Development and Evaluation of a Newcastle Disease Virus-like Particle Vaccine Expressing SARS-CoV-2 Spike Protein with Protease-Resistant and Stability-Enhanced Modifications
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Construction of Recombinant Baculovirus Plasmids
2.3. Generation of Recombinant Baculoviruses (rBVs)
2.4. IFA
2.5. VLP Production, Characterization, and Purification
2.6. Western Blot
2.7. Immunization Study of BALB/c Mice
2.8. Determination of the S Protein-Specific IgG, IgG1, and IgG2a Antibody Titers
2.9. Construction of ACE2 Overexpressing 293T Cell Line
2.10. Packaging and Characterization of SARS-CoV-2 Pseudovirus
2.11. Pseudovirus Neutralization Assay
2.12. Analysis of CD4+ and CD8+ T Cells in Lung and Spleen by Flow Cytometry
2.13. Evaluation of Cellular Immune Response by qRT-PCR
2.14. Statistical Analysis
3. Results
3.1. Generation and Characterization of rBVs
3.2. Production and Characterization of NDV-S3Q2P-VLP
3.3. Validation of 293T-hACE2 Cell Line and SARS-CoV-2 Pseudovirus
3.4. NDV-S3Q2P-VLPs Immunization Elicits High Titers of S Protein-Specific IgG, IgG1, and IgG2a Antibodies in Mice
3.5. NDV-S3Q2P-VLP Immunization Triggers Potent Neutralizing Antibody Responses Against SARS-CoV-2 Pseudovirus
3.6. NDV-S3Q2P-VLP Immunization Promotes Robust T Cell Immunity in Mice
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Mansour, H.M. The interference between SARS-COV-2 and Alzheimer’s disease: Potential immunological and neurobiological crosstalk from a kinase perspective reveals a delayed pandemic. Ageing Res. Rev. 2024, 94, 102195. [Google Scholar] [CrossRef] [PubMed]
- Yee, R.; Carranza, D.; Kim, C.; Trinidad, J.P.; Tobias, J.L.; Bhatkoti, R.; Kuwabara, S. COVID-19 Vaccination Site Accessibility, United States, December 11, 2020-March 29, 2022. Emerg. Infect. Dis. 2024, 30, 947–955. [Google Scholar] [CrossRef]
- Carabelli, A.M.; Peacock, T.P.; Thorne, L.G.; Harvey, W.T.; Hughes, J.; Peacock, S.J.; Barclay, W.S.; de Silva, T.I.; Towers, G.J.; Robertson, D.L. SARS-CoV-2 variant biology: Immune escape, transmission and fitness. Nat. Rev. Microbiol. 2023, 21, 162–177. [Google Scholar] [CrossRef]
- Harrison, A.G.; Lin, T.; Wang, P. Mechanisms of SARS-CoV-2 Transmission and Pathogenesis. Trends Immunol. 2020, 41, 1100–1115. [Google Scholar] [CrossRef]
- Lacek, K.A.; Rambo-Martin, B.L.; Batra, D.; Zheng, X.Y.; Hassell, N.; Sakaguchi, H.; Peacock, T.; Groves, N.; Keller, M.; Wilson, M.M.; et al. SARS-CoV-2 Delta-Omicron Recombinant Viruses, United States. Emerg. Infect. Dis. 2022, 28, 1442–1445. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Thambiraja, T.S.; Karuppanan, K.; Subramaniam, G. Omicron and Delta variant of SARS-CoV-2: A comparative computational study of spike protein. J. Med. Virol. 2022, 94, 1641–1649. [Google Scholar] [CrossRef] [PubMed]
