ROS/MAPK signaling pathways by okadaic acid leads to cell death via, mitochondrial mediated caspase-dependent mechanism. Apoptosis 2011, 16, 145–161. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Wang, L.; Yao, C.; Qiu, L.; Zhang, H.; Zhi, Z.; Song, L. Alternation of immune parameters and cellular energy allocation of Chlamys farreri under ammonia-N exposure and Vibrio anguillarum challenge. Fish Shellfish Immunol. 2012, 32, 741–749. [Google Scholar] [CrossRef] [PubMed]
- Hégaret, H.; da Silva, P.M.; Sunila, I.; Shumway, S.E.; Dixon, M.S.; Alix, J.; Wikfors, G.H.; Soudant, P. Perkinsosis in the Manila clam Ruditapes philippinarum affects responses to the harmful-alga, Prorocentrum minimum. J. Exp. Mar. Biol. Ecol. 2009, 371, 112–120. [Google Scholar] [CrossRef]
- Chi, C.; Giri, S.S.; Jun, J.W.; Kim, H.J.; Kim, S.G.; Yun, S.; Park, S.C. Effect of the Algaecide Palmitoleic Acid on the Immune Function of the Bay Scallop Argopecten irradians. Molecules 2016, 21, 610. [Google Scholar] [CrossRef] [PubMed]
- Hannam, M.L.; Bamber, S.D.; Galloway, T.S.; Moody, A.J.; Jones, M.B. Effects of the model PAH phenanthrene on immune function and oxidative stress in the haemolymph of the temperate scallop Pecten maximus. Chemosphere 2010, 78, 779–784. [Google Scholar] [CrossRef] [PubMed]
- Gestal, C.; Roch, P.; Renault, T.; Pallavicini, A.; Paillard, C.; Novoa, B.; Oubella, R.; Venier, P.; Figueras, A. Study of diseases and the immune system of bivalves using molecular biology and genomics. Rev. Fish Sci. 2008, 16, 133–156. [Google Scholar] [CrossRef]
- Romano, G.; Costantini, M.; Buttino, I.; Ianora, A.; Palumbo, A. Nitric oxide mediates the stress response induced by diatom aldehydes in the sea urchin Paracentrotus lividus. PLoS ONE 2011, 6, e25980. [Google Scholar] [CrossRef] [PubMed]
- Migliaccio, O.; Castellano, I.; Cirino, P.; Romano, G.; Palumbo, A. Maternal exposure to cadmium and manganese impairs reproduction and progeny fitness in the sea urchin Paracentrotus lividus. PLoS ONE 2015, 10, e0131815. [Google Scholar] [CrossRef] [PubMed]
- Migliaccio, O.; Castellano, I.; Romano, G.; Palumbo, A. Stress response to cadmium and manganese in Paracentrotus lividus developing embryos is mediated by nitric oxide. Aquat. Toxicol. 2014, 156, 125–134. [Google Scholar] [CrossRef] [PubMed]
- De Barros, C.M.; Emrich, L.C.; Mello, A.A.; da Fonseca, R.N.; Allodi, S. Regulation of nitric-oxide production in hemocytes of the ascidian Phallusia nigra. Nitric Oxide 2014, 38, 26–36. [Google Scholar] [CrossRef] [PubMed]
- Migliaccio, O.; Castellano, I.; Cioccio, D.D.; Tedeschi, G.; Negri, A.; Cirino, P.; Romano, G.; Zingone, A.; Palumbo, A. Subtle reproductive impairment through nitric oxide-mediated mechanisms in sea urchins from an area affected by harmful algal blooms. Sci. Rep. 2016, 6, 26086. [Google Scholar] [CrossRef] [PubMed]
- Jaiswal, S.K.; Siddiqi, N.J.; Sharma, B. Studies on the ameliorative effect of curcumin on carbofuran induced perturbations in the activity of lactate dehydrogenase in wistar rats. Saudi J. Biol. Sci. 2016. [Google Scholar] [CrossRef]
- Traoré, A.; Bonini, M.; Dano, S.D.; Creppy, E.E. Synergistic effects of some metals contaminating mussels on the cytotoxicity of the marine toxin okadaic acid. Arch. Toxicol. 1999, 73, 289–295. [Google Scholar] [CrossRef] [PubMed]
- Pan, L.; Ren, J.; Liu, J. Responses of antioxidant systems and LPO level to benzo(a)pyrene and benzo(k)fluoranthene in the haemolymph of the scallop Chlamys ferrari. Environ. Pollut. 2006, 141, 443–451. [Google Scholar] [CrossRef] [PubMed]
- Hannam, M.L.; Bamber, S.D.; Moody, A.J.; Galloway, T.S.; Jones, M.B. Immunotoxicity and oxidative stress in the Arctic scallop Chlamys islandica: Effects of acute oil exposure. Ecotox. Environ. Safe 2010, 73, 1440–1448. [Google Scholar] [CrossRef] [PubMed]
