Serum DJ-1 Is a Biomarker of Colorectal Cancer and DJ-1 Activates Mitophagy to Promote Colorectal Cancer Progression
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Microarray Analysis and Correlation Coefficients in Gene Expressions
2.2. Serum and Paired Colorectal Tissues of Tumor Tissue (T) and Adjacent Normal Tissue (N) from Colorectal Cancer Patients
2.3. RNA Extraction, Reverse-Transcription, and Real-Time Quantitative PCR
2.4. Western Blot and Immunohistochemistry (IHC) Staining
2.5. Serum DJ-1 Levels in Colorectal Cancer Patients
2.6. Cell Culture and DJ-1 Stable Knockdown
2.7. MTT, Cell Migration Assay, and Colony Formation
2.8. ATP Production, Intracellular Reactive Oxygen Species (ROS) Detection, Mitochondrial Depolarization Analysis, and Immunofluorescence Staining
2.9. Statistics
3. Results
3.1. DJ-1 mRNA Overexpression in Tumor Tissues (T) but Not Adjacent Normal Tissues (N) Is Positively Correlated with TNM Stages of Colorectal Cancer Patients, and DJ-1′s Function Might Associate with Autophagy/Mitophagy
3.2. DJ-1 Protein Overexpression in Colorectal Tumor Tissues (T) but Not Adjacent Normal Tissues (N) Is Positively Correlated with TNM Stages of Colorectal Cancer Patients
3.3. Increases in Serum DJ-1 Are Positively Correlated with TNM Stages of Colorectal Cancer in Taiwanese Patients
3.4. DJ-1 Knockdown Inhibits Cell Survival, Cell Migration, and Colony Formation in Metastatic Colorectal Adenocarcinoma Cells
3.5. DJ-1 Knockdown Induces an Incomplete Autophagic Response and Cell Apoptosis in Metastatic Colorectal Adenocarcinoma Cells
3.6. DJ-1 Knockdown Has No Impact on Adenosine Triphosphate Production; DJ-1 Knockdown Enhances Intracellular Reactive Oxygen Species Generation, Damaged Mitochondrial Accumulation and Mitophagy Inhibition in Metastatic Colorectal Adenocarcinoma Cells
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2020. CA Cancer J. Clin. 2020, 70, 7–30. [Google Scholar] [CrossRef]
- Health Promotion Administration, Ministry of Health and Welfare. Cancer Registry Annual Report: Taiwan. 2018. Available online: https://www.hpa.gov.tw/Pages/Detail.aspx?nodeid=3801%20&pid=10231 (accessed on 8 June 2021).
- Tsikitis, V.L.; Larson, D.W.; Huebner, M.; Lohse, C.M.; A Thompson, P. Predictors of recurrence free survival for patients with stage II and III colon cancer. BMC Cancer 2014, 14, 336. [Google Scholar] [CrossRef] [Green Version]
- Wang, J.; Li, S.; Liu, Y.; Zhang, C.; Li, H.; Lai, B. Metastatic patterns and survival outcomes in patients with stage IV colon cancer: A population-based analysis. Cancer Med. 2019, 9, 361–373. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vogel, A.; Hofheinz, R.D.; Kubicka, S.; Arnold, D. Treatment decisions in metastatic colorectal cancer—Beyond first and second line combination therapies. Cancer Treat. Rev. 2017, 59, 54–60. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nixon, R.A. The role of autophagy in neurodegenerative disease. Nat. Med. 2013, 19, 983–997. [Google Scholar] [CrossRef] [PubMed]
- Johansen, T.; Lamark, T. Selective autophagy mediated by autophagic adapter proteins. Autophagy 2011, 7, 279–296. [Google Scholar] [CrossRef]
- Vilchez, D.; Saez, I.; Dillin, A. The role of protein clearance mechanisms in organismal ageing and age-related diseases. Nat. Commun. 2014, 5, 5659. [Google Scholar] [CrossRef]
- Sahni, S.; Merlot, A.M.; Krishan, S.; Jansson, P.; Richardson, D. Gene of the month: BECN1. J. Clin. Pathol. 2014, 67, 656–660. [Google Scholar] [CrossRef] [PubMed]
