Identification of the Valid Reference Genes for Quantitative RT-PCR in Annual Ryegrass (Lolium multiflorum) under Salt Stress
Abstract
:1. Introduction
2. Results and Discussion
2.1. Verification of Specificity of RT-PCR and qRT-PCR Products
| Gene Name | Accession ID | Gene Description | Primer Sequence (5'-3') | Amplicon Length (bp) |
|---|---|---|---|---|
| Actin | AJ585201 | actin | F TCCTCACGCCATTCTT | 131 |
| R TCTCCTTGATGTCCCT | ||||
| GAPDH | EL664147.1 | glyceraldehyde-3-phosphate dehydrogenase | F GCCACCTATGACCAGA | 157 |
| R CGTTCAGAGCAATCCC | ||||
| eIF-5A | EL664154.1 | translation initiation factor 5A | F CCCCAGGTAAACTTCC | 154 |
| R CAGATAGGTATGGCAAC | ||||
| eEF1A(s) | EZ421973 | elongation factor 1-α-like protein | F GATGATTCCCACCAAGC | 200 |
| R TAGTAGCAGACAACCACCAG | ||||
| EF1-a | Z50789 | elongation factor 1-α | F TATTGCCCTGTGGAAGTT | 138 |
| R GTGGTGGAGTCAATGATAAG | ||||
| YT521-B | EZ421977 | YT521-B-like protein | F AGGGCAAACCAGTCAC | 137 |
| R TTGGCGGTTCTCATAG | ||||
| TBP-1 | EZ421974 | 26S protease regulatory subunit-like protein | F CGAGATGCCTTTGAG | 188 |
| R GCGGCAATCACCTTTA | ||||
| P5CS1 | JX470539 | delta-1-pyrroline-5-carboxylate | F ATAACCAATGCTATCCCTGAC R TCTTAGTCGTTGCCTTGA | 160 |
| Cyt-Cu/Zn SOD | JQ269677 | cytosolic Cu/Zn superoxide | F GGCTGAGTATCCCATTT R CTGCCTTTGCTGTTCT | 87 |


2.2. Expression Levels of Seven Reference Genes

2.3. Stability Ranking of Seven Reference Genes in Leaves
| Ranking Order (Better—Good—Average) in Leaves | |||||||
|---|---|---|---|---|---|---|---|
| Method | 1 | 2 | 3 | 4 | 5 | 6 | 7 |
| Delta CT | eEF1A(s) 1.12 | GAPDH 1.15 | Actin 1.23 | TBP-1 1.29 | YT521-B 1.57 | EF1-a 1.86 | eIF-5A 1.87 |
| BestKeeper | eIF-5A 0.67 | TBP-1 1.07 | GAPDH 1.22 | eEF1A(s) 1.38 | YT521-B 1.46 | Actin 1.75 | EF1-a 2.45 |
| Normfinder | eEF1A(s) 0.239 | GAPDH 0.356 | Actin 0.611 | TBP-1 0.744 | YT521-B 1.188 | EF1-a 1.685 | eIF-5A 1.685 |
| Genorm | GAPDH | eEF1A(s) 0.661 | TBP-1 0.771 | Actin 0.871 | YT521-B 1.073 | EF1-a 1.272 | eIF-5A 1.442 | |
| Recommended Comprehensive ranking | eEF1A(s) 1.41 | GAPDH 1.86 | TBP-1 3.13 | Actin 3.83 | eIF-5A 4.30 | YT521-B 5.00 | EF1-a 6.24 |
2.4. Stability of Seven Reference Genes in Roots
| Ranking Order (Better–Good–Average) in Roots | |||||||
|---|---|---|---|---|---|---|---|
| Method | 1 | 2 | 3 | 4 | 5 | 6 | 7 |
| Delta CT | TBP-1 3.03 | Actin 3.18 | eEF1A(s) 3.19 | EF1-a 3.35 | YT521-B 3.41 | GAPDH 3.59 | eIF-5A 3.99 |
| BestKeeper | YT521-B 2.88 | TBP-1 3.42 | EF1-a 3.47 | Actin 3.63 | eIF-5A 3.77 | GAPDH 4.11 | eEF1A(s) 4.31 |
| Normfinder | TBP-1 1.775 | eEF1A(s) 2.048 | Actin 2.150 | EF1-a 2.302 | YT521-B 2.439 | GAPDH 2.721 | eIF-5A 3.315 |
| Genorm | Actin | TBP-1 1.978 | eEF1A(s) 2.597 | YT521-B 2.809 | EF1-a 2.977 | GAPDH 3.156 | eIF-5A 3.395 | |
| Recommended Comprehensive ranking | TBP-1 1.19 | Actin 2.21 | YT521-B 3.16 | eEF1A(s) 3.35 | EF1-a 3.94 | GAPDH 6.00 | eIF-5A 6.44 |
2.5. Stability Ranking of Seven Reference Genes in All Samples
| Ranking Order (Better–Good–Average) in all Samples | |||||||
