Development and Validation of a Panel of One-Step Four-Plex qPCR/RT-qPCR Assays for Simultaneous Detection of SARS-CoV-2 and Other Pathogens Associated with Canine Infectious Respiratory Disease Complex
Abstract
1. Introduction
2. Materials and Methods
2.1. Viruses and Bacteria
2.2. Clinical Specimens
2.3. Nucleic Acid Extraction
2.4. Primers and Probe Design
2.5. Specific Multiplex TaqMan® Quantitative PCR (qPCR) and Reverse Transcription PCR (RT-qPCR) Assays for Canine Respiratory Pathogens
2.6. Synthesis of In Vitro Transcribed RNA and DNA
2.7. Analytical Parameter Determination and Statistical Analysis
3. Results
3.1. Analytical Specificity of Singleplex and Multiplex Assays for the Detection of Canine Respiratory Pathogens
3.2. Analytical Sensitivity of Singleplex and Multiplex Assays for the Detection of Canine Respiratory Pathogens
3.3. Repeatability and Reproducibility of Multiplex qPCR/RT-qPCR Assays for Detection of Canine Respiratory Pathogens
3.4. Use of Multiplex Assays on Biological Specimens from CIRDC-Suspected Dogs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Buonavoglia, C.; Martella, V. Canine Respiratory Viruses. Vet. Res. 2007, 38, 355–373. [Google Scholar] [CrossRef] [PubMed]
- Reagan, K.L.; Sykes, J.E. Canine Infectious Respiratory Disease. Vet. Clin. N. Am. Small Anim. Pract. 2020, 50, 405–418. [Google Scholar] [CrossRef] [PubMed]
- Mitchell, J.A.; Cardwell, J.M.; Leach, H.; Walker, C.A.; Le Poder, S.; Decaro, N.; Rusvai, M.; Egberink, H.; Rottier, P.; Fernandez, M.; et al. European Surveillance of Emerging Pathogens Associated with Canine Infectious Respiratory Disease. Vet. Microbiol. 2017, 212, 31–38. [Google Scholar] [CrossRef]
- Matsuu, A.; Yabuki, M.; Aoki, E.; Iwahana, M. Molecular Detection of Canine Respiratory Pathogens between 2017 and 2018 in Japan. J. Vet. Med. Sci. 2020, 82, 690–694. [Google Scholar] [CrossRef]
- Hiebl, A.; Auer, A.; Bagrinovschi, G.; Stejskal, M.; Hirt, R.; Rümenapf, H.T.; Tichy, A.; Künzel, F. Detection of Selected Viral Pathogens in Dogs with Canine Infectious Respiratory Disease in Austria. J. Small Anim. Pract. 2019, 60, 594–600. [Google Scholar] [CrossRef] [PubMed]
- Lavan, R.; Knesl, O. Prevalence of Canine Infectious Respiratory Pathogens in Asymptomatic Dogs Presented at US Animal Shelters. J. Small Anim. Pract. 2015, 56, 572–576. [Google Scholar] [CrossRef]
- Sowman, H.R.; Cave, N.J.; Dunowska, M. A Survey of Canine Respiratory Pathogens in New Zealand Dogs. N. Z. Vet. J. 2018, 66, 236–242. [Google Scholar] [CrossRef]
- Decaro, N.; Mari, V.; Larocca, V.; Losurdo, M.; Lanave, G.; Lucente, M.S.; Corrente, M.; Catella, C.; Bo, S.; Elia, G.; et al. Molecular Surveillance of Traditional and Emerging Pathogens Associated with Canine Infectious Respiratory Disease. Vet. Microbiol. 2016, 192, 21–25. [Google Scholar] [CrossRef]
- Erles, K.; Dubovi, E.J.; Brooks, H.W.; Brownlie, J. Longitudinal Study of Viruses Associated with Canine Infectious Respiratory Disease. J. Clin. Microbiol. 2004, 42, 4524–4529. [Google Scholar] [CrossRef]
