Novel Transcriptome Study and Detection of Metabolic Variations in UV-B-Treated Date Palm (Phoenix dactylifera cv. Khalas)
Abstract
:1. Introduction
2. Results
2.1. Sequence and De Novo Assembly of the Transcriptome of Khalas Date Palm under UV Stress Conditions
2.2. Functional Annotations
2.3. Gene Ontology (GO) Analysis
2.4. Differentially Expressed Genes (DEGs)
2.5. KEGG Pathways Related to UV Radiation
2.6. Transcription Factors
2.7. Chloroplast-Related Genes as Affected by UV Stress
2.8. Photosynthesis
2.9. Oxidative Phosphorylation-Related Genes
2.10. Quantitative Real-Time PCR (qRT-PCR) Validation of DEGs from RNA-seq
3. Materials and Methods
3.1. Plant Materials
3.2. RNA Extraction
3.3. CDNA Library Preparation for Transcriptome Analysis
3.4. Data Analysis Quality Control
3.5. Transcriptome Based Assembly
3.6. Gene Annotation and Functional Analysis
3.7. Quantification of Levels of Gene Expression and Study of Differential Expression
3.8. Quantitative and Real Time-PCR (qRT-PCR) Validation
3.9. Metabolite Analysis by LC-MS/MS
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Food and Agriculture Organization of the United Nations. Worldwide Dates Production Statistics; Food and Agriculture Organization of the United Nations: Rome, Italy, 2006. [Google Scholar]
- Chao, C.T.; Krueger, R.R. The date palm (Phoenix dactylifera L.): Overview of biology, uses, and cultivation. HortScience 2007, 42, 1077–1082. [Google Scholar] [CrossRef] [Green Version]
- Al-Harrasi, A.; Rehman, N.U.; Hussain, J.; Khan, A.L.; Al-Rawahi, A.; Gilani, S.A.; Al-Broumi, M.; Ali, L. Nutritional assessment and antioxidant analysis of 22 date palm (Phoenix dactylifera) varieties growing in Sultanate of Oman. Asian Pac. J. Trop. Med. 2014, 7, S591–S598. [Google Scholar] [CrossRef] [Green Version]
- Hazzouri, K.M.; Flowers, J.M.; Visser, H.J.; Khierallah, H.S.; Rosas, U.; Pham, G.M.; Meyer, R.S.; Johansen, C.K.; Fresquez, Z.A.; Masmoudi, K. Whole genome re-sequencing of date palms yields insights into diversification of a fruit tree crop. Nat. Commun. 2015, 6, 1–11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Soliman, S.; Al-Obeed, R.; Harhash, M. Effects of bunch thinning on yield and fruit quality of khalas date palm cultivar. World J. Agric. Sci. 2011, 7, 42–46. [Google Scholar]
- Gao, W.; Lv, D.; Yu, C.; Qin, S.; Du, G.; Zhao, D. Study on microorganism population structure in microenvironment of bagged apple fruit. J. Fruit Sci. 2007, 24, 830–832. [Google Scholar]
- Liu, J.; Li, B.; Zhang, L.; Luan, D.; Li, Y.; Lei, Y. The effect of bagging on the quality and pesticide residual of ‘Red Fuji’apple. J. Northwest Sci.-Tech. Univ. Agric. For. 2003, 10, 16–18. [Google Scholar]
- Andrady, A.; Aucamp, P.J.; Bais, A.F.; Ballare, C.L.; Björn, L.; Bornman, J.F.; Caldwell, M.; Cullen, A.P.; Erickson, D.J.; Häder, D. Environmental effects of ozone depletion and its interactions with climate change: Progress report, 2009. Photochem. Photobiol. Sci. Off. J. Eur. Photochem. Assoc. Eur. Soc. Photobiol. 2010, 9, 275–294. [Google Scholar]
- Jansen, M.A.; Gaba, V.; Greenberg, B.M. Higher plants and UV-B radiation: Balancing damage, repair and acclimation. Trends Plant Sci. 1998, 3, 131–135. [Google Scholar] [CrossRef]
- Teramura, A.H.; Sullivan, J.H. Effects of UV-B radiation on photosynthesis and growth of terrestrial plants. Photosynth. Res. 1994, 39, 463–473. [Google Scholar] [CrossRef]
- Jassim, S.A.; Limoges, R.G. Impact of external forces on cyanophage–host interactions in aquatic ecosystems. World J. Microbiol. Biotechnol. 2013, 29, 1751–1762. [Google Scholar] [CrossRef] [PubMed]
