An Analysis of Differentially Expressed Coding and Long Non-Coding RNAs in Multiple Models of Skeletal Muscle Atrophy
Abstract
:1. Introduction
2. Results
2.1. mRNA and lncRNA Expression Changes during Skeletal Muscle Atrophy
2.2. Functional Characterization of Altered mRNAs in Skeletal Muscle Atrophy
2.3. Identification of lncRNAs That Are Altered in Skeletal Muscle Atrophy
3. Discussion
4. Materials and Methods
4.1. Animal Experiments
4.2. RNA-Seq Library Construction, Sequencing, and Data Analysis
4.3. RNA Purification, Reverse Transcription, and qPCR
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Hon, C.-C.; Ramilowski, J.A.; Harshbarger, J.; Bertin, N.; Rackham, O.J.L.; Gough, J.; Denisenko, E.; Schmeier, S.; Poulsen, T.M.; Severin, J.; et al. An atlas of human long non-coding RNAs with accurate 5′ ends. Nature 2017, 543, 199–204. [Google Scholar] [CrossRef] [Green Version]
- Ma, L.; Cao, J.; Liu, L.; Du, Q.; Li, Z.; Zou, D.; Bajic, V.B.; Zhang, Z. LncBook: A curated knowledgebase of human long non-coding RNAs. Nucleic Acids Res. 2019, 47, D128–D134. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ali, T.; Grote, P. Beyond the RNA-dependent function of LncRNA genes. eLife 2020, 9, e60583. [Google Scholar] [CrossRef]
- Kozomara, A.; Birgaoanu, M.; Griffiths-Jones, S. miRBase: From microRNA sequences to function. Nucleic Acids Res. 2019, 47, D155–D162. [Google Scholar] [CrossRef]
- Bao, Z.; Yang, Z.; Huang, Z.; Zhou, Y.; Cui, Q.; Dong, D. LncRNADisease 2.0: An updated database of long non-coding RNA-associated diseases. Nucleic Acids Res. 2019, 47, D1034–D1037. [Google Scholar] [CrossRef]
- Zhao, H.; Shi, J.; Zhang, Y.; Xie, A.; Yu, L.; Zhang, C.; Lei, J.; Xu, H.; Leng, Z.; Li, T.; et al. LncTarD: A manually-curated database of experimentally-supported functional lncRNA–target regulations in human diseases. Nucleic Acids Res. 2019, 48, D118–D126. [Google Scholar] [CrossRef]
- Aznaourova, M.; Schmerer, N.; Schmeck, B.; Schulte, L.N. Disease-Causing Mutations and Rearrangements in Long Non-coding RNA Gene Loci. Front. Genet. 2020, 11, 527484. [Google Scholar] [CrossRef] [PubMed]
- Larsson, L.; Degens, H.; Li, M.; Salviati, L.; Lee, Y.I.; Thompson, W.; Kirkland, J.L.; Sandri, M. Sarcopenia: Aging-Related Loss of Muscle Mass and Function. Physiol. Rev. 2019, 99, 427–511. [Google Scholar] [CrossRef] [PubMed]
- Gao, Y.; Arfat, Y.; Wang, H.; Goswami, N. Muscle atrophy induced by mechanical unloading: Mechanisms and potential coun-termeasures. Front. Physiol. 2018, 9, 235. [Google Scholar] [CrossRef]
- Picot, J.; Hartwell, D.; Harris, P.; Mendes, D.; Clegg, A.J.; Takeda, A. The effectiveness of interventions to treat severe acute malnutrition in young children: A systematic review. Health Technol. Assess. 2012, 16, 1–316. [Google Scholar] [CrossRef]
- Rohm, M.; Zeigerer, A.; Machado, J.; Herzig, S. Energy metabolism in cachexia. EMBO Rep. 2019, 20, e47258. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, T.; Palus, S.; Springer, J. Skeletal muscle wasting in chronic heart failure. ESC Heart Fail. 2018, 5, 1099–1107. [Google Scholar] [CrossRef]
