Effects of Feeding Time on Markers of Muscle Metabolic Flexibility Following Acute Aerobic Exercise in Trained Mice Undergoing Time Restricted Feeding
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Experimental Design
2.2. Diet and Feeding Protocol
2.3. Exercise
2.4. Run to Fatigue
2.5. Protein Expression
2.6. Gene Expression
2.7. Statistical Analysis
3. Results
3.1. Body Weight Changes
3.2. Energy Status Following Acute Exercise in Chronic TRF with Immediate and Delayed Feeding
3.3. Markers of Metabolic Flexibility Following Acute Exercise in Chronic TRF with Immediate and Delayed Feeding Following Training
3.4. Marker of Mitochondrial Biogenesis and Content
3.5. Run to Exhaustion
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Conflicts of Interest
References
- Trends, G. Intermittent Fasting. Available online: https://trends.google.com/trends/explore?date=all&q=Intermittent%20fasting (accessed on 19 February 2020).
- Wu, Z.; Puigserver, P.; Andersson, U.; Zhang, C.; Adelmant, G.; Mootha, V.; Troy, A.; Cinti, S.; Lowell, B.; Scarpulla, R.C.; et al. Mechanisms Controlling Mitochondrial Biogenesis and Respiration through the Thermogenic Coactivator PGC-1. Cell 1999, 98, 115–124. [Google Scholar] [CrossRef]
- Hatori, M.; Vollmers, C.; Zarrinpar, A.; DiTacchio, L.; Bushong, E.A.; Gill, S.; Leblanc, M.; Chaix, A.; Joens, M.; Fitzpatrick, J.A.J.; et al. Time-Restricted Feeding without Reducing Caloric Intake Prevents Metabolic Diseases in Mice Fed a High-Fat Diet. Cell Metab. 2012, 15, 848–860. [Google Scholar] [CrossRef] [PubMed]
- Chaix, A.; Zarrinpar, A.; Miu, P.; Panda, S. Time-Restricted Feeding Is a Preventative and Therapeutic Intervention against Diverse Nutritional Challenges. Cell Metab. 2014, 20, 991–1005. [Google Scholar] [CrossRef] [PubMed]
- Stockman, M.-C.; Thomas, D.; Burke, J.; Apovian, C.M. Intermittent Fasting: Is the Wait Worth the Weight? Curr. Obes. Rep. 2018, 7, 172–185. [Google Scholar] [CrossRef] [PubMed]
- Patterson, R.; Sears, D. Metabolic Effects of Intermittent Fasting. Annu. Rev. Nutr. 2017, 37, 371–393. [Google Scholar] [CrossRef] [PubMed]
- Chung, H.; Chou, W.; Sears, D.D.; Patterson, R.E.; Webster, N.J.; Ellies, L.G. Time-restricted feeding improves insulin resistance and hepatic steatosis in a mouse model of postmenopausal obesity. Metabolism 2016, 65, 1743–1754. [Google Scholar] [CrossRef]
- Mattson, M.P.; Longo, V.D.; Harvie, M. Impact of intermittent fasting on health and disease processes. Ageing Res. Rev. 2017, 39, 46–58. [Google Scholar] [CrossRef]
- Anton, S.D.; Moehl, K.; Donahoo, W.T.; Marosi, K.; Lee, S.A.; Mainous, A.G.; Leeuwenburgh, C.; Mattson, M.P. Flipping the Metabolic Switch: Understanding and Applying the Health Benefits of Fasting. Obesity 2018, 26, 254–268. [Google Scholar] [CrossRef]
- Holloszy, J.O.; Coyle, E.F. Adaptations of skeletal muscle to endurance exercise and their metabolic consequences. J. Appl. Physiol. 1984, 56, 831–838. [Google Scholar] [CrossRef] [PubMed]