- Weese, J.S.; Stull, J. Respiratory Disease Outbreak in a Veterinary Hospital Associated with Canine Parainfluenza Virus Infection. Can. Vet. J. 2013, 54, 79–82. [Google Scholar]
- Priestnall, S.L.; Mitchell, J.A.; Walker, C.A.; Erles, K.; Brownlie, J. New and Emerging Pathogens in Canine Infectious Respiratory Disease. Vet. Pathol. 2014, 51, 492–504. [Google Scholar] [CrossRef] [PubMed]
- Maboni, G.; Seguel, M.; Lorton, A.; Berghaus, R.; Sanchez, S. Canine Infectious Respiratory Disease: New Insights into the Etiology and Epidemiology of Associated Pathogens. PLoS ONE 2019, 14, e0215817. [Google Scholar] [CrossRef] [PubMed]
- Day, M.J.; Carey, S.; Clercx, C.; Kohn, B.; MarsilIo, F.; Thiry, E.; Freyburger, L.; Schulz, B.; Walker, D.J. Aetiology of Canine Infectious Respiratory Disease Complex and Prevalence of Its Pathogens in Europe. J. Comp. Pathol. 2020, 176, 86–108. [Google Scholar] [CrossRef]
- Ditchfield, J.; Macpherson, L.W.; Zbitnew, A. Association of Canine Adenovirus (Toronto A 26/61) with an Outbreak of Laryngotracheitis (“Kennel Cough”). Can. Vet. J. 1962, 3, 238–246. [Google Scholar] [PubMed]
- Karpas, A.; King, N.W.; Garcia, F.G.; Calvo, F.; Cross, R.E. Canine Tracheobronchitis: Isolation and Characterization of the Agent with Experimental Reproduction of the Disease. Proc. Soc. Exp. Biol. Med. 1968, 127, 45–52. [Google Scholar] [CrossRef]
- Appel, M.J.; Percy, D.H. SV-5-like Parainfluenza Virus in Dogs. J. Am. Vet. Med. Assoc. 1970, 156, 1778–1781. [Google Scholar] [PubMed]
- Erles, K.; Toomey, C.; Brooks, H.W.; Brownlie, J. Detection of a Group 2 Coronavirus in Dogs with Canine Infectious Respiratory Disease. Virology 2003, 310, 216–223. [Google Scholar] [CrossRef]
- Erles, K.; Brownlie, J. Canine Respiratory Coronavirus: An Emerging Pathogen in the Canine Infectious Respiratory Disease Complex. Vet. Clin. North Am. Small Anim. Pract. 2008, 38, 815–825. [Google Scholar] [CrossRef]
- Chalker, V.J.; Brooks, H.W.; Brownlie, J. The Association of Streptococcus Equi Subsp. Zooepidemicus with Canine Infectious Respiratory Disease. Vet. Microbiol. 2003, 95, 149–156. [Google Scholar] [CrossRef]
- Priestnall, S.; Erles, K. Streptococcus Zooepidemicus: An Emerging Canine Pathogen. Vet. J. 2011, 188, 142–148. [Google Scholar] [CrossRef]
- Dong, J.; Tsui, W.N.T.; Leng, X.; Fu, J.; Lohman, M.; Anderson, J.; Hamill, V.; Lu, N.; Porter, E.P.; Gray, M.; et al. Development of a Three-Panel Multiplex Real-Time PCR Assay for Simultaneous Detection of Nine Canine Respiratory Pathogens. J. Microbiol. Methods 2022, 199, 106528. [Google Scholar] [CrossRef]
- Hong, S.; Kim, O. Molecular Identification of Mycoplasma Cynos from Laboratory Beagle Dogs with Respiratory Disease. Lab. Anim. Res. 2012, 28, 61–66. [Google Scholar] [CrossRef] [PubMed]
- Chalker, V.J.; Owen, W.M.A.; Paterson, C.; Barker, E.; Brooks, H.; Rycroft, A.N.; Brownlie, J. Mycoplasmas Associated with Canine Infectious Respiratory Disease. Microbiology 2004, 150, 3491–3497. [Google Scholar] [CrossRef] [PubMed]