- Casas, C.; Manzano, R.; Vaz, R.; Osta, R.; Brites, D. Synaptic Failure: Focus in an Integrative View of ALS. Brain Plast. 2016, 1, 159–175. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schiaffino, S.; Dyar, K.A.; Ciciliot, S.; Blaauw, B.; Sandri, M. Mechanisms regulating skeletal muscle growth and atrophy. FEBS J. 2013, 280, 4294–4314. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez, J.; Vernus, B.; Chelh, I.; Cassar-Malek, I.; Gabillard, J.-C.; Sassi, A.H.; Seiliez, I.; Picard, B.; Bonnieu, A. Myostatin and the skeletal muscle atrophy and hypertrophy signaling pathways. Cell. Mol. Life Sci. 2014, 71, 4361–4371. [Google Scholar] [CrossRef] [PubMed]
- Braun, T.P.; Marks, D.L. The regulation of muscle mass by endogenous glucocorticoids. Front. Physiol. 2015, 6, 12. [Google Scholar] [CrossRef] [Green Version]
- Sartori, R.; Romanello, V.; Sandri, M. Mechanisms of muscle atrophy and hypertrophy: Implications in health and disease. Nat. Commun. 2021, 12, 330. [Google Scholar] [CrossRef]
- Hitachi, K.; Tsuchida, K. Role of microRNAs in skeletal muscle hypertrophy. Front. Physiol. 2014, 4, 408. [Google Scholar] [CrossRef] [Green Version]
- Sun, L.; Si, M.; Liu, X.; Choi, J.M.; Wang, Y.; Thomas, S.S.; Peng, H.; Hu, Z. Long-noncoding RNA Atrolnc-1 promotes muscle wasting in mice with chronic kidney disease. J. Cachex. Sarcopenia Muscle 2018, 9, 962–974. [Google Scholar] [CrossRef]
- Alessio, E.; Buson, L.; Chemello, F.; Peggion, C.; Grespi, F.; Martini, P.; Massimino, M.L.; Pacchioni, B.; Millino, C.; Romualdi, C.; et al. Single cell analysis reveals the involvement of the long non-coding RNA Pvt1 in the modulation of muscle atrophy and mi-tochondrial network. Nucleic Acids Res. 2019, 47, 1653–1670. [Google Scholar] [CrossRef] [Green Version]
- Hitachi, K.; Nakatani, M.; Takasaki, A.; Ouchi, Y.; Uezumi, A.; Ageta, H.; Inagaki, H.; Kurahashi, H.; Tsuchida, K. Myogenin promoter-associated lncRNA Myoparr is essential for myogenic differentiation. EMBO Rep. 2019, 20, e47468. [Google Scholar] [CrossRef]
- Hitachi, K.; Nakatani, M.; Tsuchida, K. Long Non-Coding RNA Myoparr Regulates GDF5 Expression in Denervated Mouse Skeletal Muscle. Non-Coding RNA 2019, 5, 33. [Google Scholar] [CrossRef] [Green Version]
- Hitachi, K.; Nakatani, M.; Funasaki, S.; Hijikata, I.; Maekawa, M.; Honda, M.; Tsuchida, K. Expression Levels of Long Non-Coding RNAs Change in Models of Altered Muscle Activity and Muscle Mass. Int. J. Mol. Sci. 2020, 21, 1628. [Google Scholar] [CrossRef] [Green Version]
- Hitachi, K.; Tsuchida, K. The chemical biology of long noncoding RNAs. RNA Technol. 2020, 11, 431–463. [Google Scholar] [CrossRef]
- Fox, D.K.; Ebert, S.M.; Bongers, K.S.; Dyle, M.C.; Bullard, S.A.; Dierdorff, J.M.; Kunkel, S.D.; Adams, C.M. p53 and ATF4 mediate distinct and additive pathways to skeletal muscle atrophy during limb immobilization. Am. J. Physiol. Metab. 2014, 307, E245–E261. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tsujinaka, T.; Fujita, J.; Ebisui, C.; Yano, M.; Kominami, E.; Suzuki, K.; Tanaka, K.; Katsume, A.; Ohsugi, Y.; Shiozaki, H.; et al. Interleukin 6 receptor antibody inhibits muscle atrophy and modulates proteolytic systems in interleukin 6 transgenic mice. J. Clin. Investig. 1996, 97, 244–249. [Google Scholar] [CrossRef] [Green Version]