- Miyamura, Y.; Coelho, S.G.; Schlenz, K.; Batzer, J.; Smuda, C.; Choi, W.; Brenner, M.; Passeron, T.; Zhang, G.; Kolbe, L. The deceptive nature of UVA tanning versus the modest protective effects of UVB tanning on human skin. Pigment Cell Melanoma Res. 2011, 24, 136–147. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kusano, M.; Tohge, T.; Fukushima, A.; Kobayashi, M.; Hayashi, N.; Otsuki, H.; Kondou, Y.; Goto, H.; Kawashima, M.; Matsuda, F. Metabolomics reveals comprehensive reprogramming involving two independent metabolic responses of Arabidopsis to UV-B light. Plant J. 2011, 67, 354–369. [Google Scholar] [CrossRef]
- Kim, S.; Yun, E.J.; Hossain, M.A.; Lee, H.; Kim, K.H. Global profiling of ultraviolet-induced metabolic disruption in Melissa officinalis by using gas chromatography-mass spectrometry. Anal. Bioanal. Chem. 2012, 404, 553–562. [Google Scholar] [CrossRef] [PubMed]
- Landry, L.G.; Chapple, C.C.; Last, R.L. Arabidopsis mutants lacking phenolic sunscreens exhibit enhanced ultraviolet-B injury and oxidative damage. Plant Physiol. 1995, 109, 1159–1166. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rao, M.V.; Paliyath, G.; Ormrod, D.P. Ultraviolet-B-and ozone-induced biochemical changes in antioxidant enzymes of Arabidopsis thaliana. Plant Physiol. 1996, 110, 125–136. [Google Scholar] [CrossRef] [Green Version]
- Czégény, G.; Mátai, A.; Hideg, É. UV-B effects on leaves—Oxidative stress and acclimation in controlled environments. Plant Sci. 2016, 248, 57–63. [Google Scholar] [CrossRef] [Green Version]
- Zhu, W.; Yang, B.; Komatsu, S.; Lu, X.; Li, X.; Tian, J. Binary stress induces an increase in indole alkaloid biosynthesis in Catharanthus roseus. Front. Plant Sci. 2015, 6, 582. [Google Scholar] [CrossRef] [Green Version]
- Harborne, J.B.; Williams, C.A. Advances in flavonoid research since 1992. Phytochemistry 2000, 55, 481–504. [Google Scholar] [CrossRef]
- Agati, G.; Stefano, G.; Biricolti, S.; Tattini, M. Mesophyll distribution of ‘antioxidant’flavonoid glycosides in Ligustrum vulgare leaves under contrasting sunlight irradiance. Ann. Bot. 2009, 104, 853–861. [Google Scholar] [CrossRef] [Green Version]
- Agati, G.; Biricolti, S.; Guidi, L.; Ferrini, F.; Fini, A.; Tattini, M. The biosynthesis of flavonoids is enhanced similarly by UV radiation and root zone salinity in L. vulgare leaves. J. Plant Physiol. 2011, 168, 204–212. [Google Scholar] [CrossRef]
- Al-Mssallem, I.S.; Hu, S.; Zhang, X.; Lin, Q.; Liu, W.; Tan, J.; Yu, X.; Liu, J.; Pan, L.; Zhang, T. Genome sequence of the date palm Phoenix dactylifera L. Nat. Commun. 2013, 4, 2274. [Google Scholar] [CrossRef] [Green Version]
- Al-Dous, E.K.; George, B.; Al-Mahmoud, M.E.; Al-Jaber, M.Y.; Wang, H.; Salameh, Y.M.; Al-Azwani, E.K.; Chaluvadi, S.; Pontaroli, A.C.; DeBarry, J. De novo genome sequencing and comparative genomics of date palm (Phoenix dactylifera). Nat. Biotechnol. 2011, 29, 521. [Google Scholar] [CrossRef]
- Mathew, L.S.; Spannagl, M.; Al-Malki, A.; George, B.; Torres, M.F.; Al-Dous, E.K.; Al-Azwani, E.K.; Hussein, E.; Mathew, S.; Mayer, K.F. A first genetic map of date palm (Phoenix dactylifera) reveals long-range genome structure conservation in the palms. BMC Genom. 2014, 15, 1–10. [Google Scholar] [CrossRef] [Green Version]
- Zhang, G.; Pan, L.; Yin, Y.; Liu, W.; Huang, D.; Zhang, T.; Wang, L.; Xin, C.; Lin, Q.; Sun, G. Large-scale collection and annotation of gene models for date palm (Phoenix dactylifera, L.). Plant Mol. Biol. 2012, 79, 521–536. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, L.; Zhao, G.; Xia, C.; Jia, J.; Liu, X.; Kong, X. A wheat R2R3-MYB gene, TaMYB30-B, improves drought stress tolerance in transgenic Arabidopsis. J. Exp. Bot. 2012, 63, 5873–5885. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bourgis, F.; Kilaru, A.; Cao, X.; Ngando-Ebongue, G.-F.; Drira, N.; Ohlrogge, J.B.; Arondel, V. Comparative transcriptome and metabolite analysis of oil palm and date palm mesocarp that differ dramatically in carbon partitioning. Proc. Natl. Acad. Sci. USA 2011, 108, 12527–12532. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, F.; Guo, H.; Huang, J.; Yang, C.; Li, Y.; Wang, X.; Qu, L.; Liu, X.; Luo, J. A UV-B-responsive glycosyltransferase, OsUGT706C2, modulates flavonoid metabolism in rice. Sci. China Life Sci. 2020, 63, 1037–1052. [Google Scholar] [CrossRef]