- Hood, D.A.; Tryon, L.D.; Carter, H.N.; Kim, Y.; Chen, C.C. Unravelling the mechanisms regulating muscle mitochondrial biogenesis. Biochem. J. 2016, 473, 2295–2314. [Google Scholar] [CrossRef]
- Huertas, J.R.; Casuso, R.A.; Agustín, P.H.; Cogliati, S. Stay Fit, Stay Young: Mitochondria in Movement: The Role of Exercise in the New Mitochondrial Paradigm. Oxid. Med. Cell. Longev. 2019, 2019, 1–18. [Google Scholar] [CrossRef] [PubMed]
- Morita, M.; Gravel, S.-P.; Chénard, V.; Sikström, K.; Zheng, L.; Alain, T.; Gandin, V.; Avizonis, D.; Arguello, M.; Zakaria, C.; et al. mTORC1 Controls Mitochondrial Activity and Biogenesis through 4E-BP-Dependent Translational Regulation. Cell Metab. 2013, 18, 698–711. [Google Scholar] [CrossRef]
- Andreux, P.A.; Houtkooper, R.H.; Auwerx, J. Pharmacological approaches to restore mitochondrial function. Nat. Rev. Drug Discov. 2013, 12, 465–483. [Google Scholar] [CrossRef]
- Paoli, A.; Tinsley, G.; Bianco, A.; Moro, T. The Influence of Meal Frequency and Timing on Health in Humans: The Role of Fasting. Nutrients 2019, 11, 719. [Google Scholar] [CrossRef] [PubMed]
- Marin, T.L.; Gongol, B.; Zhang, F.; Martin, M.; Johnson, D.A.; Xiao, H.; Wang, Y.; Subramaniam, S.; Chien, S.; Shyy, J.Y.J. AMPK promotes mitochondrial biogenesis and function by phosphorylating the epigenetic factors DNMT1, RBBP7, and HAT1. Sci. Signal. 2017, 10, eaaf7478. [Google Scholar] [CrossRef] [PubMed]
- Reznick, R.M.; Shulman, G.I. The role of AMP-activated protein kinase in mitochondrial biogenesis. J. Physiol. 2006, 574, 33–39. [Google Scholar] [CrossRef]
- Aragon, A.A.; Schoenfeld, B.J. Nutrient timing revisited: Is there a post-exercise anabolic window? J. Int. Soc. Sports Nutr. 2013, 10, 5. [Google Scholar] [CrossRef] [PubMed]
- Kerksick, C.M.; Arent, S.; Schoenfeld, B.J.; Stout, J.R.; Campbell, B.; Wilborn, C.D.; Taylor, L.; Kalman, D.; Smith-Ryan, A.E.; Kreider, R.B.; et al. International society of sports nutrition position stand: Nutrient timing. J. Int. Soc. Sports Nutr. 2017, 14, 1–21. [Google Scholar] [CrossRef] [PubMed]
- Aird, T.P.; Davies, R.W.; Carson, B.P. Effects of fasted vs fed-state exercise on performance and post-exercise metabolism: A systematic review and meta-analysis. Scand. J. Med. Sci. Sports 2018, 28, 1476–1493. [Google Scholar] [CrossRef]
- Jones, R.; Pabla, P.; Mallinson, J.; Nixon, A.; Taylor, T.; Bennett, A.; Tsintzas, K. Two weeks of early time-restricted feeding (eTRF) improves skeletal muscle insulin and anabolic sensitivity in healthy men. Am. J. Clin. Nutr. 2020, 112, 1015–1028. [Google Scholar] [CrossRef]
- Stratton, M.T.; Tinsley, G.M.; Alesi, M.G.; Hester, G.M.; Olmos, A.A.; Serafini, P.R.; Modjeski, A.S.; Mangine, G.T.; King, K.; Savage, S.N.; et al. Four Weeks of Time-Restricted Feeding Combined with Resistance Training does not Differentially Influence Measures of Body Composition, Muscle Performance, Resting Energy Expenditure, and Blood Biomarkers. Nutrients 2020, 12, 1126. [Google Scholar] [CrossRef] [PubMed]