- Mele, A.; Camerino, G.M.; Calzolaro, S.; Cannone, M.; Conte, D.; Tricarico, M. Dual response of the KATP channels to staurosporine: A novel role of SUR2B, SUR1 and Kir6.2 subunits in the regulation of the atrophy in different skeletal muscle phenotypes. Biochem. Pharmacol. 2014, 91, 266–275. [Google Scholar] [CrossRef]
- Barash, I.A.; Mathew, L.; Lahey, M.; Greaser, M.L.; Lieber, R.L. Muscle LIM protein plays both structural and functional roles in skeletal muscle. Am. J. Physiol. Physiol. 2005, 289, C1312–C1320. [Google Scholar] [CrossRef] [PubMed]
- Cui, C.; Han, S.; Tang, S.; He, H.; Shen, X.; Zhao, J.; Chen, Y.; Wei, Y.; Wang, Y.; Zhu, Q.; et al. The Autophagy Regulatory Molecule CSRP3 Interacts with LC3 and Protects Against Muscular Dystrophy. Int. J. Mol. Sci. 2020, 21, 749. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kaya-Çopur, A.; Marchiano, F.; Hein, M.Y.; Alpern, D.; Russeil, J.; Luis, N.M.; Mann, M.; Deplancke, B.; Habermann, B.H.; Schnorrer, F. The Hippo pathway controls myofibril assembly and muscle fiber growth by regulating sarcomeric gene expression. eLife 2021, 10, e63726. [Google Scholar] [CrossRef]
- MacPherson, P.C.D.; Farshi, P.; Goldman, D. Dach2-Hdac9 signaling regulates reinnervation of muscle endplates. Development 2015, 142, 4038–4048. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nagahara, Y.; Shimazawa, M.; Tanaka, H.; Ono, Y.; Noda, Y.; Ohuchi, K.; Tsuruma, K.; Katsuno, M.; Sobue, G.; Hara, H. Glycoprotein nonmetastatic melanoma protein B ameliorates skeletal muscle lesions in a SOD1G93A mouse model of amyotrophic lateral sclerosis. J. Neurosci. Res. 2015, 93, 1552–1566. [Google Scholar] [CrossRef]
- Costamagna, D.; Duelen, R.; Penna, F.; Neumann, D.; Costelli, P.; Sampaolesi, M. Interleukin-4 administration improves muscle function, adult myogenesis, and lifespan of colon carcinoma-bearing mice. J. Cachex. Sarcopenia Muscle 2020, 11, 783–801. [Google Scholar] [CrossRef] [Green Version]
- Wang, X.; Blagden, C.; Fan, J.; Nowak, S.J.; Taniuchi, I.; Littman, D.R.; Burden, S.J. Runx1 prevents wasting, myofibrillar dis-organization, and autophagy of skeletal muscle. Gene Dev. 2005, 19, 1715–1722. [Google Scholar] [CrossRef] [Green Version]
- Ng, D.C.; Carlsen, R.C.; Walsh, N.A. Neural regulation of the formation of skeletal muscle phosphorylase kinase holoenzyme in adult and developing rat muscle. Biochem. J. 1997, 325, 793–800. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chao, L.C.; Zhang, Z.; Pei, L.; Saito, T.; Tontonoz, P.; Pilch, P.F. Nur77 Coordinately Regulates Expression of Genes Linked to Glucose Metabolism in Skeletal Muscle. Mol. Endocrinol. 2007, 21, 2152–2163. [Google Scholar] [CrossRef] [Green Version]