- Haas, B.J.; Papanicolaou, A.; Yassour, M.; Grabherr, M.; Blood, P.D.; Bowden, J.; Couger, M.B.; Eccles, D.; Li, B.; Lieber, M.; et al. De novo transcript sequence reconstruction from RNA-seq using the Trinity platform for reference generation and analysis. Nat. Protoc. 2013, 8, 1494–1512. [Google Scholar] [CrossRef] [PubMed]
- Götz, S.; García-Gómez, J.M.; Terol, J.; Williams, T.D.; Nagaraj, S.H.; Nueda, M.J.; Robles, M.; Talón, M.; Dopazo, J.; Conesa, A. High-throughput functional annotation and data mining with the Blast2GO suite. Nucleic Acids Res. 2008, 36, 3420–3435. [Google Scholar] [CrossRef]
- Young, M.D.; Wakefield, M.J.; Smyth, G.K.; Oshlack, A. Gene ontology analysis for RNA-seq: Accounting for selection bias. Genome Biol. 2010, 11, R14. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kanehisa, M.; Araki, M.; Goto, S.; Hattori, M.; Hirakawa, M.; Itoh, M.; Katayama, T.; Kawashima, S.; Okuda, S.; Tokimatsu, T. KEGG for linking genomes to life and the environment. Nucleic Acids Res. 2007, 36, D480–D484. [Google Scholar] [CrossRef] [PubMed]
- Arisha, M.H.; Ahmad, M.Q.; Tang, W.; Liu, Y.; Yan, H.; Kou, M.; Wang, X.; Zhang, Y.; Li, Q. RNA-sequencing analysis revealed genes associated drought stress responses of different durations in hexaploid sweet potato. Sci. Rep. 2020, 10, 1–17. [Google Scholar] [CrossRef]
- Zhang, X.; Ding, X.; Ji, Y.; Wang, S.; Chen, Y.; Luo, J.; Shen, Y.; Peng, L. Measurement of metabolite variations and analysis of related gene expression in Chinese liquorice (Glycyrrhiza uralensis) plants under UV-B irradiation. Sci. Rep. 2018, 8, 1–17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Tu, H.; Wan, J.; Chen, W.; Liu, X.; Luo, J.; Xu, J.; Zhang, H. Spatio-temporal distribution and natural variation of metabolites in citrus fruits. Food Chem. 2016, 199, 8–17. [Google Scholar] [CrossRef]
- Aioub, A.A.; Zuo, Y.; Li, Y.; Qie, X.; Zhang, X.; Essmat, N.; Wu, W.; Hu, Z. Transcriptome analysis of Plantago major as a phytoremediator to identify some genes related to cypermethrin detoxification. Environ. Sci. Pollut. Res. 2020, 28, 5101–5115. [Google Scholar] [CrossRef]
- Banerjee, J.; Das, N.; Dey, P.; Maiti, M.K. Transgenically expressed rice germin-like protein1 in tobacco causes hyper-accumulation of H2O2 and reinforcement of the cell wall components. Biochem. Biophys. Res. Commun. 2010, 402, 637–643. [Google Scholar] [CrossRef]
- Zlatev, Z.S.; Lidon, F.J.; Kaimakanova, M. Plant physiological responses to UV-B radiation. Emir. J. Food Agric. 2012, 24, 481–501. [Google Scholar] [CrossRef]
- Jiang, L.; Wu, J.; Fan, S.; Li, W.; Dong, L.; Cheng, Q.; Xu, P.; Zhang, S. Isolation and characterization of a novel pathogenesis-related protein gene (GmPRP) with induced expression in soybean (Glycine max) during infection with Phytophthora sojae. PLoS ONE 2015, 10, e0129932. [Google Scholar] [CrossRef] [PubMed]
- Gonzalez, D.; Bowen, A.J.; Carroll, T.S.; Conlan, R.S. The transcription corepressor LEUNIG interacts with the histone deacetylase HDA19 and mediator components MED14 (SWP) and CDK8 (HEN3) to repress transcription. Mol. Cell. Biol. 2007, 27, 5306–5315. [Google Scholar] [CrossRef] [Green Version]
- Gong, H.; Jiao, Y.; Hu, W.-W.; Pua, E.-C. Expression of glutathione-S-transferase and its role in plant growth and development in vivo and shoot morphogenesis in vitro. Plant Mol. Biol. 2005, 57, 53–66. [Google Scholar] [CrossRef]