- Tinsley, G.M.; Moore, M.L.; Graybeal, A.J.; Paoli, A.; Kim, Y.; Gonzales, J.U.; Harry, J.R.; VanDusseldorp, T.A.; Kennedy, D.N.; Cruz, M.R. Time-restricted feeding plus resistance training in active females: A randomized trial. Am. J. Clin. Nutr. 2019, 110, 628–640. [Google Scholar] [CrossRef] [PubMed]
- Moro, T.; Tinsley, G.; Bianco, A.; Marcolin, G.; Pacelli, Q.F.; Battaglia, G.; Palma, A.; Gentil, P.; Neri, M.; Paoli, A. Effects of eight weeks of time-restricted feeding (16/8) on basal metabolism, maximal strength, body composition, inflammation, and cardiovascular risk factors in resistance-trained males. J. Transl. Med. 2016, 14, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Hardie, D.G. AMP-activated/SNF1 protein kinases: Conserved guardians of cellular energy. Nat. Rev. Mol. Cell Biol. 2007, 8, 774–785. [Google Scholar] [CrossRef]
- Richter, E.A.; Ruderman, N.B. AMPK and the biochemistry of exercise: Implications for human health and disease. Biochem. J. 2009, 418, 261–275. [Google Scholar] [CrossRef] [PubMed]
- Bujak, A.L.; Crane, J.D.; Lally, J.S.; Ford, R.J.; Kang, S.J.; Rebalka, I.A.; Green, A.E.; Kemp, B.E.; Hawke, T.J.; Schertzer, J.D.; et al. AMPK Activation of Muscle Autophagy Prevents Fasting-Induced Hypoglycemia and Myopathy during Aging. Cell Metab. 2015, 21, 883–890. [Google Scholar] [CrossRef] [PubMed]
- Steinberg, G.R.; Jorgensen, S.B. The AMP-activated protein kinase: Role in regulation of skeletal muscle metabolism and insulin sensitivity. Mini Rev. Med. Chem. 2007, 7, 519–526. [Google Scholar] [CrossRef] [PubMed]
- Fujii, N.; Hayashi, T.; Hirshman, M.F.; Smith, J.T.; Habinowski, S.A.; Kaijser, L.; Mu, J.; Ljungqvist, O.; Birnbaum, M.J.; Witters, L.A.; et al. Exercise Induces Isoform-Specific Increase in 5′AMP-Activated Protein Kinase Activity in Human Skeletal Muscle. Biochem. Biophys. Res. Commun. 2000, 273, 1150–1155. [Google Scholar] [CrossRef]
- Wojtaszewski, J.F.; Nielsen, P.; Hansen, B.F.; Richter, E.A.; Kiens, B. Isoform-specific and exercise intensity-dependent activation of 5’-AMP-activated protein kinase in human skeletal muscle. J. Physiol. 2000, 528 Pt 1, 221–226. [Google Scholar] [CrossRef]
- Chen, Z.P.; Stephens, T.J.; Murthy, S.; Canny, B.J.; Hargreaves, M.; Witters, L.A.; Kemp, B.E.; McConell, G.K. Effect of exercise intensity on skeletal muscle AMPK signaling in humans. Diabetes 2003, 52, 2205–2212. [Google Scholar] [CrossRef]
- Wojtaszewski, J.F.; MacDonald, C.; Nielsen, J.N.; Hellsten, Y.; Hardie, D.G.; Kemp, B.E.; Kiens, B.; Richter, E.A. Regulation of 5’AMP-activated protein kinase activity and substrate utilization in exercising human skeletal muscle. Am. J. Physiol. Endocrinol. Metab. 2003, 284, E813–E822. [Google Scholar] [CrossRef]
- Stephens, T.J.; Chen, Z.P.; Canny, B.J.; Michell, B.J.; Kemp, B.E.; McConell, G.K. Progressive increase in human skeletal muscle AMPKalpha2 activity and ACC phosphorylation during exercise. Am. J. Physiol. Endocrinol. Metab. 2002, 282, E688–E694. [Google Scholar] [CrossRef]
- Dedual, M.A.; Wueest, S.; Borsigova, M.; Konrad, D. Intermittent fasting improves metabolic flexibility in short-term high-fat diet-fed mice. Am. J. Physiol. Endocrinol. Metab. 2019, 317, E773–E782. [Google Scholar] [CrossRef] [PubMed]