- Duong, B.V.; Larpruenrudee, P.; Fang, T.; Hossain, S.I.; Saha, S.C.; Gu, Y.; Islam, M.S. Is the SARS CoV-2 Omicron Variant Deadlier and More Transmissible Than Delta Variant? Int. J. Environ. Res. Public Health 2022, 19, 4586. [Google Scholar] [CrossRef] [PubMed]
- Khehra, N.; Padda, I.; Jaferi, U.; Atwal, H.; Narain, S.; Parmar, M.S. Tozinameran (BNT162b2) Vaccine: The Journey from Preclinical Research to Clinical Trials and Authorization. AAPS PharmSciTech 2021, 22, 172. [Google Scholar] [CrossRef] [PubMed]
- Patel, P.; Macdonald, J.C.; Boobalan, J.; Marsden, M.; Rizzi, R.; Zenon, M.; Ren, J.; Chu, H.; Cappelleri, J.C.; Roychoudhury, S.; et al. Regulatory agilities impacting review timelines for Pfizer/BioNTech’s BNT162b2 mRNA COVID-19 vaccine: A retrospective study. Front. Med. 2023, 10, 1275817. [Google Scholar] [CrossRef] [PubMed]
- Corbett, K.S.; Werner, A.P.; Connell, S.O.; Gagne, M.; Lai, L.; Moliva, J.I.; Flynn, B.; Choi, A.; Koch, M.; Foulds, K.E.; et al. mRNA-1273 protects against SARS-CoV-2 beta infection in nonhuman primates. Nat. Immunol. 2021, 22, 1306–1315. [Google Scholar] [CrossRef] [PubMed]
- Roberts-McCarthy, E.; Buck, P.O.; Smith-Ray, R.L.; Van de Velde, N.; Singh, T.; Mansi, J.; Shah, A.; Taitel, M. Factors associated with receipt of mRNA-1273 vaccine at a United States national retail pharmacy during the COVID-19 pandemic. Vaccine 2023, 41, 4257–4266. [Google Scholar] [CrossRef] [PubMed]
- Knoll, M.D.; Wonodi, C. Oxford-AstraZeneca COVID-19 vaccine efficacy. Lancet 2021, 397, 72–74. [Google Scholar] [CrossRef] [PubMed]
- Voysey, M.; Clemens, S.A.C.; Madhi, S.A.; Weckx, L.Y.; Folegatti, P.M.; Aley, P.K.; Angus, B.; Baillie, V.L.; Barnabas, S.L.; Bhorat, Q.E.; et al. Safety and efficacy of the ChAdOx1 nCoV-19 vaccine (AZD1222) against SARS-CoV-2: An interim analysis of four randomised controlled trials in Brazil, South Africa, and the UK. Lancet 2021, 397, 99–111. [Google Scholar] [CrossRef]
- Lewis, N.M.; Self, W.H.; Gaglani, M.; Ginde, A.A.; Douin, D.J.; Keipp Talbot, H.; Casey, J.D.; Mohr, N.M.; Zepeski, A.; Ghamande, S.A.; et al. Effectiveness of the Ad26.COV2.S (Johnson & Johnson) Coronavirus Disease 2019 (COVID-19) Vaccine for Preventing COVID-19 Hospitalizations and Progression to High Disease Severity in the United States. Clin. Infect. Dis. 2022, 75, S159–S166. [Google Scholar] [CrossRef]
- Stephenson, K.E.; Le Gars, M.; Sadoff, J.; de Groot, A.M.; Heerwegh, D.; Truyers, C.; Atyeo, C.; Loos, C.; Chandrashekar, A.; McMahan, K.; et al. Immunogenicity of the Ad26.COV2.S Vaccine for COVID-19. JAMA 2021, 325, 1535–1544. [Google Scholar] [CrossRef]
- Jin, L.; Li, Z.; Zhang, X.; Li, J.; Zhu, F. CoronaVac: A review of efficacy, safety, and immunogenicity of the inactivated vaccine against SARS-CoV-2. Hum. Vaccines Immunother. 2022, 18, 2096970. [Google Scholar] [CrossRef] [PubMed]