- Sato, K.; Tsuchihara, K.; Fujii, S.; Sugiyama, M.; Goya, T.; Atomi, Y.; Ueno, T.; Ochiai, A.; Esumi, H. Autophagy Is Activated in Colorectal Cancer Cells and Contributes to the Tolerance to Nutrient Deprivation. Cancer Res. 2007, 67, 9677–9684. [Google Scholar] [CrossRef] [Green Version]
- Fan, X.-J.; Wang, Y.; Wang, L.; Zhu, M. Salidroside induces apoptosis and autophagy in human colorectal cancer cells through inhibition of PI3K/Akt/mTOR pathway. Oncol. Rep. 2016, 36, 3559–3567. [Google Scholar] [CrossRef] [Green Version]
- Osellame, L.D.; Blacker, T.S.; Duchen, M.R. Cellular and molecular mechanisms of mitochondrial function. Best Pract. Res. Clin. Endocrinol. Metab. 2012, 26, 711–723. [Google Scholar] [CrossRef] [Green Version]
- Bernardini, J.; Lazarou, M.; Dewson, G. Parkin and mitophagy in cancer. Oncogene 2017, 36, 1315–1327. [Google Scholar] [CrossRef]
- Ashrafi, G.H.; Schwarz, T.L. The pathways of mitophagy for quality control and clearance of mitochondria. Cell Death Differ. 2013, 20, 31–42. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Raefsky, S.M.; Mattson, M.P. Adaptive responses of neuronal mitochondria to bioenergetic challenges: Roles in neuroplasticity and disease resistance. Free. Radic. Biol. Med. 2017, 102, 203–216. [Google Scholar] [CrossRef] [Green Version]
- Joselin, A.P.; Hewitt, S.J.; Callaghan, S.M.; Kim, R.H.; Chung, Y.-H.; Mak, T.W.; Shen, J.; Slack, R.S.; Park, D.S. ROS-dependent regulation of Parkin and DJ-1 localization during oxidative stress in neurons. Hum. Mol. Genet. 2012, 21, 4888–4903. [Google Scholar] [CrossRef] [Green Version]
- Ghosh, S.; Mukherjee, S.; Sengupta, N.; Roy, A.; Dey, D.; Chakraborty, S.; Chattopadhyay, D.; Banerjee, A.; Basu, A. Network analysis reveals common host protein/s modulating pathogenesis of neurotropic viruses. Sci. Rep. 2016, 6, 32593. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gao, H.; Yang, W.; Qi, Z.; Lu, L.; Duan, C.; Zhao, C.; Yang, H. DJ-1 Protects dopaminergic neurons against rotenone-induced apoptosis by enhancing ERK-dependent mitophagy. J. Mol. Biol. 2012, 423, 232–248. [Google Scholar] [CrossRef]
- Thomas, K.J.; McCoy, M.K.; Blackinton, J.; Beilina, A.; Van Der Brug, M.; Sandebring, A.; Miller, D.; Maric, D.; Cedazo-Minguez, A.; Cookson, M.R. DJ-1 acts in parallel to the PINK1/parkin pathway to control mitochondrial function and autophagy. Hum. Mol. Genet. 2010, 20, 40–50. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Scarffe, L.A.; Stevens, D.A.; Dawson, V.L.; Dawson, T.M. Parkin and PINK1: Much more than mitophagy. Trends Neurosci. 2014, 37, 315–324. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fan, J.; Ren, H.; Jia, N.; Fei, E.; Zhou, T.; Jiang, P.; Wu, M.; Wang, G. DJ-1 Decreases bax expression through repressing p53 transcriptional activity. J. Biol. Chem. 2008, 283, 4022–4030. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Davidson, B.; Hadar, R.; Schlossberg, A.; Sternlicht, T.; Slipicevic, A.; Skrede, M.; Risberg, B.; Flørenes, V.A.; Kopolovic, J.; Reich, R. Expression and clinical role of DJ-1, a negative regulator of PTEN, in ovarian carcinoma. Hum. Pathol. 2008, 39, 87–95. [Google Scholar] [CrossRef]
- Tsuchiya, B.; Iwaya, K.; Kohno, N.; Kawate, T.; Akahoshi, T.; Matsubara, O.; Mukai, K. Clinical significance of DJ-1 as a secretory molecule: Retrospective study of DJ-1 expression at mRNA and protein levels in ductal carcinoma of the breast. Histopathology 2012, 61, 69–77. [Google Scholar] [CrossRef]