|---|---|---|---|---|---|---|---|
| Method | 1 | 2 | 3 | 4 | 5 | 6 | 7 |
| Delta CT | TBP-1 2.60 | Actin 2.64 | eEF1A(s) 2.80 | EF1-a 2.96 | GAPDH 3.16 | YT521-B 3.22 | eIF-5A 3.65 |
| BestKeeper | YT521-B 2.48 | GAPDH 2.89 | EF1-a 3.34 | Actin 3.50 | TBP-1 3.55 | eEF1A(s) 4.19 | eIF-5A 4.34 |
| Normfinder | TBP-1 1.369 | Actin 1.540 | eEF1A(s) 1.755 | EF1-a 2.024 | GAPDH 2.386 | YT521-B 2.470 | eIF-5A 3.101 |
| Genorm | Actin | TBP-1 1.650 | eEF1A(s) 2.020 | EF1-a 2.355 | GAPDH 2.607 | YT521-B 2.747 | eIF-5A 3.005 | |
| Recommended Comprehensive ranking | TBP-1 1.50 | Actin 2.00 | eEF1A(s) 3.57 | EF1-a 3.72 | YT521-B 3.83 | GAPDH 3.98 | eIF-5A 7.00 |
2.6. Validation of the Stability Reference Genes Identified from This Study

2.7. Discussion
3. Experimental Section
3.1. Plant Materials and Growth Conditions
3.2. Treatments
3.3. RNA Isolation and cDNA Synthesis
3.4. Primer Design and qRT-PCR Analysis
3.5. Data Analysis
4. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Olsvik, P.A.; Søfteland, L.; Lie, K.K. Selection of reference genes for qRT-PCR examination of wild populations of Atlantic cod Gadus morhua. BMC Res. Notes 2008, 1, 47. [Google Scholar] [CrossRef] [PubMed]
- Guénin, S.; Mauriat, M.; Pelloux, J.; van Wuytswinkel, O.; Bellini, C.; Gutierrez, L. Normalization of qRT-PCR data: The necessity of adopting a systematic, experimental conditions-specific, validation of references. J. Exp. Bot. 2009, 60, 487–493. [Google Scholar] [CrossRef] [PubMed]
- Ahn, K.; Huh, J.W.; Park, S.J.; Kim, D.S.; Ha, H.S.; Kim, Y.J.; Lee, J.R.; Chang, K.T.; Kim, H.S. Selection of internal reference genes for SYBR green qRT-PCR studies of rhesus monkey (Macaca mulatta) tissues. BMC Mol. Biol. 2008, 9, 78. [Google Scholar] [CrossRef] [PubMed]
- Jain, M. Genome-wide identification of novel internal control genes for normalization of gene expression during various stages of development in rice. Plant Sci. 2009, 176, 702–706. [Google Scholar] [CrossRef]
- Chen, L.; Zhong, H.Y.; Kuang, J.F.; Li, J.G.; Lu, W.J.; Chen, J.Y. Validation of reference genes for RT-qPCR studies of gene expression in banana fruit under different experimental conditions. Planta 2011, 234, 377–390. [Google Scholar] [CrossRef] [PubMed]
- Garg, R.; Sahoo, A.; Tyagi, A.K.; Jain, M. Validation of internal control genes for quantitative gene expression studies in chickpea (Cicer arietinum L.). Biochem. Biophys. Res. Commun. 2010, 396, 283–288. [Google Scholar] [CrossRef] [PubMed]
- Luo, H.; Li, H.; Zhang, X.; Fu, J. Antioxidant responses and gene expression in perennial ryegrass (Lolium perenne L.) under cadmium stress. Ecotoxicology 2011, 20, 770–778. [Google Scholar] [CrossRef] [PubMed]
- Kianianmomeni, A.; Hallmann, A. Validation of reference genes for quantitative gene expression studies in Volvox carteri using real-time RT-PCR. Mol. Boil. Rep. 2013, 40, 6691–6699. [Google Scholar] [CrossRef]
- Dheda, K.; Huggett, J.F.; Bustin, S.A.; Johnson, M.A.; Rook, G.; Zumla, A. Validation of housekeeping genes for normalizing RNA expression in real-time PCR. Biotechniques 2004, 37, 112–119. [Google Scholar] [PubMed]