- Fonseca, M.H.G.; de Souza, T.F.G.; de Carvalho Araújo, F.M.; de Andrade, L.O.M. Dynamics of antibody response to CoronaVac vaccine. J. Med. Virol. 2022, 94, 2139–2148. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Belayachi, J.; Yang, Y.; Fu, Q.; Rodewald, L.; Li, H.; Yan, B.; Wang, Y.; Shen, Y.; Yang, Q.; et al. Real-world study of the effectiveness of BBIBP-CorV (Sinopharm) COVID-19 vaccine in the Kingdom of Morocco. BMC Public Health 2022, 22, 1584. [Google Scholar] [CrossRef] [PubMed]
- Abdelhafiz, A.S.; Ali, A.; Kamel, M.M.; Ahmed, E.H.; Sayed, D.M.; Bakry, R.M. Sinopharm’s BBIBP-CorV Vaccine and ChAdOx1 nCoV-19 Vaccine Are Associated with a Comparable Immune Response against SARS-CoV-2. Vaccines 2022, 10, 1462. [Google Scholar] [CrossRef]
- Roldão, A.; Mellado, M.C.; Castilho, L.R.; Carrondo, M.J.; Alves, P.M. Virus-like particles in vaccine development. Expert. Rev. Vaccines 2010, 9, 1149–1176. [Google Scholar] [CrossRef] [PubMed]
- Chroboczek, J.; Szurgot, I.; Szolajska, E. Virus-like particles as vaccine. Acta Biochim. Pol. 2014, 61, 531–539. [Google Scholar] [CrossRef] [PubMed]
- Frietze, K.M.; Peabody, D.S.; Chackerian, B. Engineering virus-like particles as vaccine platforms. Curr. Opin. Virol. 2016, 18, 44–49. [Google Scholar] [CrossRef] [PubMed]
- Pattyn, J.; Hendrickx, G.; Vorsters, A.; Van Damme, P. Hepatitis B Vaccines. J. Infect. Dis. 2021, 224, S343–S351. [Google Scholar] [CrossRef]
- Mohsen, M.O.; Zha, L.; Cabral-Miranda, G.; Bachmann, M.F. Major findings and recent advances in virus-like particle (VLP)-based vaccines. Semin. Immunol. 2017, 34, 123–132. [Google Scholar] [CrossRef] [PubMed]
- Gupta, G.; Glueck, R.; Patel, P.R. HPV vaccines: Global perspectives. Hum. Vaccines Immunother. 2017, 13, 1421–1424. [Google Scholar] [CrossRef]
- Huang, S.; Zhang, X.; Su, Y.; Zhuang, C.; Tang, Z.; Huang, X.; Chen, Q.; Zhu, K.; Hu, X.; Ying, D.; et al. Long-term efficacy of a recombinant hepatitis E vaccine in adults: 10-year results from a randomised, double-blind, placebo-controlled, phase 3 trial. Lancet 2024, 403, 813–823. [Google Scholar] [CrossRef]
- Tan, T.K.; Rijal, P.; Rahikainen, R.; Keeble, A.H.; Schimanski, L.; Hussain, S.; Harvey, R.; Hayes, J.W.P.; Edwards, J.C.; McLean, R.K.; et al. A COVID-19 vaccine candidate using SpyCatcher multimerization of the SARS-CoV-2 spike protein receptor-binding domain induces potent neutralising antibody responses. Nat. Commun. 2021, 12, 542. [Google Scholar] [CrossRef] [PubMed]
- Chu, K.B.; Kang, H.J.; Yoon, K.W.; Lee, H.A.; Moon, E.K.; Han, B.K.; Quan, F.S. Influenza Virus-like Particle (VLP) Vaccines Expressing the SARS-CoV-2 S Glycoprotein, S1, or S2 Domains. Vaccines 2021, 9, 920. [Google Scholar] [CrossRef]
- Yang, H.; Tian, J.; Zhao, J.; Zhao, Y.; Zhang, G. The Application of Newcastle Disease Virus (NDV): Vaccine Vectors and Tumor Therapy. Viruses 2024, 16, 886. [Google Scholar] [CrossRef] [PubMed]