- Lin, Y.; Chen, Q.; Liu, Q.-X.; Zhou, D.; Lu, X.; Deng, X.-F.; Yang, H.; Zheng, H.; Qiu, Y. High expression of DJ-1 promotes growth and invasion via the PTEN-AKT pathway and predicts a poor prognosis in colorectal cancer. Cancer Med. 2018, 7, 809–819. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Wang, M.; Li, M.; Wang, D.; Rao, Q.; Wang, Y.; Xu, Z.; Wang, J. Expression and role of DJ-1 in leukemia. Biochem. Biophys. Res. Commun. 2008, 375, 477–483. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.; Liu, H.; Zhang, L.; Liu, X.; Zhang, C.; Wang, Y.; He, Q.; Zhang, Y.; Li, Y.; Chen, Q.; et al. DJ-1 promotes colorectal cancer progression through activating PLAGL2/Wnt/BMP4 axis. Cell Death Dis. 2018, 9, 1–12. [Google Scholar] [CrossRef] [Green Version]
- Zheng, H.; Zhou, C.; Lu, X.; Liu, Q.; Liu, M.; Chen, G.; Chen, W.; Wang, S.; Qiu, Y. DJ-1 promotes survival of human colon cancer cells under hypoxia by modulating HIF-1α expression through the PI3K-AKT pathway. Cancer Manag. Res. 2018, 10, 4615–4629. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Wang, H.; Xiang, L.; Ni, T.; Jin, F.; Deng, J.; Zhang, Y.; Shintaro, I.; Zhou, Y.; Liu, Y. DJ-1 is a new prognostic marker and predicts chemotherapy efficacy in colorectal cancer. Oncol. Rep. 2020, 44, 77–90. [Google Scholar] [CrossRef] [Green Version]
- Heras-Sandoval, D.; Rojas, J.P.; Hernández-Damián, J.; Pedraza-Chaverri, J. The role of PI3K/AKT/mTOR pathway in the modulation of autophagy and the clearance of protein aggregates in neurodegeneration. Cell. Signal. 2014, 26, 2694–2701. [Google Scholar] [CrossRef]
- He, X.Y.; Liu, B.Y.; Yao, W.Y.; Zhao, X.J.; Zheng, Z.; Li, J.F.; Yu, B.Q.; Yuan, Y.Z. Serum DJ-1 as a diagnostic marker and prognostic factor for pancreatic cancer. J. Dig. Dis. 2011, 12, 131–137. [Google Scholar] [CrossRef]
- Pardo, M.; García, Á.; Thomas, B.; Piñeiro, A.; Akoulitchev, A.; Dwek, R.A.; Zitzmann, N. The characterization of the invasion phenotype of uveal melanoma tumour cells shows the presence of MUC18 and HMG-1 metastasis markers and leads to the identification of DJ-1 as a potential serum biomarker. Int. J. Cancer 2006, 119, 1014–1022. [Google Scholar] [CrossRef]
- Maita, C.; Tsuji, S.; Yabe, I.; Hamada, S.; Ogata, A.; Maita, H.; Iguchi-Ariga, S.M.; Sasaki, H.; Ariga, H. Secretion of DJ-1 into the serum of patients with Parkinson’s disease. Neurosci. Lett. 2008, 431, 86–89. [Google Scholar] [CrossRef]
- An, C.; Pu, X.; Xiao, W.; Zhang, H. Expression of the DJ-1 protein in the serum of Chinese patients with Parkinson’s disease. Neurosci. Lett. 2018, 665, 236–239. [Google Scholar] [CrossRef]
- Sabates-Bellver, J.; Van Der Flier, L.G.; De Palo, M.; Cattaneo, E.; Maake, C.; Rehrauer, H.; Laczko, E.; Kurowski, M.A.; Bujnicki, J.M.; Menigatti, M.; et al. Transcriptome profile of human colorectal adenomas. Mol. Cancer Res. 2007, 5, 1263–1275. [Google Scholar] [CrossRef] [Green Version]
- Edge, S.B.; Compton, C.C. The American Joint Committee on Cancer: The 7th Edition of the AJCC Cancer staging manual and the future of TNM. Ann. Surg. Oncol. 2010, 17, 1471–1474. [Google Scholar] [CrossRef]
- Lin, M.-W.; Lin, C.C.; Chen, Y.-H.; Yang, H.-B.; Hung, S.-Y. Celastrol inhibits dopaminergic neuronal death of Parkinson’s disease through activating mitophagy. Antioxidants 2019, 9, 37. [Google Scholar] [CrossRef] [Green Version]