- Wang, G.X.; Zhou, Z.; Jiang, D.X.; Han, J.; Wang, J.F.; Zhao, L.W.; Li, J. In vivo anthelmintic activity of five alkaloids from Macleaya microcarpa (Maxim) Fedde against Dactylogyrus intermedius in Carassius auratus. Vet. Parasitol. 2010, 171, 305–313. [Google Scholar] [CrossRef] [PubMed]
- Tang, B.; Liu, B.; Wang, X.; Yue, X.; Xiang, J. Physiological and immune responses of zhikong scallop Chlamys farreri to the acute viral necrobiotic virus infection. Fish Shellfish Immunol. 2010, 29, 42–48. [Google Scholar] [CrossRef] [PubMed]
- Manfrin, C.; Dreos, R.; Battistella, S.; Beran, A.; Gerdol, M.; Varotto, L.; Lanfranchi, G.; Venier, P.; Pallavicini, A. Mediterranean mussel gene expression profile induced by okadaic acid exposure. Environ. Sci. Technol. 2010, 44, 8276–8283. [Google Scholar] [CrossRef] [PubMed]
- Miles, A.T.; Hawksworth, G.M.; Beattie, J.H.; Rodilla, V. Induction, regulation, degradation, and biological significance of mammalian metallothioneins. Crit. Rev. Biochem. Mol. Biol. 2000, 35, 35–70. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Song, L.; Ni, D.; Zhang, H.; Liu, W. Alteration of metallothionein mRNA in bay scallop Argopecten irradians under cadmium exposure and bacteria challenge. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2009, 149, 50–57. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Wang, L.; Song, L.; Song, X.; Wang, B.; Mu, C.; Zhang, Y. A fibrinogen-related protein from bay scallop Argopecten irradians involved in innate immunity as pattern recognition receptor. Fish Shellfish Immunol. 2009, 26, 56–64. [Google Scholar] [CrossRef] [PubMed]
- Chi, C.; Liu, J.-Y.; Fei, S.Z.; Zhang, C.; Chang, Y.Q.; Liu, X.L.; Wang, G.X. Effect of intestinal autochthonous probiotics isolated from the gut of sea cucumber (Apostichopus japonicus) on immune response and growth of A. japonicus. Fish Shellfish Immunol. 2014, 38, 367–373. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−△△CT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Sample Availability: Not available.



| Genes | Primer Sequence | Accession No. |
|---|---|---|
| β-actin | F: 5′CAAACAGCAGCCTCCTCGTCA 3′ | AY335441 |
| R: 5′CTGGGCACCTGAACCTTTCGTT 3′ | ||
| CTL-6 | F: 5′CAGTTGCTACAGGGTTCG 3′ | GQ202279 |
| R: 5′GGGCGTTATCTGGCTCAT 3′ | ||
| FREP | F: 5′CGTCGCAAATGCTGAAGATG 3′ | EU399719 |
| R: 5′TAAGTTGTGGTCGGTCCTGAGA 3′ | ||
| HSP90 | F: 5′TCAGTATGGTTGGTCCGCTAA 3′ | EF532406 |
| R: 5′CGGTTGCCTTTTCCTTCAGA 3′ | ||
| MT | F: 5′AACTTGCTGTAGTGGGAATG 3′ | EU734181 |
| R: 5′AGGCTGGAAACTGCTGTGGT 3′ | ||
| Cu/ZnSOD | F: 5′GTATTGAAAGGTGATTCGGAGG 3′ | EU563958 |
| R: 5′ATGCACATGAAAGCCATGTAGG 3′ |
© 2016 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC-BY) license ( http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chi, C.; Giri, S.S.; Jun, J.W.; Kim, H.J.; Yun, S.; Kim, S.G.; Park, S.C. Marine Toxin Okadaic Acid Affects the Immune Function of Bay Scallop (Argopecten irradians). Molecules 2016, 21, 1108. https://doi.org/10.3390/molecules21091108
Chi C, Giri SS, Jun JW, Kim HJ, Yun S, Kim SG, Park SC. Marine Toxin Okadaic Acid Affects the Immune Function of Bay Scallop (Argopecten irradians). Molecules. 2016; 21(9):1108. https://doi.org/10.3390/molecules21091108
Chicago/Turabian StyleChi, Cheng, Sib Sankar Giri, Jin Woo Jun, Hyoun Joong Kim, Saekil Yun, Sang Guen Kim, and Se Chang Park. 2016. "Marine Toxin Okadaic Acid Affects the Immune Function of Bay Scallop (Argopecten irradians)" Molecules 21, no. 9: 1108. https://doi.org/10.3390/molecules21091108
APA StyleChi, C., Giri, S. S., Jun, J. W., Kim, H. J., Yun, S., Kim, S. G., & Park, S. C. (2016). Marine Toxin Okadaic Acid Affects the Immune Function of Bay Scallop (Argopecten irradians). Molecules, 21(9), 1108. https://doi.org/10.3390/molecules21091108