- Jambhekar, A.; Robin, E.; Le Boedec, K. A Systematic Review and Meta-Analyses of the Association between 4 Mycoplasma Species and Lower Respiratory Tract Disease in Dogs. J. Vet. Intern. Med. 2019, 33, 1880–1891. [Google Scholar] [CrossRef]
- Wasik, B.R.; Voorhees, I.E.H.; Parrish, C.R. Canine and Feline Influenza. Cold Spring Harb. Perspect. Med. 2021, 11, a038562. [Google Scholar] [CrossRef] [PubMed]
- Crawford, P.C.; Dubovi, E.J.; Castleman, W.L.; Stephenson, I.; Gibbs, E.P.J.; Chen, L.; Smith, C.; Hill, R.C.; Ferro, P.; Pompey, J.; et al. Transmission of Equine Influenza Virus to Dogs. Science 2005, 310, 482–485. [Google Scholar] [CrossRef] [PubMed]
- Zhu, H.; Hughes, J.; Murcia, P.R. Origins and Evolutionary Dynamics of H3N2 Canine Influenza Virus. J. Virol. 2015, 89, 5406–5418. [Google Scholar] [CrossRef]
- Voorhees, I.E.H.; Glaser, A.L.; Toohey-Kurth, K.; Newbury, S.; Dalziel, B.D.; Dubovi, E.J.; Poulsen, K.; Leutenegger, C.; Willgert, K.J.E.; Brisbane-Cohen, L.; et al. Spread of Canine Influenza A(H3N2) Virus, United States. Emerg. Infect. Dis. 2017, 23, 1950–1957. [Google Scholar] [CrossRef]
- Damiani, A.M.; Kalthoff, D.; Beer, M.; Müller, E.; Osterrieder, N. Serological Survey in Dogs and Cats for Influenza A(H1N1)Pdm09 in Germany. Zoonoses Public Health 2012, 59, 549–552. [Google Scholar] [CrossRef]
- Dundon, W.G.; De Benedictis, P.; Viale, E.; Capua, I. Serologic Evidence of Pandemic (H1N1) 2009 Infection in Dogs, Italy. Emerg. Infect. Dis. 2010, 16, 2019–2021. [Google Scholar] [CrossRef]
- Renshaw, R.W.; Zylich, N.C.; Laverack, M.A.; Glaser, A.L.; Dubovi, E.J. Pneumovirus in Dogs with Acute Respiratory Disease. Emerg. Infect. Dis. 2010, 16, 993–995. [Google Scholar] [CrossRef]
- Renshaw, R.; Laverack, M.; Zylich, N.; Glaser, A.; Dubovi, E. Genomic Analysis of a Pneumovirus Isolated from Dogs with Acute Respiratory Disease. Vet. Microbiol. 2011, 150, 88–95. [Google Scholar] [CrossRef] [PubMed]
- Decaro, N.; Pinto, P.; Mari, V.; Elia, G.; Larocca, V.; Camero, M.; Terio, V.; Losurdo, M.; Martella, V.; Buonavoglia, C. Full-Genome Analysis of a Canine Pneumovirus Causing Acute Respiratory Disease in Dogs, Italy. PLoS ONE 2014, 9, e85220. [Google Scholar] [CrossRef] [PubMed]
- Mitchell, J.A.; Cardwell, J.M.; Renshaw, R.W.; Dubovi, E.J.; Brownlie, J. Detection of Canine Pneumovirus in Dogs with Canine Infectious Respiratory Disease. J. Clin. Microbiol. 2013, 51, 4112–4119. [Google Scholar] [CrossRef] [PubMed]
- Piewbang, C.; Techangamsuwan, S. Phylogenetic Evidence of a Novel Lineage of Canine Pneumovirus and a Naturally Recombinant Strain Isolated from Dogs with Respiratory Illness in Thailand. BMC Vet. Res. 2019, 15, 300. [Google Scholar] [CrossRef]
- More, G.D.; Cave, N.J.; Biggs, P.J.; Acke, E.; Dunowska, M. A Molecular Survey of Canine Respiratory Viruses in New Zealand. N. Z. Vet. J. 2021, 69, 224–233. [Google Scholar] [CrossRef]
- Song, X.; Li, Y.; Huang, J.; Cao, H.; Zhou, Q.; Sha, X.; Zhang, B. An Emerging Orthopneumovirus Detected from Dogs with Canine Infectious Respiratory Disease in China. Transbound. Emerg. Dis. 2021, 68, 3217–3221. [Google Scholar] [CrossRef]