- Martin, R.C.; Hollenbeck, V.G.; Dombrowski, J.E. Evaluation of Reference Genes for Quantitative RT-PCR in Lolium perenne. Crop. Sci. 2008, 48, 1881–1887. [Google Scholar] [CrossRef]
- Lee, J.M.; Roche, J.R.; Donaghy, D.J.; Thrush, A.; Sathish, P. Validation of reference genes for quantitative RT-PCR studies of gene expression in perennial ryegrass (Lolium perenne L.). BMC Mol. Biol. 2010, 11, 8. [Google Scholar] [CrossRef] [PubMed]
- Huang, L.K.; Yan, H.D.; Jiang, X.M.; Yin, G.H.; Zhang, X.Q.; Qi, X.; Zhang, Y.; Yan, Y.H.; Ma, X.; Peng, Y. Identification of Candidate Reference Genes in Perennial Ryegrass for Quantitative RT-PCR under Various Abiotic Stress Conditions. PLoS One 2014, 9, e93724. [Google Scholar] [CrossRef] [PubMed]
- Lin, F.; Jiang, L.; Liu, Y.; Lv, Y.; Dai, H.; Zhao, H. Genome-wide identification of housekeeping genes in maize. Plant Mol. Biol. 2014, 86, 543–554. [Google Scholar] [CrossRef] [PubMed]
- Czechowski, T.; Stitt, M.; Altmann, T.; Udvardi, M.K.; Scheible, W.R. Genome-wide identification and testing of superior reference genes for transcript normalization in Arabidopsis. Plant Physiol. 2005, 139, 5–17. [Google Scholar] [CrossRef] [PubMed]
- Mehta, R.; Birerdinc, A.; Hossain, N.; Afendy, A.; Chandhoke, V.; Younossi, Z.; Baranova, A. Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples. BMC Mol. Biol. 2010, 11, 39. [Google Scholar] [CrossRef] [PubMed]
- Olsvik, P.A.; Lie, K.K.; O Jordal, A.E.; O Nilsen, T.; Hordvik, I. Evaluation of potential reference genes in real-time RT-PCR studies of Atlantic salmon. BMC Mol. Biol. 2005, 6, 21. [Google Scholar] [CrossRef] [PubMed]
- Rieu, I.; Powers, S.J. Real-Time Quantitative RT-PCR: Design, Calculations, and Statistics. Plant Cell 2009, 21, 1031–1033. [Google Scholar] [CrossRef] [PubMed]
- Udvardi, M.K.; Czechowski, T.; Scheible, W.R. Eleven golden rules of quantitative RT-PCR. Plant Cell 2008, 20, 1736–1737. [Google Scholar] [CrossRef] [PubMed]
- Qiu, Z.; Guo, J.; Zhu, A.; Zhang, L.; Zhang, M. Exogenous jasmonic acid can enhance tolerance of wheat seedlings to salt stress. Ecotoxicol. Environ. Saf. 2014, 104, 202–208. [Google Scholar] [CrossRef] [PubMed]
- Adolf, V.I.; Jacobsen, S.E.; Shabala, S. Salt tolerance mechanisms in quinoa (Chenopodium quinoa Willd.). Environ. Exp. Bot. 2013, 92, 43–54. [Google Scholar] [CrossRef]
- Chen, S.; Hawighorst, P.; Sun, J.; Polle, A. Salt tolerance in Populus: Significance of stress signaling networks, mycorrhization, and soil amendments for cellular and whole-plant nutrition. Environ. Exp. Bot. 2014, 107, 113–124. [Google Scholar] [CrossRef]
- Kovda, V.A. Loss of productive land due to salinization. Ambio 1983, 10, 91–93. [Google Scholar]
- Li, H.; Hu, T.; Fu, J. Identification of genes associated with adaptation to NaCl toxicity in perennial ryegrass (Lolium perenne L.). Ecotoxicol. Environ. Saf. 2012, 79, 153–162. [Google Scholar] [CrossRef] [PubMed]