- Battaglia, G.M.; Zheng, D.; Hickner, R.C.; Houmard, J.A. Effect of exercise training on metabolic flexibility in response to a high-fat diet in obese individuals. Am. J. Physiol. Endocrinol. Metab. 2012, 303, E1440–E1445. [Google Scholar] [CrossRef]
- Parr, E.B.; Heilbronn, L.K.; Hawley, J.A. A Time to Eat and a Time to Exercise. Exerc. Sport Sci. Rev. 2020, 48, 4–10. [Google Scholar] [CrossRef] [PubMed]
- Sato, S.; Basse, A.L.; Schönke, M.; Chen, S.; Samad, M.; Altıntaş, A.; Laker, R.C.; Dalbram, E.; Barrès, R.; Baldi, P.; et al. Time of Exercise Specifies the Impact on Muscle Metabolic Pathways and Systemic Energy Homeostasis. Cell Metab. 2019, 30, 92–110.e4. [Google Scholar] [CrossRef] [PubMed]
- De Lange, P.; Farina, P.; Moreno, M.; Ragni, M.; Lombardi, A.; Silvestri, E.; Burrone, L.; Lanni, A.; Goglia, F. Sequential changes in the signal transduction responses of skeletal muscle following food deprivation. FASEB J. 2006, 20, 2579–2581. [Google Scholar] [CrossRef]
- Pilegaard, H.; Saltin, B.; Neufer, P.D. Exercise induces transient transcriptional activation of the PGC-1α gene in human skeletal muscle. J. Physiol. 2019, 546, 851–858. [Google Scholar] [CrossRef] [PubMed]
- Short, K.R.; Vittone, J.L.; Bigelow, M.L.; Proctor, D.N.; Rizza, R.A.; Coenen-Schimke, J.M.; Nair, K.S. Impact of Aerobic Exercise Training on Age-Related Changes in Insulin Sensitivity and Muscle Oxidative Capacity. Diabetes 2003, 52, 1888–1896. [Google Scholar] [CrossRef] [PubMed]
- Kuhl, J.E.; Ruderman, N.B.; Musi, N.; Goodyear, L.J.; Patti, M.E.; Crunkhorn, S.; Dronamraju, D.; Thorell, A.; Nygren, J.; Ljungkvist, O.; et al. Exercise training decreases the concentration of malonyl-CoA and increases the expression and activity of malonyl-CoA decarboxylase in human muscle. Am. J. Physiol. Endocrinol. Metab. 2006, 290, E1296–E1303. [Google Scholar] [CrossRef] [PubMed]
- Saleem, A.; Hood, D.A. Acute exercise induces tumour suppressor protein p53 translocation to the mitochondria and promotes a p53–Tfam–mitochondrial DNA complex in skeletal muscle. J. Physiol. 2013, 591, 3625–3636. [Google Scholar] [CrossRef] [PubMed]
- de las Heras, N.; Klett-Mingo, M.; Ballesteros, S.; Martín-Fernández, B.; Escribano, Ó.; Blanco-Rivero, J.; Balfagón, G.; Hribal, M.L.; Benito, M.; Lahera, V.; et al. Chronic Exercise Improves Mitochondrial Function and Insulin Sensitivity in Brown Adipose Tissue. Front. Physiol. 2018, 9. [Google Scholar] [CrossRef] [PubMed]
- Civitarese, A.E.; Carling, S.; Heilbronn, L.K.; Hulver, M.H.; Ukropcova, B.; Deutsch, W.A.; Smith, S.R.; Ravussin, E. Calorie Restriction Increases Muscle Mitochondrial Biogenesis in Healthy Humans. PLoS Med. 2007, 4, e76. [Google Scholar] [CrossRef] [PubMed]
- Marosi, K.; Moehl, K.; Navas-Enamorado, I.; Mitchell, S.J.; Zhang, Y.; Lehrmann, E.; Aon, M.A.; Cortassa, S.; Becker, K.G.; Mattson, M.P. Metabolic and molecular framework for the enhancement of endurance by intermittent food deprivation. FASEB J. 2018, 32, 3844–3858. [Google Scholar] [CrossRef] [PubMed]