- Hao, X.; Liu, R.; He, Y.; Xiao, X.; Xiao, W.; Zheng, Q.; Lin, X.; Tao, P.; Zhou, P.; Li, S. Multiplex PCR Methods for Detection of Several Viruses Associated with Canine Respiratory and Enteric Diseases. PLoS ONE 2019, 14, e0213295. [Google Scholar] [CrossRef]
- Andersen, K.G.; Rambaut, A.; Lipkin, W.I.; Holmes, E.C.; Garry, R.F. The Proximal Origin of SARS-CoV-2. Nat. Med. 2020, 26, 450–452. [Google Scholar] [CrossRef]
- Wu, F.; Zhao, S.; Yu, B.; Chen, Y.-M.; Wang, W.; Song, Z.-G.; Hu, Y.; Tao, Z.-W.; Tian, J.-H.; Pei, Y.-Y.; et al. A New Coronavirus Associated with Human Respiratory Disease in China. Nature 2020, 579, 265–269. [Google Scholar] [CrossRef]
- Zhou, P.; Yang, X.-L.; Wang, X.-G.; Hu, B.; Zhang, L.; Zhang, W.; Si, H.-R.; Zhu, Y.; Li, B.; Huang, C.-L.; et al. A Pneumonia Outbreak Associated with a New Coronavirus of Probable Bat Origin. Nature 2020, 579, 270–273. [Google Scholar] [CrossRef]
- Padilla-Blanco, M.; Vega, S.; Enjuanes, L.; Morey, A.; Lorenzo, T.; Marín, C.; Ivorra, C.; Maiques, E.; Rubio, V.; Rubio-Guerri, C. Detection of SARS-CoV-2 in a Dog with Hemorrhagic Diarrhea. BMC Vet. Res. 2022, 18, 370. [Google Scholar] [CrossRef] [PubMed]
- Sit, T.H.C.; Brackman, C.J.; Ip, S.M.; Tam, K.W.S.; Law, P.Y.T.; To, E.M.W.; Yu, V.Y.T.; Sims, L.D.; Tsang, D.N.C.; Chu, D.K.W.; et al. Infection of Dogs with SARS-CoV-2. Nature 2020, 586, 776–778. [Google Scholar] [CrossRef]
- Shi, J.; Wen, Z.; Zhong, G.; Yang, H.; Wang, C.; Huang, B.; Liu, R.; He, X.; Shuai, L.; Sun, Z.; et al. Susceptibility of Ferrets, Cats, Dogs, and Other Domesticated Animals to SARS-Coronavirus 2. Science 2020, 368, 1016–1020. [Google Scholar] [CrossRef] [PubMed]
- Fernández-Bastit, L.; Rodon, J.; Pradenas, E.; Marfil, S.; Trinité, B.; Parera, M.; Roca, N.; Pou, A.; Cantero, G.; Lorca-Oró, C.; et al. First Detection of SARS-CoV-2 Delta (B.1.617.2) Variant of Concern in a Dog with Clinical Signs in Spain. Viruses 2021, 13, 2526. [Google Scholar] [CrossRef] [PubMed]
- Garigliany, M.; Van Laere, A.-S.; Clercx, C.; Giet, D.; Escriou, N.; Huon, C.; van der Werf, S.; Eloit, M.; Desmecht, D. SARS-CoV-2 Natural Transmission from Human to Cat, Belgium, March 2020. Emerg. Infect. Dis. 2020, 26, 3069–3071. [Google Scholar] [CrossRef] [PubMed]
- Decaro, N.; Balboni, A.; Bertolotti, L.; Martino, P.A.; Mazzei, M.; Mira, F.; Pagnini, U. SARS-CoV-2 Infection in Dogs and Cats: Facts and Speculations. Front. Vet. Sci. 2021, 8, 619207. [Google Scholar] [CrossRef]
- Bosco-Lauth, A.M.; Hartwig, A.E.; Porter, S.M.; Gordy, P.W.; Nehring, M.; Byas, A.D.; VandeWoude, S.; Ragan, I.K.; Maison, R.M.; Bowen, R.A. Experimental Infection of Domestic Dogs and Cats with SARS-CoV-2: Pathogenesis, Transmission, and Response to Reexposure in Cats. Proc. Natl. Acad. Sci. USA 2020, 117, 26382–26388. [Google Scholar] [CrossRef]
- Lyoo, K.-S.; Yeo, Y.-H.; Lee, S.-G.; Yeom, M.; Lee, J.-Y.; Kim, K.-C.; Song, D. Susceptibility to SARS-CoV-2 and MERS-CoV in Beagle Dogs. Animals 2023, 13, 624. [Google Scholar] [CrossRef]