- Castanheira, N.; Dourado, A.C.; Alves, P.I.; Cortés-Pallero, A.M.; Delgado-Rodríguez, A.I.; Prazeres, Â.; Prazeres, A.; Borges, N.; Sánchez, C.; Crespo, M.T.B.; et al. Annual ryegrass-associated bacteria with potential for plant growth promotion. Microbiol. Res. 2014, 169, 768–779. [Google Scholar] [CrossRef]
- Wang, S.; Li, H.; Lin, C. Physiological, biochemical and growth responses of Italian ryegrass to butachlor exposure. Pestic. Biochem. Physiol. 2013, 106, 21–27. [Google Scholar] [CrossRef]
- Wang, X.; Ma, X.; Zhang, X.Q.; Zhou, K.; Ma, Y.M. Effects of four different sodium salts stress on seeds germination of annual ryegrass. Chin. J. Grassl. 2014, 36, 44–51. [Google Scholar]
- Hasegawa, P.M. Sodium (Na+) homeostasis and salt tolerance of plants. Environ. Exp. Bot. 2013, 92, 19–31. [Google Scholar] [CrossRef]
- Razavizadeh, R.; Ehsanpour, A.A. Effects of salt stress on proline content, expression of delta-1-pyrroline-5-carboxylatesynthetase, and activities of catalase and ascorbate peroxidase in transgenic tobacco plants. Biol. Lett. 2009, 46, 63–75. [Google Scholar] [CrossRef]
- Silva-Ortega, C.O.; Ochoa-Alfaro, A.E.; Reyes-Agüero, J.A.; Aguado-Santacruz, G.A.; Jiménez-Bremont, J.F. Salt stress increases the expression of p5cs gene and induces proline accumulation in cactus pear. Plant Physiol. Biochem. 2008, 46, 82–92. [Google Scholar] [CrossRef] [PubMed]
- Kishor, P.B.K.; Hong, Z.; Miao, C.H.; Hu, C.A.A.; Verma, D.P.S. Overexpression of [delta]-pyrroline-5-carboxylate synthetase increases proline production and confers osmotolerance in transgenic plants. Plant Physiol. 1995, 108, 1387–1394. [Google Scholar] [PubMed]
- Su, J.; Wu, R. Stress-inducible synthesis of proline in transgenic rice confers faster growth under stress conditions than that with constitutive synthesis. Plant Sci. 2004, 166, 941–948. [Google Scholar] [CrossRef]
- Sawahal, W.A.; Hassan, A.H. Generation of transgenic wheat plants producing higher levels of the osmoprotectant proline. Biotechnol. Let. 2002, 24, 721–725. [Google Scholar] [CrossRef]
- Dombrowski, J.E.; Martin, R.C. Evaluation of reference genes for quantitative RT-PCR in loliun temulentum. Plant Sci. 2009, 176, 390–396. [Google Scholar] [CrossRef]
- Ashraf, M.; Akram, N.A. Improving salinity tolerance of plants through conventional breeding and genetic engineering: An analytical comparison. Biotechnol. Adv. 2009, 27, 744–752. [Google Scholar] [CrossRef]
- Gill, S.S.; Tuteja, N. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol. Biochem. 2010, 48, 909–930. [Google Scholar] [CrossRef] [PubMed]
- Ashraf, M. Biotechnological approach of improving plant salt tolerance using antioxidants as marks. Biotechnol. Adv. 2009, 27, 84–93. [Google Scholar] [CrossRef] [PubMed]
- Hu, L.; Li, H.; Pang, H.; Fu, J. Responses of antioxidant gene, protein and enzymes to salinity stress in two genotypes of perennial ryegrass (Lolium perenne) differing in salt tolerance. J. Plant Physiol. 2012, 169, 146–156. [Google Scholar] [CrossRef] [PubMed]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucl. Acids Res. 2001, 29, 2002–2007. [Google Scholar] [CrossRef]