- Chen, J.-H.; Yeh, K.-T.; Yang, Y.-M.; Chang, J.-G.; Lee, H.-E.; Hung, S.-Y. High expressions of histone methylation- and phosphorylation-related proteins are associated with prognosis of oral squamous cell carcinoma in male population of Taiwan. Med Oncol. 2013, 30, 513. [Google Scholar] [CrossRef] [PubMed]
- Baptista-Hon, D.; Robertson, F.; Robertson, G.; Owen, S.; Rogers, G.; Lydon, E.; Lee, N.; Hales, T. Potent inhibition by ropivacaine of metastatic colon cancer SW620 cell invasion and Na V 1.5 channel function. Br. J. Anaesth. 2014, 113, i39–i48. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hung, S.-Y.; Huang, W.-P.; Liou, H.-C.; Fu, W.-M. Autophagy protects neuron from Aβ-induced cytotoxicity. Autophagy 2009, 5, 502–510. [Google Scholar] [CrossRef] [PubMed]
- Hewitt, R.E.; McMarlin, A.; Kleiner, D.; Wersto, R.; Martin, P.; Tsokos, M.; Stamp, G.W.H.; Stetler-Stevenson, W.G. Validation of a model of colon cancer progression. J. Pathol. 2000, 192, 446–454. [Google Scholar] [CrossRef]
- Stolz, A.; Ernst, A.; Dikic, I. Cargo recognition and trafficking in selective autophagy. Nat. Cell Biol. 2014, 16, 495–501. [Google Scholar] [CrossRef] [PubMed]
- Raninga, P.; Di Trapani, G.; Tonissen, K.F. The multifaceted roles of DJ-1 as an antioxidant. Adv. Exp. Med. Biol. 2017, 1037, 67–87. [Google Scholar] [CrossRef] [PubMed]
- Murphy, M.P. How mitochondria produce reactive oxygen species. Biochem. J. 2009, 417, 1–13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jelski, W.; Mroczko, B. Biochemical markers of colorectal cancer—Present and future. Cancer Manag. Res. 2020, 12, 4789–4797. [Google Scholar] [CrossRef]
- Choi, K.S. Autophagy and cancer. Exp. Mol. Med. 2012, 44, 109–120. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ding, W.-X.; Yin, X.-M. Mitophagy: Mechanisms, pathophysiological roles, and analysis. Biol. Chem. 2012, 393, 547–564. [Google Scholar] [CrossRef] [Green Version]







| Gene | Forward Primer | Reverse Primer | Probe |
|---|---|---|---|
| DJ-1 | GATGTCATGAGGCGAGCTG | TGACCACATCACGGCTACAC | CCTGGAGC |
| β-actin | ATTGGCAATGAGCGGTTC | CGTGGATGCCACAGGACT | CTTCCAGC |
| Vector-Based shDJ-1 Plasmid | Target Sequence on DJ-1 | Binding Site on the DJ-1 Isoform | |
| NM_007262.5 | NM_001123377.2 | ||
| pLKO1-shDJ-1-A | ACTTAGAGAAACAGGCCGTTA | 697–717 | 639–659 |
| pLKO1-shDJ-1-B | GCAATTGTTGAAGCCCTGAAT | 605–625 | 547–567 |
| pLKO1-shDJ-1-C | GCTGGGATTAAGGTCACCGTT | 191–211 | 133–153 |
| pLKO1-shDJ-1-D | ACTCTGAGAATCGTGTGGAAA | 528–548 | 470–490 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, W.T.-L.; Yang, H.-B.; Ke, T.-W.; Liao, W.-L.; Hung, S.-Y. Serum DJ-1 Is a Biomarker of Colorectal Cancer and DJ-1 Activates Mitophagy to Promote Colorectal Cancer Progression. Cancers 2021, 13, 4151. https://doi.org/10.3390/cancers13164151
Chen WT-L, Yang H-B, Ke T-W, Liao W-L, Hung S-Y. Serum DJ-1 Is a Biomarker of Colorectal Cancer and DJ-1 Activates Mitophagy to Promote Colorectal Cancer Progression. Cancers. 2021; 13(16):4151. https://doi.org/10.3390/cancers13164151
Chicago/Turabian StyleChen, William Tzu-Liang, Han-Bin Yang, Tao-Wei Ke, Wen-Ling Liao, and Shih-Ya Hung. 2021. "Serum DJ-1 Is a Biomarker of Colorectal Cancer and DJ-1 Activates Mitophagy to Promote Colorectal Cancer Progression" Cancers 13, no. 16: 4151. https://doi.org/10.3390/cancers13164151
APA StyleChen, W. T.-L., Yang, H.-B., Ke, T.-W., Liao, W.-L., & Hung, S.-Y. (2021). Serum DJ-1 Is a Biomarker of Colorectal Cancer and DJ-1 Activates Mitophagy to Promote Colorectal Cancer Progression. Cancers, 13(16), 4151. https://doi.org/10.3390/cancers13164151