- Lyoo, K.-S.; Lee, H.; Lee, S.-G.; Yeom, M.; Lee, J.-Y.; Kim, K.-C.; Yang, J.-S.; Song, D. Experimental Infection and Transmission of SARS-CoV-2 Delta and Omicron Variants among Beagle Dogs. Emerg. Infect. Dis. 2023, 29, 782–785. [Google Scholar] [CrossRef]
- Pan, Z.; Lu, J.; Wang, N.; He, W.-T.; Zhang, L.; Zhao, W.; Su, S. Development of a TaqMan-Probe-Based Multiplex Real-Time PCR for the Simultaneous Detection of Emerging and Reemerging Swine Coronaviruses. Virulence 2020, 11, 707–718. [Google Scholar] [CrossRef]
- Wang, R.; Zhang, W.; Ye, R.; Pan, Z.; Li, G.; Su, S. One-Step Multiplex TaqMan Probe-Based Method for Real-Time PCR Detection of Four Canine Diarrhea Viruses. Mol. Cell. Probes. 2020, 53, 101618. [Google Scholar] [CrossRef] [PubMed]
- Carossino, M.; Barrandeguy, M.E.; Erol, E.; Li, Y.; Balasuriya, U.B.R. Development and Evaluation of a One-Step Multiplex Real-Time TaqMan® RT-QPCR Assay for the Detection and Genotyping of Equine G3 and G14 Rotaviruses in Fecal Samples. Virol. J. 2019, 16, 49. [Google Scholar] [CrossRef]
- Carossino, M.; Balasuriya, U.B.R.; Thieulent, C.J.; Barrandeguy, M.E.; Vissani, M.A.; Parreño, V. Quadruplex Real-Time TaqMan® RT-QPCR Assay for Differentiation of Equine Group A and B Rotaviruses and Identification of Group A G3 and G14 Genotypes. Viruses 2023, 15, 1626. [Google Scholar] [CrossRef] [PubMed]
- Lu, X.; Wang, L.; Sakthivel, S.K.; Whitaker, B.; Murray, J.; Kamili, S.; Lynch, B.; Malapati, L.; Burke, S.A.; Harcourt, J.; et al. US CDC Real-Time Reverse Transcription PCR Panel for Detection of Severe Acute Respiratory Syndrome Coronavirus 2. Emerg. Infect. Dis. 2020, 26, 1654–1665. [Google Scholar] [CrossRef]
- Decaro, N.; Amorisco, F.; Desario, C.; Lorusso, E.; Camero, M.; Bellacicco, A.L.; Sciarretta, R.; Lucente, M.S.; Martella, V.; Buonavoglia, C. Development and Validation of a Real-Time PCR Assay for Specific and Sensitive Detection of Canid Herpesvirus 1. J. Virol. Methods 2010, 169, 176–180. [Google Scholar] [CrossRef] [PubMed]
- Tizolova, A.; Brun, D.; Guiso, N.; Guillot, S. Development of Real-Time PCR Assay for Differential Detection of Bordetella Bronchiseptica and Bordetella Parapertussis. Diagn. Microbiol. Infect. Dis. 2014, 78, 347–351. [Google Scholar] [CrossRef] [PubMed]
- Tallmadge, R.L.; Anderson, R.; Mitchell, P.K.; Forbes, Z.C.; Werner, B.; Gioia, G.; Moroni, P.; Glaser, A.; Thachil, A.J.; Goodman, L.B. Characterization of a Novel Mycoplasma Cynos Real-Time PCR Assay. J. VET Diagn. Investig. 2020, 32, 793–801. [Google Scholar] [CrossRef]
- Båverud, V.; Johansson, S.K.; Aspan, A. Real-Time PCR for Detection and Differentiation of Streptococcus Equi Subsp. Equi and Streptococcus Equi Subsp. Zooepidemicus. Vet. Microbiol. 2007, 124, 219–229. [Google Scholar] [CrossRef]
- Lu, Z.; Dubovi, E.J.; Zylich, N.C.; Crawford, P.C.; Sells, S.; Go, Y.Y.; Loynachan, A.T.; Timoney, P.J.; Chambers, T.M.; Balasuriya, U.B.R. Diagnostic Application of H3N8-Specific Equine Influenza Real-Time Reverse Transcription Polymerase Chain Reaction Assays for the Detection of Canine Influenza Virus in Clinical Specimens. J. VET Diagn. Investig. 2010, 22, 942–945. [Google Scholar] [CrossRef]