- Xu, N.X.; Gu, H.R.; Feng, B.Q.; Zhang, X.; Cheng, Y.H.; Ding, C.L. Evaluation of Salt Tolerance of 1 6 Introduced Varieties of Italian Ryegrass at Seedling Stage. Acta Agrestia Sin. 2010, 18, 223–227. [Google Scholar]
- Zhou, X.; Liu, J.; Zhuang, Y. Selection of appropriate reference genes in eggplant for quantitative gene expression studies under different experimental conditions. Sci. Hortic. 2014, 176, 200–207. [Google Scholar] [CrossRef]
- Silver, N.; Best, S.; Jiang, J.; Thein, S. Selection of housekeeping genes for gene expression studies in human reticulocytes using real-time PCR. BMC Mol. Biol. 2006, 7, 33. [Google Scholar] [CrossRef] [PubMed]
- Gu, C.S.; Liu, L.Q.; Deng, Y.M.; Zhu, X.D.; Lu, X.Q.; Huang, S.Z. Validation of reference genes for RT-qPCR normalization in Iris. lactea var. chinensis leaves under different experimental conditions. Sci. Hortic. 2014, 175, 144–149. [Google Scholar]
- Kundu, A.; Patel, A.; Pal, A. Defining reference genes for qPCR normalization to study biotic and abiotic stress responses in Vigna mungo. Plant Cell Rep. 2013, 32, 1647–1658. [Google Scholar] [CrossRef] [PubMed]
- Jain, M.; Nijhawan, A.; Tyagi, A.K.; Khurana, J.P. Validation of housekeeping genes as internal control for studying gene expression in rice by quantitative real-time PCR. Biochem. Biophys. Res. Commun. 2006, 345, 646–651. [Google Scholar] [CrossRef] [PubMed]
- Xia, W.; Mason, A.S.; Xiao, Y.; Liu, Z.; Yang, Y.; Lei, X.; Wu, X.; Ma, Z.; Peng, M. Analysis of multiple transcriptomes of the African oil palm (Elaeis guineensis) to identify reference genes for RT-qPCR. J. Biotechnol. 2014, 184, 63–73. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.; Wang, Q.; Zhang, B. Evaluation and selection of reliable reference genes for gene expression under abiotic stress in cotton (Gossypium hirsutum L.). Gene 2013, 530, 44–50. [Google Scholar] [CrossRef] [PubMed]
- Jurczyk, B.; Pociecha, E.; Janeczko, A.; Paczyński, R.; Rapacz, M. Assessment of candidate reference genes for the expression studies with brassinosteroids in Lolium perenne and Triticum aestivum. J. Plant Physiol. 2014, 171, 1541–1544. [Google Scholar] [CrossRef] [PubMed]
- Yi, S.; Qian, Y.; Han, L.; Sun, Z.; Fan, C.; Liu, J.; Ju, G. Selection of reliable reference genes for gene expression studies in Rhododendron micranthum Turcz. Sci. Hortic. 2012, 138, 128–133. [Google Scholar] [CrossRef]
- Wan, H.; Zhao, Z.; Qian, C.; Sui, Y.; Malik, A.A.; Chen, J. Selection of appropriate reference genes for gene expression studies by quantitative real-time polymerase chain reaction in cucumber. Anal. Biochem. 2010, 399, 257–261. [Google Scholar] [CrossRef] [PubMed]
- Gopaulchan, D.; Lennon, A.M.; Umaharan, P. Identification of reference genes for expression studies using quantitative RT-PCR in spathe tissue of Anthurium andraeanum (Hort.). Sci. Hortic. 2013, 153, 1–7. [Google Scholar] [CrossRef]
- Deloffre, L.A.; Andrade, A.; Filipe, A.I.; Canario, A.V. Reference genes to quantify gene expression during oogenesis in a teleost fish. Gene 2012, 506, 69–75. [Google Scholar] [CrossRef] [PubMed]