- Bongers, K.S.; Fox, D.K.; Kunkel, S.D.; Stebounova, L.V.; Murry, D.J.; Pufall, M.A.; Ebert, S.M.; Dyle, M.C.; Bullard, S.A.; Dierdorff, J.M.; et al. Spermine oxidase maintains basal skeletal muscle gene expression and fiber size and is strongly repressed by conditions that cause skeletal muscle atrophy. Am. J. Physiol. Metab. 2015, 308, E144–E158. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bonetto, A.; Aydogdu, T.; Kunzevitzky, N.; Guttridge, D.C.; Khuri, S.; Koniaris, L.G.; Zimmers, T.A. STAT3 Activation in Skeletal Muscle Links Muscle Wasting and the Acute Phase Response in Cancer Cachexia. PLoS ONE 2011, 6, e22538. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stangenberg, L.; Burzyn, D.; Binstadt, B.A.; Weissleder, R.; Mahmood, U.; Benoist, C.; Mathis, D. Denervation protects limbs from inflammatory arthritis via an impact on the microvasculature. Proc. Natl. Acad. Sci. USA 2014, 111, 11419–11424. [Google Scholar] [CrossRef] [Green Version]
- Ulitsky, I.; Shkumatava, A.; Jan, C.H.; Sive, H.; Bartel, D.P. Conserved function of lincRNAs in vertebrate embryonic devel-opment despite rapid sequence evolution. Cell 2011, 147, 1537–1550. [Google Scholar] [CrossRef] [Green Version]
- Goudarzi, M.; Berg, K.; Pieper, L.M.; Schier, A.F. Individual long non-coding RNAs have no overt functions in zebrafish em-bryogenesis, viability and fertility. eLife 2019, 8, e40815. [Google Scholar] [CrossRef]
- Yang, J.-H.; Chang, M.-W.; Pandey, P.R.; Tsitsipatis, D.; Yang, X.; Martindale, J.L.; Munk, R.; De, S.; Abdelmohsen, K.; Gorospe, M. Interaction of OIP5-AS1 with MEF2C mRNA promotes myogenic gene expression. Nucleic Acids Res. 2020, 48, 12943–12956. [Google Scholar] [CrossRef]
- Moretti, I.; Ciciliot, S.; Dyar, K.A.; Abraham, R.; Murgia, M.; Agatea, L.; Akimoto, T.; Bicciato, S.; Forcato, M.; Pierre, P.; et al. MRF4 negatively regulates adult skeletal muscle growth by repressing MEF2 activity. Nat. Commun. 2016, 7, 12397. [Google Scholar] [CrossRef]
- Sakakibara, I.; Santolini, M.; Ferry, A.; Hakim, V.; Maire, P. Six Homeoproteins and a linc-RNA at the Fast MYH Locus Lock Fast Myofiber Terminal Phenotype. PLoS Genet. 2014, 10, e1004386. [Google Scholar] [CrossRef]
- Schutt, C.; Hallmann, A.; Hachim, S.; Klockner, I.; Valussi, M.; Atzberger, A.; Graumann, J.; Braun, T.; Boettger, T. Linc-MYH configures INO 80 to regulate muscle stem cell numbers and skeletal muscle hypertrophy. EMBO J. 2020, 39, e105098. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.; Aydemir, T.B.; Jimenez-Rondan, F.R.; Ruggiero, C.H.; Kim, M.-H.; Cousins, R.J. Deletion of metal transporter Zip14 (Slc39a14) produces skeletal muscle wasting, endotoxemia, Mef2c activation and induction of miR-675 and Hspb. Sci. Rep. 2020, 10, 4050. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Summermatter, S.; Bouzan, A.; Pierrel, E.; Melly, S.; Stauffer, D.; Gutzwiller, S.; Nolin, E.; Dornelas, C.; Fryer, C.; Leighton-Davies, J.; et al. Blockade of Metallothioneins 1 and 2 Increases Skeletal Muscle Mass and Strength. Mol. Cell. Biol. 2017, 37, e00305–16. [Google Scholar] [CrossRef] [Green Version]
- Ciciliot, S.; Rossi, A.C.; Dyar, K.A.; Blaauw, B.; Schiaffino, S. Muscle type and fiber type specificity in muscle wasting. Int. J. Biochem. Cell Biol. 2013, 45, 2191–2199. [Google Scholar] [CrossRef] [PubMed]
- Xing, H.; Zhou, M.; Assinck, P.; Liu, N. Electrical stimulation influences satellite cell differentiation after sciatic nerve crush injury in rats. Muscle Nerve 2015, 51, 400–411. [Google Scholar] [CrossRef]