- Lu, Z.; Chambers, T.M.; Boliar, S.; Branscum, A.J.; Sturgill, T.L.; Timoney, P.J.; Reedy, S.E.; Tudor, L.R.; Dubovi, E.J.; Vickers, M.L.; et al. Development and Evaluation of One-Step TaqMan Real-Time Reverse Transcription-PCR Assays Targeting Nucleoprotein, Matrix, and Hemagglutinin Genes of Equine Influenza Virus. J. Clin. Microbiol. 2009, 47, 3907–3913. [Google Scholar] [CrossRef]
- Spackman, E.; Senne, D.A.; Myers, T.J.; Bulaga, L.L.; Garber, L.P.; Perdue, M.L.; Lohman, K.; Daum, L.T.; Suarez, D.L. Development of a Real-Time Reverse Transcriptase PCR Assay for Type A Influenza Virus and the Avian H5 and H7 Hemagglutinin Subtypes. J. Clin. Microbiol. 2002, 40, 3256–3260. [Google Scholar] [CrossRef] [PubMed]
- Dowgier, G.; Mari, V.; Losurdo, M.; Larocca, V.; Colaianni, M.L.; Cirone, F.; Lucente, M.S.; Martella, V.; Buonavoglia, C.; Decaro, N. A Duplex Real-Time PCR Assay Based on TaqMan Technology for Simultaneous Detection and Differentiation of Canine Adenovirus Types 1 and 2. J. Virol. Methods 2016, 234, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Slomka, M.J.; Densham, A.L.E.; Coward, V.J.; Essen, S.; Brookes, S.M.; Irvine, R.M.; Spackman, E.; Ridgeon, J.; Gardner, R.; Hanna, A.; et al. Original Article: Real Time Reverse Transcription (RRT)-Polymerase Chain Reaction (PCR) Methods for Detection of Pandemic (H1N1) 2009 Influenza Virus and European Swine Influenza A Virus Infections in Pigs: SIV and Pandemic (H1N1) 2009 Detection by RRT PCRs. Influenza Other Respir. Viruses 2010, 4, 277–293. [Google Scholar] [CrossRef]
- Burd, E.M. Validation of Laboratory-Developed Molecular Assays for Infectious Diseases. Clin. Microbiol. Rev. 2010, 23, 550–576. [Google Scholar] [CrossRef] [PubMed]
- Conway, J.R.; Lex, A.; Gehlenborg, N. UpSetR: An R Package for the Visualization of Intersecting Sets and Their Properties. Bioinformatics 2017, 33, 2938–2940. [Google Scholar] [CrossRef] [PubMed]
- Percopo, C.M.; Dubovi, E.J.; Renshaw, R.W.; Dyer, K.D.; Domachowske, J.B.; Rosenberg, H.F. Canine Pneumovirus Replicates in Mouse Lung Tissue and Elicits Inflammatory Pathology. Virology 2011, 416, 26–31. [Google Scholar] [CrossRef]
- Harvey, W.T.; Carabelli, A.M.; Jackson, B.; Gupta, R.K.; Thomson, E.C.; Harrison, E.M.; Ludden, C.; Reeve, R.; Rambaut, A.; Peacock, S.J.; et al. SARS-CoV-2 Variants, Spike Mutations and Immune Escape. Nat. Rev. Microbiol. 2021, 19, 409–424. [Google Scholar] [CrossRef]
- Thieulent, C.J.; Carossino, M.; Peak, L.; Wolfson, W.; Balasuriya, U.B.R. Development and Validation of Multiplex One-Step QPCR/RT-QPCR Assays for Simultaneous Detection of SARS-CoV-2 and Pathogens Associated with Feline Respiratory Disease Complex. PLoS ONE 2023. under review. [Google Scholar]
- Thieulent, C.J.; Carossino, M.; Peak, L.; Wolfson, W.; Balasuriya, U.B.R. Multiplex One-Step RT-QPCR Assays for Simultaneous Detection of SARS-CoV-2 and Other Enteric Viruses of Dogs and Cats. Viruses 2023. under review. [Google Scholar]
- Viitanen, S.J.; Lappalainen, A.; Rajamäki, M.M. Co-Infections with Respiratory Viruses in Dogs with Bacterial Pneumonia. J. Vet. Intern. Med. 2015, 29, 544–551. [Google Scholar] [CrossRef]