- Fulber, J.P.C.; Kamen, A.A. Development and Scalable Production of Newcastle Disease Virus-Vectored Vaccines for Human and Veterinary Use. Viruses 2022, 14, 975. [Google Scholar] [CrossRef]
- McGinnes, L.W.; Pantua, H.; Laliberte, J.P.; Gravel, K.A.; Jain, S.; Morrison, T.G. Assembly and biological and immunological properties of Newcastle disease virus-like particles. J. Virol. 2010, 84, 4513–4523. [Google Scholar] [CrossRef] [PubMed]
- Pantua, H.D.; McGinnes, L.W.; Peeples, M.E.; Morrison, T.G. Requirements for the assembly and release of Newcastle disease virus-like particles. J. Virol. 2006, 80, 11062–11073. [Google Scholar] [CrossRef]
- Morrison, T.G. Newcastle disease virus-like particles as a platform for the development of vaccines for human and agricultural pathogens. Future Virol. 2010, 5, 545–554. [Google Scholar] [CrossRef]
- Wrapp, D.; Wang, N.; Corbett, K.S.; Goldsmith, J.A.; Hsieh, C.L.; Abiona, O.; Graham, B.S.; McLellan, J.S. Cryo-EM structure of the 2019-nCoV spike in the prefusion conformation. Science 2020, 367, 1260–1263. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Shi, W.; Abiona, O.M.; Nazzari, A.; Olia, A.S.; Ou, L.; Phung, E.; Stephens, T.; Tsybovsky, Y.; Verardi, R.; et al. Newcastle Disease Virus-Like Particles Displaying Prefusion-Stabilized SARS-CoV-2 Spikes Elicit Potent Neutralizing Responses. Vaccines 2021, 9, 73. [Google Scholar] [CrossRef]
- Bangaru, S.; Ozorowski, G.; Turner, H.L.; Antanasijevic, A.; Huang, D.; Wang, X.; Torres, J.L.; Diedrich, J.K.; Tian, J.H.; Portnoff, A.D.; et al. Structural analysis of full-length SARS-CoV-2 spike protein from an advanced vaccine candidate. Science 2020, 370, 1089–1094. [Google Scholar] [CrossRef]
- Hu, J.; Zhang, Q.; Peng, P.; Li, R.; Li, J.; Wang, X.; Gu, M.; Hu, Z.; Hu, S.; Liu, X.; et al. Baculovirus-derived influenza virus-like particle confers complete protection against lethal H7N9 avian influenza virus challenge in chickens and mice. Vet. Microbiol. 2022, 264, 109306. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Li, R.; Zhang, Q.; Peng, P.; Wang, X.; Gu, M.; Hu, Z.; Jiao, X.; Peng, D.; Hu, J.; et al. H7N9 influenza virus-like particle based on BEVS protects chickens from lethal challenge with highly pathogenic H7N9 avian influenza virus. Vet. Microbiol. 2021, 258, 109106. [Google Scholar] [CrossRef] [PubMed]
- Reed, L.J.; Muench, H. A simple method of estimating fifty per cent endpoints. Am. J. Epidemiol. 1938, 27, 493–497. [Google Scholar] [CrossRef]
- Wei, J.; Alfajaro, M.M.; Cai, W.L.; Graziano, V.R.; Strine, M.S.; Filler, R.B.; Biering, S.B.; Sarnik, S.A.; Patel, S.; Menasche, B.L.; et al. The KDM6A-KMT2D-p300 axis regulates susceptibility to diverse coronaviruses by mediating viral receptor expression. PLoS Pathog. 2023, 19, e1011351. [Google Scholar] [CrossRef] [PubMed]