- He, W.A.; Berardi, E.; Cardillo, V.M.; Acharyya, S.; Aulino, P.; Thomas-Ahner, J.; Wang, J.; Bloomston, M.; Muscarella, P.; Nau, P.; et al. NF-ΚB-mediated Pax7 dysregulation in the muscle microenvironment promotes cancer cachexia. J. Clin. Investig. 2013, 123, 4821–4835. [Google Scholar] [CrossRef] [Green Version]
- Guitart, M.; Lloreta, J.; Mañas-Garcia, L.; Barreiro, E. Muscle regeneration potential and satellite cell activation profile during recovery following hindlimb immobilization in mice. J. Cell. Physiol. 2018, 233, 4360–4372. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fauconneau, B.; Paboeuf, G. Effect of fasting and refeeding on in vitro muscle cell proliferation in rainbow trout (Oncorhynchus mykiss). Cell Tissue Res. 2000, 301, 459–463. [Google Scholar] [CrossRef] [PubMed]
- Li, R.; Li, B.; Jiang, A.; Cao, Y.; Hou, L.; Zhang, Z.; Zhang, X.; Liu, H.; Kim, K.-H.; Wu, W. Exploring the lncRNAs Related to Skeletal Muscle Fiber Types and Meat Quality Traits in Pigs. Genes 2020, 11, 883. [Google Scholar] [CrossRef] [PubMed]
- Dong, A.; Preusch, C.B.; So, W.-K.; Lin, K.; Luan, S.; Yi, R.; Wong, J.W.; Wu, Z.; Cheung, T.H. A long noncoding RNA, LncMyoD, modulates chromatin accessibility to regulate muscle stem cell myogenic lineage progression. Proc. Natl. Acad. Sci. USA 2020, 117, 32464–32475. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Yuan, J.; Chen, F.; Zhang, S.; Zhao, Y.; Chen, X.; Lu, L.; Zhou, L.; Chu, C.Y.; Sun, H.; et al. Long noncoding RNA SAM promotes myoblast proliferation through stabilizing Sugt1 and facilitating kinetochore assembly. Nat. Commun. 2020, 11, 2725. [Google Scholar] [CrossRef]
- Li, J.; Zhao, W.; Li, Q.; Huang, Z.; Shi, G.; Li, C. Long Non-Coding RNA H19 Promotes Porcine Satellite Cell Differentiation by Interacting with TDP43. Genes 2020, 11, 259. [Google Scholar] [CrossRef] [Green Version]
- Wu, T.; Wang, S.; Wang, L.; Zhang, W.; Chen, W.; Lv, X.; Li, Y.; Hussain, Z.; Sun, W. Long Noncoding RNA (lncRNA) CTTN-IT1 Elevates Skeletal Muscle Satellite Cell Proliferation and Differentiation by Acting as ceRNA for YAP1 Through Absorbing miR-29a in Hu Sheep. Front. Genet. 2020, 11, 843. [Google Scholar] [CrossRef] [PubMed]
- Tseng, Y.-C.; Kulp, S.K.; Lai, I.-L.; Hsu, E.-C.; He, W.A.; Frankhouser, D.E.; Yan, P.S.; Mo, X.; Bloomston, M.; Lesinski, G.B.; et al. Preclinical Investigation of the Novel Histone Deacetylase Inhibitor AR-42 in the Treatment of Cancer-Induced Cachexia. J. Natl. Cancer Inst. 2015, 107, djv274. [Google Scholar] [CrossRef] [Green Version]
- Pertea, M.; Kim, D.; Pertea, G.M.; Leek, J.T.; Salzberg, S.L. Transcript-level expression analysis of RNA-seq experiments with HISAT, StringTie and Ballgown. Nat. Protoc. 2016, 11, 1650–1667. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. 1000 Genome Project Data Processing Subgroup. The Sequence Alignment/Map format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef] [Green Version]