- Hu, Y.; Chen, H.; Luo, C.; Dong, L.; Zhang, S.; He, X.; Huang, G. Selection of reference genes for real-time quantitative PCR studies of kumquat in various tissues and under abiotic stress. Sci. Hortic. 2014, 174, 207–216. [Google Scholar] [CrossRef]
- Vandesompele, J.; De, P.K.; Pattyn, F.; Poppe, B.; Van, R.N.; De, P.A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3. [Google Scholar] [CrossRef]
- Chi, X.; Hu, R.; Yang, Q.; Zhang, X.; Pan, L.; Chen, N.; Chen, M.N.; Yang, Z.; Wang, T.; He, Y.N.; et al. Validation of reference genes for gene expression studies in peanut by quantitative real-time RT-PCR. Mol. Genet. Genomics 2012, 287, 167–176. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Wang, Y.; Zhou, P. Validation of reference genes for quantitative real-time PCR during Chinese wolfberry fruit development. Plant Physiol. Biochem. 2013, 70, 304–310. [Google Scholar] [CrossRef] [PubMed]
- Florindo, C.; Ferreira, R.; Borges, V.; Spellerberg, B.; Gomes, J.P.; Borrego, M.J. Selection of reference genes for real-time expression studies in Streptococcus agalactiae. J. Microbial. Methods 2012, 90, 220–227. [Google Scholar] [CrossRef]
- Mauriz, O.; Maneiro, V.; Pérez-Parallé, M.L.; Sánchez, J.L.; Pazos, A.J. Selection of reference genes for quantitative RT-PCR studies on the gonad of the bivalve mollusc Pecten maximus L. Aquaculture 2012, 370, 158–165. [Google Scholar] [CrossRef]
- Tanic, N.; Perovic, M.; Mlade, N.A.; Ruzdijic, S.; Kanazir, S. Effects of Aging, Dietary Restriction and Glucocorticoid Treatment on Housekeeping Gene Expression in Rat Cortex and Hippocampus Evaluation by Real Time RT-PCR. J. Mol. Neurosci. 2007, 32, 38–46. [Google Scholar] [CrossRef] [PubMed]
- EST Database of Cotton. Available online: http://www.leonxie.com/Referencegene.php (accessed on 15 August 2014).
- Sample Availability: Samples of the compounds are available from the authors.
© 2015 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license ( http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, X.; Ma, X.; Huang, L.; Zhang, X. Identification of the Valid Reference Genes for Quantitative RT-PCR in Annual Ryegrass (Lolium multiflorum) under Salt Stress. Molecules 2015, 20, 4833-4847. https://doi.org/10.3390/molecules20034833
Wang X, Ma X, Huang L, Zhang X. Identification of the Valid Reference Genes for Quantitative RT-PCR in Annual Ryegrass (Lolium multiflorum) under Salt Stress. Molecules. 2015; 20(3):4833-4847. https://doi.org/10.3390/molecules20034833
Chicago/Turabian StyleWang, Xia, Xiao Ma, Linkai Huang, and Xinquan Zhang. 2015. "Identification of the Valid Reference Genes for Quantitative RT-PCR in Annual Ryegrass (Lolium multiflorum) under Salt Stress" Molecules 20, no. 3: 4833-4847. https://doi.org/10.3390/molecules20034833
APA StyleWang, X., Ma, X., Huang, L., & Zhang, X. (2015). Identification of the Valid Reference Genes for Quantitative RT-PCR in Annual Ryegrass (Lolium multiflorum) under Salt Stress. Molecules, 20(3), 4833-4847. https://doi.org/10.3390/molecules20034833