- Hansen, D.; De Strijcker, D.; Calders, P. Impact of Endurance Exercise Training in the Fasted State on Muscle Biochemistry and Metabolism in Healthy Subjects: Can These Effects be of Particular Clinical Benefit to Type 2 Diabetes Mellitus and Insulin-Resistant Patients? Sports Med. 2017, 47, 415–428. [Google Scholar] [CrossRef]






| Gene | Forward Primer 5′-3′ | Reverse Primer 5′-3′ |
|---|---|---|
| Tfam | TCCCCTCGTCTATCAGTCTTG | GGGCTGCAATTTTCCTAACC |
| Pgc1a | AAGACGGATTGCCCTCATTT | AGTGCTAAGACCGCTGCATT |
| Fabp | GCTGGGAATAGAGTTCGACG | CTTCTCATAAGTCCGAGTGCTC |
| Cd36 | GATGTGCAAAACCCAGATGAC | ACAGTGAAGGCTCAAAGATGG |
| Crat | CTGTGGGATGGTGTATGAGC | CTGAGGTTCTGTTTGGCTTTC |
| Hsl | CACAGACCTCTAAATCCCACG | ATATCCGCTCTCCAGTTGAAC |
| Pfk | TGGTGCTGAGGAATGAGAAATG | CCCAGACATCCAGTTCATAGC |
| Glut4 | GTAACTTCATTGTCGGCATGG | TGCTCTAAAAGGGAAGGTGTC |
| Fasn | GATGACAGGAGATGGAAGGC | GAGTGAGGCTGGGTTGATAC |
| Ldhb | CCGAAAATTGTGGCCGATAAAG | GCTGTACTTGACGATCTGAGG |
| Gapdh | GTTGTCTCCTGCGACTTCA | TGCTGTAGCCGTATTCA |
| Muscle | Control | TRF-Immediate | TRF-Delayed |
|---|---|---|---|
| Gastrocnemius (mg) | 137.9 ± 2.4 | 128.3 ± 3.3 | 126.1 ± 3.4 * |
| Soleus (mg) | 10.3 ± 0.4 | 9.0 ± 0.2 * | 8.9 ± 0.3 * |
| Plantaris (mg) | 18.2 ± 0.5 | 16.6 ± 0.5 | 16.3 ± 0.5 |
| Tibialis Anterior (mg) | 45.3 ± 1.2 | 41.2 ± 1.8 | 40.5 ± 0.9 * |
| Extensor digitorum longus (mg) | 10.8 ± 0.4 | 9.8 ± 0.4 | 9.5 ± 0.3 |
| Quadriceps (mg) | 101.4 ± 1.8 | 96.5 ± 3.5 | 94.2 ± 3.8 |
| Tibia Length (mm) | 16.52 ± 0.07 | 16.60 ± 0.13 | 16.38 ± 0.16 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Persinger, A.; Butawan, M.; Faietti, M.; Pryke, A.; Rose, K.; van der Merwe, M.; Bloomer, R.J.; Puppa, M.J. Effects of Feeding Time on Markers of Muscle Metabolic Flexibility Following Acute Aerobic Exercise in Trained Mice Undergoing Time Restricted Feeding. Nutrients 2021, 13, 1717. https://doi.org/10.3390/nu13051717
Persinger A, Butawan M, Faietti M, Pryke A, Rose K, van der Merwe M, Bloomer RJ, Puppa MJ. Effects of Feeding Time on Markers of Muscle Metabolic Flexibility Following Acute Aerobic Exercise in Trained Mice Undergoing Time Restricted Feeding. Nutrients. 2021; 13(5):1717. https://doi.org/10.3390/nu13051717
Chicago/Turabian StylePersinger, Aaron, Matthew Butawan, Martina Faietti, Ashley Pryke, Kyley Rose, Marie van der Merwe, Richard J. Bloomer, and Melissa J. Puppa. 2021. "Effects of Feeding Time on Markers of Muscle Metabolic Flexibility Following Acute Aerobic Exercise in Trained Mice Undergoing Time Restricted Feeding" Nutrients 13, no. 5: 1717. https://doi.org/10.3390/nu13051717
APA StylePersinger, A., Butawan, M., Faietti, M., Pryke, A., Rose, K., van der Merwe, M., Bloomer, R. J., & Puppa, M. J. (2021). Effects of Feeding Time on Markers of Muscle Metabolic Flexibility Following Acute Aerobic Exercise in Trained Mice Undergoing Time Restricted Feeding. Nutrients, 13(5), 1717. https://doi.org/10.3390/nu13051717