- Niknafs, Y.S.; Pandian, B.; Iyer, H.K.; Chinnaiyan, A.M.; Iyer, M.K. TACO produces robust multisample transcriptome assem-blies from RNA-Seq. Nat. Methods 2017, 14, 68–70. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-Seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, L.; Park, H.J.; Dasari, S.; Wang, S.; Kocher, J.-P.; Li, W. CPAT: Coding-Potential Assessment Tool using an alignment-free logistic regression model. Nucleic Acids Res. 2013, 41, e74. [Google Scholar] [CrossRef]
- Zhou, Y.; Zhou, B.; Pache, L.; Chang, M.; Khodabakhshi, A.H.; Tanaseichuk, O.; Benner, C.; Chanda, S.K. Metascape provides a biologist-oriented resource for the analysis of systems-level datasets. Nat. Commun. 2019, 10, 1523. [Google Scholar] [CrossRef] [PubMed]
- Li, T.; Chen, B.; Yang, P.; Wang, D.; Du, B.; Kang, L. Long non-coding RNA derived from lncRNA–mRNA co-expression net-works modulates the locust phase change. Genom. Proteom. Bioinform. 2020, in press. [Google Scholar] [CrossRef] [PubMed]
- Reimand, J.; Isserlin, R.; Voisin, V.; Kucera, M.; Tannus-Lopes, C.; Rostamianfar, A.; Wadi, L.; Meyer, M.; Wong, J.; Xu, C.; et al. Pathway enrichment analysis and visualization of omics data using g: Profiler, GSEA, Cytoscape and EnrichmentMap. Nat. Protoc. 2019, 14, 482–517. [Google Scholar] [CrossRef] [PubMed]
Target Name | Forward | Reverse |
---|---|---|
linc-Myh | GTGCAGCCAGAACAAGACAG | CAAGATGGGAGGCTCTCAAA |
Oip5os1 | ATAAACAGGCGCCACCATCA | CAGCACAGCCTGAGTCTGAA |
2310015D24Rik | AGCTATCCACAGCCAGAGGA | GACGTCAAAGGTCTGCAGGA |
Gm4544 | CTGACTCCCCCAAGTTGTCC | GAGCTGTGATTGCAGATGCG |
Gm46085 | AAACCCCCAAAACCCCAACT | CCCTGGGTCCTCATTTTCCC |
Gm49794 | GTCAACTGCCTTAGCCAGGT | TCACAGCTTCTGCACCTCAG |
G3896 | AGAGGAGGCAGGGTAACGAT | CCGTGGGTTCTGCTTTTTGG |
G11259 | AAACCGTACCACTGGAGCAG | CAGTTTCCCTATGCAGCCCA |
G22235 | TTTTCCCAGTGCCCAACAGT | ACACTGAATACCCTGGCTGC |
G22346 | TTTCTGTGACTCCGTGACCG | TTGCAAGGAGATGGCGTTCT |
G1852 | TTGCCATCACCAGTAGCCTG | GGGAGTGGCTCTCTCAGAGA |
G9255 | AATCCTCTCCCCAGAGCTGT | AGGAGGACCAATACCCAGGG |
G10427 | CCACCTTTGACTCAGGCCTT | TATGATGAGCTGGGACCCCA |
G10533 | TCGAGTCTGTTCCACATGGC | TCCTCAGGGCTAGGACTTCC |
G11197 | AAGAGAGTGTTTCCTGGCCG | TGAGGGATTGCATGTGCCAT |
G12564 | GCCTGAGGACATTGTGGTGA | TGTCTTCTTCAGGCAGCCAG |
G12658 | GCAGAGACCTTTCTGACCCC | GGTGGTGACAGAGAAGGGTG |
G24021 | GTTCCTGTACCTGGGGTTGG | ACATGTGGGTGAGCTGATGG |
Rpl26 | GGTCTATGCCCATTCGGAAGG | TCGTTCGATGTAGATGACGTACT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hitachi, K.; Nakatani, M.; Kiyofuji, Y.; Inagaki, H.; Kurahashi, H.; Tsuchida, K. An Analysis of Differentially Expressed Coding and Long Non-Coding RNAs in Multiple Models of Skeletal Muscle Atrophy. Int. J. Mol. Sci. 2021, 22, 2558. https://doi.org/10.3390/ijms22052558
Hitachi K, Nakatani M, Kiyofuji Y, Inagaki H, Kurahashi H, Tsuchida K. An Analysis of Differentially Expressed Coding and Long Non-Coding RNAs in Multiple Models of Skeletal Muscle Atrophy. International Journal of Molecular Sciences. 2021; 22(5):2558. https://doi.org/10.3390/ijms22052558
Chicago/Turabian StyleHitachi, Keisuke, Masashi Nakatani, Yuri Kiyofuji, Hidehito Inagaki, Hiroki Kurahashi, and Kunihiro Tsuchida. 2021. "An Analysis of Differentially Expressed Coding and Long Non-Coding RNAs in Multiple Models of Skeletal Muscle Atrophy" International Journal of Molecular Sciences 22, no. 5: 2558. https://doi.org/10.3390/ijms22052558