- Niño, M.C.; Song, J.-Y.; Nogoy, F.M.; Kim, M.-S.; Jung, Y.J.; Kang, K.-K.; Nou, I.; Cho, Y.-G. Overexpression of rice premnaspirodiene oxygenase reduces the infection rate of Xanthomonas oryzae pv. oryzae. J. Plant Biotechnol. 2016, 43, 422–431. [Google Scholar] [CrossRef] [Green Version]
- Galili, G. The aspartate-family pathway of plants: Linking production of essential amino acids with energy and stress regulation. Plant Signal. Behav. 2011, 6, 192–195. [Google Scholar] [CrossRef] [Green Version]
- Zhu, X.; Galili, G. Increased lysine synthesis coupled with a knockout of its catabolism synergistically boosts lysine content and also transregulates the metabolism of other amino acids in Arabidopsis seeds. Plant Cell 2003, 15, 845–853. [Google Scholar] [CrossRef] [Green Version]
- Stepansky, A.; Galili, G. Synthesis of the Arabidopsis bifunctional lysine-ketoglutarate reductase/saccharopine dehydrogenase enzyme of lysine catabolism is concertedly regulated by metabolic and stress-associated signals. Plant Physiol. 2003, 133, 1407–1415. [Google Scholar] [CrossRef] [Green Version]
- Aksakal, O.; Tabay, D.; Esringu, A.; Aksakal, F.I.; Esim, N. Effect of proline on biochemical and molecular mechanisms in lettuce (Lactuca sativa L.) exposed to UV-B radiation. Photochem. Photobiol. Sci. 2017, 16, 246–254. [Google Scholar] [CrossRef]
- Yang, B.; Wang, X.; Gao, C.; Chen, M.; Guan, Q.; Tian, J.; Komatsu, S. Proteomic and metabolomic analyses of leaf from Clematis terniflora DC. exposed to high-Level ultraviolet-B irradiation with dark treatment. J. Proteome Res. 2016, 15, 2643–2657. [Google Scholar] [CrossRef] [PubMed]
- Arruda, P.; Kemper, E.L.; Papes, F.; Leite, A. Regulation of lysine catabolism in higher plants. Trends Plant Sci. 2000, 5, 324–330. [Google Scholar] [CrossRef]
- Noctor, G.; Foyer, C.H. Ascorbate and glutathione: Keeping active oxygen under control. Annu. Rev. Plant Biol. 1998, 49, 249–279. [Google Scholar] [CrossRef]
- Häusler, R.E.; Ludewig, F.; Krueger, S. Amino acids–A life between metabolism and signaling. Plant Sci. 2014, 229, 225–237. [Google Scholar] [CrossRef]
- Buer, C.S.; Imin, N.; Djordjevic, M.A. Flavonoids: New roles for old molecules. J. Integr. Plant Biol. 2010, 52, 98–111. [Google Scholar] [CrossRef]
- Ryan, K.G.; Markham, K.R.; Bloor, S.J.; Bradley, J.M.; Mitchell, K.A.; Jordan, B.R. UVB radiation induced increase in quercetin: Kaempferol ratio in wild-type and transgenic lines of Petunia. Photochem. Photobiol. 1998, 68, 323–330. [Google Scholar] [CrossRef]
- Tattini, M.; Galardi, C.; Pinelli, P.; Massai, R.; Remorini, D.; Agati, G. Differential accumulation of flavonoids and hydroxycinnamates in leaves of Ligustrum vulgare under excess light and drought stress. New Phytol. 2004, 163, 547–561. [Google Scholar] [CrossRef]
- Wang, H.; Hao, J.; Chen, X.; Hao, Z.; Wang, X.; Lou, Y.; Peng, Y.; Guo, Z. Overexpression of rice WRKY89 enhances ultraviolet B tolerance and disease resistance in rice plants. Plant Mol. Biol. 2007, 65, 799–815. [Google Scholar] [CrossRef] [PubMed]
- Guidi, L.; Brunetti, C.; Fini, A.; Agati, G.; Ferrini, F.; Gori, A.; Tattini, M. UV radiation promotes flavonoid biosynthesis, while negatively affecting the biosynthesis and the de-epoxidation of xanthophylls: Consequence for photoprotection? Environ. Exp. Bot. 2016, 127, 14–25. [Google Scholar] [CrossRef]
- Gonzalez Besteiro, M.A.; Ulm, R. ATR and MKP 1 play distinct roles in response to UV-B stress in Arabidopsis. Plant J. 2013, 73, 1034–1043. [Google Scholar] [CrossRef]