| Pathogens | Reference Strain | Source |
|---|---|---|
| Canine Herpesvirus 1 (CHV-1) | VR-552TM | ATCC® |
| Canine Adenovirus 2 (CAdV-2) | VR-800TM | ATCC® |
| Canine Parainfluenza Virus (CPiV) | VR-399TM | ATCC® |
| Canine Respiratory Coronavirus (CRCoV) | VSL-1471 | Cornell Universitya |
| Canine Distemper Virus (CDV) Lederle Avirulent | NR-3845 | BEI Resources |
| Murine Pneumonia virus (MPV) | VR-1819 | ATCC® |
| SARS-CoV-2 USA-WA1/2020 | NR-52281 | BEI Resources |
| SARS-CoV-2 Alpha (Lineage B.1.1.7) | NR-54020 | BEI Resources |
| SARS-CoV-2 Beta (Lineage B.1.351) | NR-55282 | BEI Resources |
| SARS-CoV-2 Delta (Lineage B.1.617.2) | NR-55671 | BEI Resources |
| SARS-CoV-2 Omicron (Lineage B.1.1.529) | NR-56461 | BEI Resources |
| Canine Influenza A (CIV) H3N2 | VLS-1355 | Cornell University a |
| CIV H3N8 | A/Ca/FL/15592/04 | Cornell University b |
| CIV H3N8 | A/Ca/FL/61156.2/07 | Cornell University b |
| Influenza A virus, A/California/04/2009 (H1N1)pdm09 | NR-13658 | BEI Resources |
| Bordetella bronchiseptica, E014 | NR-44164 | BEI Resources |
| Streptococcus equi susb. zooepidemicus Farrow and Collins | 700400TM | ATCC® |
| Mycoplasma cynos Rosendal | 27544TM | ATCC® |
| Mycoplasma canis, PG 14 | NR-3865 | BEI Resources |
| Canine Adenovirus 1 (CAdV-1) | VR-293TM | ATCC® |
| Canine Enteric Coronavirus (CECoV), UCD1 | NR-868 | BEI Resources |
| Mycoplasma felis Cole et al. | 23391TM | ATCC® |
| Target (Gene) | Oligonucleotide ID | Primers and Probe Sequences (5’–3’) | Nucleotide Position | Product Size(bp) | GenBank Accession | Reference |
|---|---|---|---|---|---|---|
| CPiV (Nucleoprotein) | CPiV_N-F CPiV_N-R CPiV_N-P | ACCATCAGCCACAATGCTCA | 298–317 | EF543648.1 | This article | |
| AGCGGAATGATCCCTCCTCA | 401–382 | 104 | ||||
| FAM-AGCTGACCAGTCACCAGAAGC-QSY | 331–351 | |||||
| Canine Influenza A virus (CIV) (Matrix protein) | CIV_M-F CIV_M-R1 a CIV_M-R2 a CIV_M-P | AGATGAGTCTTCTAACCGAGGTCG | 24–47 | MF173222.1 | [62,64] with modification | |
| YGCAAAGACATCTTCAAGTCTCTG TGCAAAGACACTTTCCAGTCTCTG | 124–101 124–101 | 101 | ||||
| VIC-TCAGGCCCCCTCAAAGCCGA-QSY | 74–93 | |||||
| CAdV-2 (Hexon) | CAdV2_H-F CAdV2_H-R CAdV2_H-P | AGTAATGGAAACCTAGGGG | 17,821–17,839 | U77082.1 | [63] with modification | |
| TCTGTGTTTCTGTCTTGC | 17,900–17,883 | 80 | ||||
| ABY-TCAGTCATCYCAGCTCAATGCCGTG-QSY | 17,874–17,850 | |||||
| CDV (Phosphoprotein) | CDV_P-F CDV_P-R CDV_P-P | ACTATTGAGAGACCTCCAGCTGAAA | 1296–1320 | AB028914.1 | This article | |
| TGCGGTATCCTTCGGTTTGT | 1374–1355 | 79 | ||||
| JUN-CCGATTGCCGAGCTAGACTCTTTGTCA-QSY | 1352–1326 | |||||
| SARS-CoV-2 (Nucleocapsid) | 2019-nCoV_N1-F 2019-nCoV_N1-R 2019-nCoV_N1-P | GACCCCAAAATCAGCGAAAT | 28,287–28,306 | MN985325.1 | [55] | |
| TCTGGTTACTGCCAGTTGAATCTG | 28,358-28,335 | 72 | ||||
| FAM-ACCCCGCATTACGTTTGGTGGACC-QSY | 28,309–28,332 | |||||
| CPnV (Nucleocapsid) | CPnV_N-F CPnV_N-R CPnV_N-P | CAGGACAAGTTATGCTRAGGT | 1825–1845 | NC_025344.1 | This article | |
| CTCAACCACCTGTTCCATCTC | 1925–1905 | 101 | ||||