- Boscardin, S.B.; Hafalla, J.C.; Masilamani, R.F.; Kamphorst, A.O.; Zebroski, H.A.; Rai, U.; Morrot, A.; Zavala, F.; Steinman, R.M.; Nussenzweig, R.S.; et al. Antigen targeting to dendritic cells elicits long-lived T cell help for antibody responses. J. Exp. Med. 2006, 203, 599–606. [Google Scholar] [CrossRef]
- Cui, X.; Xiang, Q.; Huang, Y.; Ji, Q.; Hu, Z.; Shi, T.; Bao, G.; Liu, Y. Mixed Th1/Th2/Th17 Responses Induced by Plant Oil Adjuvant-Based B. bronchiseptica Vaccine in Mice, with Mechanisms Unraveled by RNA-Seq, 16S rRNA and Metabolomics. Vaccines 2024, 12, 1182. [Google Scholar] [CrossRef] [PubMed]
- Chen, Q.; Ghilardi, N.; Wang, H.; Baker, T.; Xie, M.H.; Gurney, A.; Grewal, I.S.; de Sauvage, F.J. Development of Th1-type immune responses requires the type I cytokine receptor TCCR. Nature 2000, 407, 916–920. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Grabowski, K.A.; Xin, J.P.; Coleman, J.; Huang, Z.; Espiritu, B.; Alkan, S.; Xie, H.B.; Zhu, Y.; White, F.A.; et al. IL-4 induces differentiation and expansion of Th2 cytokine-producing eosinophils. J. Immunol. 2004, 172, 2059–2066. [Google Scholar] [CrossRef] [PubMed]
- He, L.; Zhong, J.; Li, G.; Lin, Z.; Zhao, P.; Yang, C.; Wang, H.; Zhang, Y.; Yang, X.; Wang, Z. Development of SARS-CoV-2 animal vaccines using a stable and efficient NDV expression system. J. Med. Virol. 2023, 95, e28237. [Google Scholar] [CrossRef]
- Warner, B.M.; Yates, J.G.E.; Vendramelli, R.; Truong, T.; Meilleur, C.; Chan, L.; Leacy, A.; Pham, P.H.; Pei, Y.; Susta, L.; et al. Intranasal vaccination with an NDV-vectored SARS-CoV-2 vaccine protects against Delta and Omicron challenges. NPJ Vaccines 2024, 9, 90. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.Y.; Zhang, H.Q.; Zhang, Y.N.; Zhang, Z.R.; Li, X.D.; Hao, M.C.; Zhang, Y.; Li, J.Q.; Hu, Y.Y.; Chen, X.L.; et al. Newcastle Disease Virus (NDV)-based vaccine candidate against SARS-CoV-2 Omicron by intranasal immunization. Antivir. Res. 2023, 220, 105757. [Google Scholar] [CrossRef]
- Sun, W.; McCroskery, S.; Liu, W.C.; Leist, S.R.; Liu, Y.; Albrecht, R.A.; Slamanig, S.; Oliva, J.; Amanat, F.; Schäfer, A.; et al. A Newcastle Disease Virus (NDV) Expressing a Membrane-Anchored Spike as a Cost-Effective Inactivated SARS-CoV-2 Vaccine. Vaccines 2020, 8, 771. [Google Scholar] [CrossRef]
- Shirvani, E.; Samal, S.K. Newcastle Disease Virus as a Vaccine Vector for SARS-CoV-2. Pathogens 2020, 9, 619. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Mateus, J.; Coelho, C.H.; Dan, J.M.; Moderbacher, C.R.; Gálvez, R.I.; Cortes, F.H.; Grifoni, A.; Tarke, A.; Chang, J.; et al. Humoral and cellular immune memory to four COVID-19 vaccines. Cell 2022, 185, 2434–2451.e17. [Google Scholar] [CrossRef]
- Karbiener, M.; Farcet, M.R.; Zollner, A.; Masuda, T.; Mori, M.; Moschen, A.R.; Kreil, T.R. Calibrated comparison of SARS-CoV-2 neutralizing antibody levels in response to protein-, mRNA-, and vector-based COVID-19 vaccines. NPJ Vaccines 2022, 7, 22. [Google Scholar] [CrossRef] [PubMed]