- Kliebenstein, D.J.; Monde, R.-A.; Last, R.L. Superoxide dismutase in Arabidopsis: An eclectic enzyme family with disparate regulation and protein localization. Plant Physiol. 1998, 118, 637–650. [Google Scholar] [CrossRef] [Green Version]
- Eguchi, K.; Sato, T. Differences in the ratios of cyanidin-3-O-glucoside and cyanidin-3-O-rutinocide to total anthocyanin under UV and non-UV conditions in Tartary Buckwheat (Fagopyrum tataricum Garten). Plant Prod. Sci. 2009, 12, 150–155. [Google Scholar] [CrossRef]
- Escobar-Bravo, R.; Klinkhamer, P.G.; Leiss, K.A. Interactive effects of UV-B light with abiotic factors on plant growth and chemistry, and their consequences for defense against arthropod herbivores. Front. Plant Sci. 2017, 8, 278. [Google Scholar] [CrossRef] [Green Version]
- Wang, P.; Liu, J.; Liu, B.; Feng, D.; Da, Q.; Shu, S.; Su, J.; Zhang, Y.; Wang, J.; Wang, H.-B. Evidence for a role of chloroplastic m-type thioredoxins in the biogenesis of photosystem II in Arabidopsis. Plant Physiol. 2013, 163, 1710–1728. [Google Scholar] [CrossRef] [Green Version]
- Lee, J.W.; Lee, S.H.; Han, J.W.; Kim, G.H. Early light-inducible protein (ELIP) can enhance resistance to cold-induced photooxidative stress in Chlamydomonas reinhardtii. Front. Physiol. 2020, 11, 1083. [Google Scholar] [CrossRef]
- Ghetti, F.; Checcucci, G.; Bornman, J.F. Environmental uv radiation: Impact on ecosystems and human health and predictive models. In Proceedings of the Nato Advanced Study Institute on Environmental Uv Radiation: Impact on Ecosystems and Human Health and Predictive Models, Pisa, Italy, 3 June 2001. [Google Scholar]
- Ivanov, A.G.; Velitchkova, M.Y.; Allakhverdiev, S.I.; Huner, N.P. Heat stress-induced effects of photosystem I: An overview of structural and functional responses. Photosynth. Res. 2017, 133, 17–30. [Google Scholar] [CrossRef]
- Prasad, S.; Dwivedi, R.; Zeeshan, M. Growth, photosynthetic electron transport, and antioxidant responses of young soybean seedlings to simultaneous exposure of nickel and UV-B stress. Photosynthetica 2005, 43, 177–185. [Google Scholar] [CrossRef]
- Kim, B.-M.; Rhee, J.-S.; Lee, K.-W.; Kim, M.-J.; Shin, K.-H.; Lee, S.-J.; Lee, Y.-M.; Lee, J.-S. UV-B radiation-induced oxidative stress and p38 signaling pathway involvement in the benthic copepod Tigriopus japonicus. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2015, 167, 15–23. [Google Scholar] [CrossRef]
KhalasCR1 | KhalasCR2 | KhalasUR1 | KhalasUR2 | |
---|---|---|---|---|
Total Reads | 43,537,934 | 44,128,934 | 43,871,714 | 44,853,794 |
Mapped Reads | 41,339,168 | 41,716,324 | 41,324,006 | 42,319,388 |
Unmapped Reads | 2,198,766 | 2,412,610 | 2,547,708 | 2,534,406 |
Raw Bases Number | 6,656,845,800 | 6,829,804,800 | 6,770,265,000 | 6,931,021,200 |
GC% | 40% | 39.7% | 41.6% | 39.9% |
Q30% | 94.59% | 93.89% | 93.05% | 94.6% |
Ns Reads (%) | 0.15 | 0.17 | 0.26 | 0.27 |
Raw Reads Number | 44,378,972 | 45,532,032 | 45,135,100 | 46,206,808 |
Clean Reads Number | 43,537,934 | 44,128,934 | 43,871,714 | 44,853,794 |
Clean Reads Rate (%) | 98.11 | 96.92 | 97.2 | 97.07 |
N percentage | 00.00 | 00.00 | 00.00 | 00.00 |
Unigene ID | Log-Fold Change | Nr.annotation | Unigene ID | Log-Fold Change | Nr.annotation |
---|---|---|---|---|---|
Upregulated | Downregulated | ||||
g28829 | 8.65 | proteinYLS9-like | g12140 | 7.29 | galactinol--sucrose galactosyltransferase 2 |
g25277 | 8.94 | germin-like protein 3-8 | g13825 | 7.36 | flavonol synthase/flavanone 3-hydroxylase |
g11369 | 8.79 | protein P21-like | g16474 | 7.28 | fatty acyl-CoA reductase 4 |
g7305 | 7.07 | protein SENSITIVE TO PROTON RHIZOTOXICITY 1-like | g11969 | 7.62 | caffeoylshikimate esterase-like |
g23553 | 7.99 | SNF1-related protein kinase regulatory subunit beta-1-like isoform X1 | g15215 | −6.21 | protein LSD1 isoform X2 |
g20545 | 6.12 | pathogenesis-related protein 1-like | g10248 | −5.64 | CASP-like protein RCOM_0864260 |
g29694 | 6.20 | transcriptional corepressor LEUNIG | g11089 | −5.21 | abscisic acid receptor PYL2 |
g13273 | 6.40 | auxin-induced protein X10A | g18749 | −5.20 | CASP-like protein 6 |
g11179 | 6.23 | probable glutathione S-transferase | g3051 | −5.75 | WAT1-related protein At1g09380 |
g23192 | 6.33 | hypothetical protein [Beta vulgaris subsp. vulgaris] | g17284 | −5.89 | 3-ketoacyl-CoA synthase 6-like |
g20792 | 6.91 | premnaspirodiene oxygenase-like | g14976 | −5.12 | histone-lysine N-methyltransferase EZ1-like isoform X1 |
g8764 | 5.52 | calcium-binding protein CML36 | g17477 | −5.85 | flowering-promoting factor 1-like protein 3 |
g16674 | 5.59 | glucosidase 2 subunit beta | g13339 | −5.36 | short-chain dehydrogenase reductase 3a isoform X2 |
g11260 | 5.61 | strigolactone esterase D14 | g17022 | −4.28 | delta (8)-fatty-acid desaturase 1-like |
g27446 | 5.86 | mavicyanin-like | g17881 | −4.26 | transcription repressor OFP13-like isoform X2 |
g6909 | 5.85 | calcium-binding protein CML36 | g27128 | −4.95 | probable beta-1,3-galactosyltransferase 6 |
g9368 | 5.73 | ABC transporter B family member 11-like | g15595 | −4.37 | very-long-chain 3-oxoacyl-CoA reductase 1 |
g5355 | 5.45 | putative receptor-like protein kinase At4g00960 | g12155 | 4.45 | homeobox protein BEL1 homolog |
g20793 | 4.10 | premnaspirodiene oxygenase-like | g4508 | −4.02 | protein IQ-DOMAIN 1 |
g29073 | 4.17 | putative disease resistance protein RGA3 | g10506 | −4.91 | transcription factor RF2b-like |
g29590 | 4.99 | cysteine-rich receptor-like protein kinase 10, partial | g734 | −4.49 | glucan endo-1,3-beta-glucosidase 14-like isoform X1 |
g28226 | 4.52 | premnaspirodiene oxygenase-like | g967 | −4.58 | long chain acyl-CoA synthetase 6, peroxisomal-like |
g10070 | −4.95 | DNA-damage-repair/toleration protein DRT100 |
Unigene ID | Log-Fold Change | Nr.annotation | Unigene ID | Log-Fold Change | Nr.annotation |
---|---|---|---|---|---|
F-box | |||||
g15721 | 3.04 | F-box/LRR-repeat protein At4g14103-like | g10026 | −1.99 | F-box/kelch-repeat protein At5g60570-like |
g16924 | 2.71 | F-box/LRR-repeat protein 14 isoform X1 | g124 | −3.60 | F-box/kelch-repeat protein At3g61590-like |
g8642 | 2.21 | F-box/LRR-repeat MAX2 homolog A-like | g10348 | −1.27 | EIN3-binding F-box protein 1-like |
g24916 | 1.57 | F-box protein At2g26160-like | g24 | −5.99 | F-box protein At5g49610-like |
g14036 | 1.89 | F-box/kelch-repeat protein At5g15710-like | |||
g12573 | 1.77 | F-box protein At4g00755-like isoform X2 | |||
g2920 | 1.08 | F-box/kelch-repeat protein SKIP6-like | |||
g24233 | 1.79 | F-box-like/WD repeat-containing protein TBL1XR1 | |||
g2912 | 1.15 | F-box/kelch-repeat protein At1g74510-like | |||
g6822 | 1.04 | F-boxprotein At4g18380-like | |||
MYB-transcription factor | |||||
g10079 | 4.47 | myb-related protein Myb4 | g25632 | −3.89 | myb-related protein 306-like |
g7661 | 3.51 | myb-related protein 315-like | |||
g21155 | 2.13 | myb-related protein 306-like | |||
g26123 | 2.22 | myb-related protein Zm1-like | |||
g15549 | 1.83 | target of Myb protein 1-like isoform X1 | |||
g6154 | 2.52 | transcription repressor MYB5 | |||
g9356 | 1.57 | myb-like protein X | |||
NAC transcription factor | |||||
g11223 | 4.88 | NAC domain-containing protein 68-like | |||
g10695 | 3.92 | NAC transcription factor 29-like | |||
g7306 | 1.07 | NAC domain-containing protein 78 | |||
bHLH transcription factor | |||||
g19016 | 3.03 | transcription factor bHLH51-like | |||
g25077 | 2.89 | transcription factor bHLH30-like | |||
g21380 | 2.18 | transcription factor bHLH79-like isoform X1 | |||
WRKY | |||||
g27377 | 3.41 | WRKY transcription factor 9 | g2524 | −1.43 | WRKY transcription factor 44 |