- Paramithiotis, E.; Sugden, S.; Papp, E.; Bonhomme, M.; Chermak, T.; Crawford, S.Y.; Demetriades, S.Z.; Galdos, G.; Lambert, B.L.; Mattison, J.; et al. Cellular Immunity Is Critical for Assessing COVID-19 Vaccine Effectiveness in Immunocompromised Individuals. Front. Immunol. 2022, 13, 880784. [Google Scholar] [CrossRef] [PubMed]
- Løken, R.; Fevang, B. Cellular immunity in COVID-19 and other infections in Common variable immunodeficiency. Front. Immunol. 2023, 14, 1124279. [Google Scholar] [CrossRef] [PubMed]
- Charland, N.; Gobeil, P.; Pillet, S.; Boulay, I.; Séguin, A.; Makarkov, A.; Heizer, G.; Bhutada, K.; Mahmood, A.; Trépanier, S.; et al. Safety and immunogenicity of an AS03-adjuvanted plant-based SARS-CoV-2 vaccine in Adults with and without Comorbidities. NPJ Vaccines 2022, 7, 142. [Google Scholar] [CrossRef]








| Primer Name | Primer Sequence (5′-3′) |
|---|---|
| pVLS3Q2P-F | CCACCATCGGGCGCGGATCCATGTTTGTTTTTCTTGTT |
| pVLS3Q2P-R | CTGCTCATACTTTCCAAGTTCTTGGAGATCGATG |
| pVLFtmct-F | AACTTGGAAAGTATGAGCAGTCTGCTCTCATTACCTAT |
| pVLFtmct-R | GAGCCACCACAAGAGCATGATCTAGAATTCCGGAGCGG |
| pVLM-F | GGTACCTTCTAGAATTCATGGACTCATCCAGGACAATC |
| pVLM-R | ATACAATCCTTTCAGGAAAGGAAGCGGAGCTACTAACCAGCCTGCTGAAGCAGGCTGGA |
| pVLNP-F | CCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGACCTTCGTCTGTTTTCGACGAATAC |
| pVLNP-R | GACACTGACTGGGGGTACTGAGCGGCCGCTGCAGATC |
| Primer Name | Primer Sequence (5′-3′) |
|---|---|
| IFN-γ-F | AAGCGTCATTGAATCACACC |
| IFN-γ-R | CGAATCAGCAGCGACTCCTT |
| IL-2-F | TTCAATTGGAAGATGCTGAGA |
| IL-2-R | ATCATCGAATTGGCACTCAA |
| IL-4-F | TTTTGAACGAGGTCACAGGA |
| IL-4-R | AGCCCTACAGACGAGCTCAC |
| β-actin-F | CATCCGTAAAGACCTCTATGCCAAC |
| β-actin-R | ATGGAGCCACCGATCCACA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, Y.; Tian, F.; Hu, S.; Liu, X. Development and Evaluation of a Newcastle Disease Virus-like Particle Vaccine Expressing SARS-CoV-2 Spike Protein with Protease-Resistant and Stability-Enhanced Modifications. Viruses 2024, 16, 1932. https://doi.org/10.3390/v16121932
Chen Y, Tian F, Hu S, Liu X. Development and Evaluation of a Newcastle Disease Virus-like Particle Vaccine Expressing SARS-CoV-2 Spike Protein with Protease-Resistant and Stability-Enhanced Modifications. Viruses. 2024; 16(12):1932. https://doi.org/10.3390/v16121932
Chicago/Turabian StyleChen, Yu, Fan Tian, Shunlin Hu, and Xiufan Liu. 2024. "Development and Evaluation of a Newcastle Disease Virus-like Particle Vaccine Expressing SARS-CoV-2 Spike Protein with Protease-Resistant and Stability-Enhanced Modifications" Viruses 16, no. 12: 1932. https://doi.org/10.3390/v16121932
APA StyleChen, Y., Tian, F., Hu, S., & Liu, X. (2024). Development and Evaluation of a Newcastle Disease Virus-like Particle Vaccine Expressing SARS-CoV-2 Spike Protein with Protease-Resistant and Stability-Enhanced Modifications. Viruses, 16(12), 1932. https://doi.org/10.3390/v16121932