g10593 | 1.73 | WRKY transcription factor 22-like | |||
Protein kinase | |||||
g26059 | 3.06 | protein kinase 2B, chloroplastic-like | |||
g22647 | 2.20 | protein kinase APK1A, chloroplastic | |||
g24262 | 2.13 | shaggy-related protein kinase alpha isoform X1 | |||
g27267 | 2.25 | shaggy-related protein kinase alpha-like | |||
g5427 | 1.42 | Protein kinase APK1A, chloroplastic isoform X1 | |||
g29590 | 4.99 | cysteine-rich receptor-like protein kinase 10, partial | |||
Chaperone protein | |||||
g3048 | 3.18 | chaperone protein dnaJ 11, chloroplastic-like | g17272 | −3.35 | BAG family molecular chaperone regulator 1-like isoform X1 |
g17853 | 2.47 | copper chaperone for superoxide dismutase, chloroplastic | |||
g23747 | 1.52 | chaperone protein dnaJ 1, mitochondrial isoform X1 | |||
g11534 | 1.43 | chaperone protein dnaJ 16 isoform X1 | |||
g14327 | 1.42 | chaperone protein dnaJ 16-like | |||
Calmodulin | |||||
g9795 | 2.10 | calmodulin-like protein 8 | |||
g12680 | 1.50 | calmodulin-binding transcription activator 3-like isoform X1 | |||
g7284 | 1.72 | calmodulin-binding, receptor-like cytoplasmic kinase 2 isoform X1 | |||
protein NRT1/PTR FAMILY | |||||
g7578 | 1.19 | protein NRT1/PTR FAMILY 8.3-like | g23257 | −2.83 | protein NRT1/PTR FAMILY 5.6-like |
g25949 | −2.57 | protein NRT1/PTR FAMILY 5.1-like | |||
g13192 | −3.85 | protein NRT1/PTR FAMILY 7.3-like isoform X1 | |||
g21391 | −3.62 | protein NRT1/PTR FAMILY 6.3-like | |||
ABC transporter | |||||
g9368 | 5.73 | ABC transporter B family member 11-like | g26516 | −3.49 | ABC transporter B family member 2-like |
g22460 | 2.52 | ABC transporter B family member 21-like | g20679 | −3.21 | ABC transporter F family member 4-like isoform X1 |
g9658 | 1.57 | ABC transporter A family member 1 | g15724 | −4.39 | ABC transporter B family member 2-like |
GTP-binding protein | |||||
g14812 | 1.17 | GTP-binding protein YPTM2 | g27583 | −1.56 | GTP-binding protein OBGC, chloroplastic isoform X1 |
Unigene ID | Log-Fold Change | Nr.annotation | Unigene ID | Log-Fold Change | Nr.annotation |
---|---|---|---|---|---|
g20372 | 4.00 | Zeaxanthin, epoxidase, chloroplastic-like | g21231 | −6.36 | Thioredoxin M-type, chloroplastic-like |
g3048 | 3.18 | chaperone protein dnaJ 11, chloroplastic-like | g26467 | −6.71 | early light-induced protein 1, chloroplastic-like |
g26059 | 3.06 | protein kinase 2B, chloroplastic-like | g17433 | −6.32 | magnesium-chelatase subunit ChlH, chloroplastic |
g17853 | 2.47 | copper chaperone for superoxide dismutase, chloroplastic | g14073 | −5.01 | protein CURVATURE THYLAKOID 1B, chloroplastic |
g22647 | 2.20 | protein kinase APK1A, chloroplastic | g12540 | −5.32 | anthranilate synthase beta subunit 2, chloroplastic-like isoform X1 |
g11261 | 2.52 | cyanidin 3-O-rutinoside 5-O-glucosyltransferase-like | g4666 | −5.97 | photosystem II 22 kDa protein, chloroplastic |
g2107 | 2.02 | alpha-amylase 3, chloroplastic isoform X1 | g6369 | −4.06 | early light-induced protein 1, chloroplastic-like |
g8568 | 2.401 | dihydropyrimidine dehydrogenase [NADP (+)]-like | g15019 | −4.18 | photosystemII10-kDa-polypeptide, chloroplastic-like |
g20708 | 2.00 | probable L-ascorbate peroxidase 6, chloroplastic | g18469 | −4.14 | Phosphoglycolate-phosphatase1B, chloroplastic-like |
g23545 | 2.69 | peroxisomal (S)-2-hydroxy-acid oxidase GLO1-like, partial | g24151 | −4.45 | Glutaminesynthetase-leaf, isozyme, chloroplastic, partial |
g27808 | 2.57 | leucine--tRNA ligase, cytoplasmic | g13326 | −3.24 | photosystem I reaction center subunit V, chloroplastic-like |
g24000 | 2.74 | short-chain, type dehydrogenase/reductase-like | g2387 | −3.04 | phytoene synthase 2, chloroplastic-like |
g4958 | 2.02 | protein DJ-1 homolog B-like | g12907 | −3.22 | CBS domain-containing protein CBSX1, chloroplastic-like isoform X1 |
g23419 | 2.23 | sufE-like protein 2, chloroplastic | g1234 | −3.69 | psbP-like protein 2, chloroplastic isoform X1 |
g1185 | 2.72 | pumilio homolog 4-like | g24998 | −3.86 | beta-amylase 1, chloroplastic |
g5427 | 1.42 | protein kinase APK1A, chloroplastic isoform X1 | g8024 | −3.28 | serine/threonine-protein kinase STN8, chloroplastic |
g26814 | 1.2 | glyoxylate/succinic semialdehyde reductase 2, chloroplastic-like, partial | g11142 | −3.88 | protein CHUP1, chloroplastic-like |
g18099 | 1.01709 | phospholipase A I isoform X1 | g13505 | −3.17 | elongation factor G-2, chloroplastic isoform X1 |
g18893 | 1.75339 | cytochrome c oxidase subunit 6b-1-like | g7192 | −3.36 | linoleate 13S-lipoxygenase 2-1, chloroplastic-like |
g16944 | 1.48651 | Bifunctional, aspartokinase/homoserine-dehydrogenase 1, chloroplastic-like isoform X2 | g28350 | −3.49 | Translationfactor-GUF1-homolog, chloroplastic-like, partial |
g2507 | 1.92168 | fructose-bisphosphate aldolase 1, chloroplastic-like | g24478 | −3.23 | protein TIC 62, chloroplastic |
g571 | 1.57951 | stress enhanced protein 2, chloroplastic | g7433 | −3.15 | oxygen-evolving enhancer protein 1, chloroplastic-like |
g22715 | 1.06424 | probable 6-phosphogluconolactonase 4, chloroplastic | g19570 | −3.99 | tuliposide A-converting enzyme 2, chloroplastic-like |
g19022 | 1.09656 | UPF0051 protein in atpA 3′region-like | g16877 | −3.50 | carbonic anhydrase 2 isoform X1 |
g17153 | 1.06724 | oleoyl-acyl carrier protein thioesterase, chloroplastic-like | g8464 | −3.68 | pheophytinase, chloroplastic-like |
g3464 | 1.12812 | kinesin-like protein KIF9 | g21644 | −3.45 | methionine aminopeptidase 1B, chloroplastic-like |
g26671 | 1.15177 | zinc finger protein MAGPIE-like | |||
g3448 | 1.38143 | protein BPS1, chloroplastic-like | |||
g1238 | 1.32983 | protein gar2 [Elaeis guineensis] |
Unigene Name | Direction | Sequence (5′->3′) | Length |
---|---|---|---|
LOC103699391 | Forward | GTTCCAGCAGATCTCCACCT | 20 |
Reverse | CCGGCAATTCCACTGTTTCA | 20 | |
LOC103695855 | Forward | TTTCGAAAGCAGGCAACACA | 20 |
Reverse | TCGACTCGGTTCATGGAGAG | 20 | |
LOC103709833 | Forward | TTCAACGACATCTCCCTCGT | 20 |
Reverse | ATATCCATGCTGCAGTCCGA | 20 | |
LOC103711915 | Forward | ATGACAGGGCTGGTGAAGAA | 20 |
Reverse | TGAGCAGGTCCTCAAACAGT | 20 | |
LOC103715616 | Forward | AGACCTCACGAAGCCAGAAA | 20 |
Reverse | CTCTTCCTCCTCCTCCTCCT | 20 | |
LOC103707665 | Forward | CACAGATTGTCGCACTCGTT | 20 |
Reverse | GCCGGAATCAGGGTCATAGA | 20 | |
LOC103715998 | Forward | CCAACGAAGGCTCTCAAAGG | 20 |
Reverse | TTGGAAGCCTCTGGTACAGG | 20 | |
LOC103719605 | Forward | GCATTCCATCCCATGACACC | 20 |
Reverse | CCATCTTCTCTCCCTCGCAT | 20 | |
LOC103702656 | Forward | TTCGAGTTCTGTGGGCTCTT | 20 |
Reverse | ACGGATAGCCTACTCAACGG | 20 | |
LOC103716074 | Forward | AGGCTGCGTTTGTATGTTCC | 20 |
Reverse | TCACCCAAACAAGGCAAAGG | 20 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Maher, M.; Ahmad, H.; Nishawy, E.; Li, Y.; Luo, J. Novel Transcriptome Study and Detection of Metabolic Variations in UV-B-Treated Date Palm (Phoenix dactylifera cv. Khalas). Int. J. Mol. Sci. 2021, 22, 2564. https://doi.org/10.3390/ijms22052564
Maher M, Ahmad H, Nishawy E, Li Y, Luo J. Novel Transcriptome Study and Detection of Metabolic Variations in UV-B-Treated Date Palm (Phoenix dactylifera cv. Khalas). International Journal of Molecular Sciences. 2021; 22(5):2564. https://doi.org/10.3390/ijms22052564
Chicago/Turabian StyleMaher, Mohamed, Hasan Ahmad, Elsayed Nishawy, Yufei Li, and Jie Luo. 2021. "Novel Transcriptome Study and Detection of Metabolic Variations in UV-B-Treated Date Palm (Phoenix dactylifera cv. Khalas)" International Journal of Molecular Sciences 22, no. 5: 2564. https://doi.org/10.3390/ijms22052564