| VIC-AGCTTGAACACTAGCATGGCCTAGC-QSY | 1904–1880 | |||||
| CRCoV (Nucleocapsid) | CRCoV_N-F CRCoV_N-R CRCoV_N-P | CCTCTGGAAATCGTTCTGGTAA | 8273–8294 | DQ682406.1 | This article | |
| GCTTGGGTTGAGCTCTTCTA | 8371–8352 | 99 | ||||
| ABY-ACTGATCGGCCCACTTAAGGATGC-QSY | 8320–8297 | |||||
| CHV-1 (Glycoprotein B) | CHV_gB-F CHV_gB-R CHV_gB-P | ACAGAGTTGATTGATAGAAGAGGTATG | 439–465 | AF361073.1 | [56] | |
| CTGGTGTATTAAACTTTGAAGGCTTTA | 574–548 | 136 | ||||
| JUN-TCTCTGGGGTCTTCATCCTTATCAAATGCG-QSY | 539–510 | |||||
| Bordetella bronchiseptica (Intergenomic region between flaA and fliA B) | Fla2-F Fla12-R Fla-P | AGGCTCCCAAGAGAGAAAGGCTT | 1,140,858–1,140,880 | 118 | CP019934.1 | [57] |
| AAACCTGCCGTAATCCAGGC | 1,140,975–1,140,956 | |||||
| FAM-ACCGGGCAGCTAGGCCGC-QSY | 1,140,887–1,140,904 | |||||
| Mycoplasma cynos (tuf) | Mcynos_tuf-F Mcynos_tuf-R Mcynos_tuf-P | TCTTCGTATTTAGCATCACCTTCAAGT | 8234–8260 | FJ896395.1 | [58] | |
| TGATGGAGATAATGCGCCAAT | 8305–8285 | 72 | ||||
| VIC-CTTTTAAAGCTGAACCACG-QSY | 8262–8280 | |||||
| Streptococcus equi subsp. zooepidemicus (sodA) | SodA-F SodA-R SodA-Bd 4116/06-R SodA-P | AGAGCAATTCACAGCAGCA | 246–264 | JN631988.1 | [59] | |
| ACCAGCCTTATTCACAACCA ACCGGCTTGGTTAACCACTA | 318–299 318–299 | 73 | ||||
| ABY-CAGGCCCAACCTGAGCCAAA-QSY | 296–277 | |||||
| Mycoplasma canis (tuf) | Mcanis_tuf-F Mcanis_tuf-R Mcanis_tuf-P | CAACAGCATCCATTAATTCCAT | 305–326 | FJ896394.1 | This article | |
| ACGGATTTGACGGAGATAAC | 412–393 | 108 | ||||
| JUN-TGAAGCTGATCCACGGATAATTGGAGC-QSY | 366–392 | |||||
| Canine H3N2 (Neuraminidase) | H3N2_NA-F H3N2_NA-R H3N2_NA-P | CCGTTGAAGGCAAAAGCTGT | 1251–1270 | MF173401.1 | This article | |
| TCTCTTGTGGCCCTCCTCTT | 1319–1300 | 69 | ||||
| FAM-AATAGGTGTTTTTATGTGGAGTTGAT-QSY | 1274–1299 | |||||
| Canine H3N8 (Hemagglutinin) | H3N8_HA3-F H3N8_HA3-R H3N8_HA3-P | TCACATGGACAGGTGTCACTCA | 448–469 | MF173285.1 | [60,61] | |
| GGCTGATCCCCTTTTGCA | 506–489 | 59 | ||||
| JUN-AACGGAAGAAGTGGAGC-QSY | 471–487 | |||||
| Canine H1N1 (Neuraminidase) | H1N1_NA-FH1N1_NA-R H1N1_NA-P | GCGGGCAATTCCTCTCTC | 256–276 | MG254090.1 | This article | |
| CTTGGAACCGATTCKTACACTRT | 333–311 | 78 | ||||
| ABY-TGYCCTGTTAGTGGATGGGCTATATACAGT-QSY | 274–303 |
| Assay | Target | Parameter | Slope | Linearity (R2) | Efficiency (%) | LOD95% (Copies/µL) | Detection Rate Limit (Copies/µL) | Ct Cut-Off |
|---|---|---|---|---|---|---|---|---|
| CRA_1 | CAdV-2 (H) | Singleplex | −3.024 | 0.999 | 114.14 | 4 | 10 | 34 |
| Four-plex | −3.057 | 0.998 | 112.38 | 5 | 10 | 35 | ||
| CPiV (NP) | Singleplex | −3.037 | 0.999 | 113.44 | 5 | 10 | 35 | |
| Four-plex | −3.053 | 0.999 | 112.59 | 5 | 10 | 34 | ||
| CDV (P) | Singleplex | −3.042 | 0.999 | 113.17 | 4 | 10 | 36 | |
| Four-plex | −3.090 | 0.999 | 110.68 | 4 | 10 | 35 | ||
| CIA (M) | Singleplex | −3.142 | 0.999 | 108.10 | 4 | 10 | 37 | |
| Four-plex | −3.113 | 0.999 | 109.52 | 4 | 10 | 34 | ||
| CRA_2 | CRCoV (N) | Singleplex | −3.258 | 0.999 | 102.74 | 10 | 100 | 35 |
| Four-plex | −3.335 | 0.999 | 99.46 | 8 | 10 | 34 | ||
| SARS-CoV-2 (N1) | Singleplex | −3.248 | 0.999 | 103.18 | 5 | 10 | 39 | |
| four-plex | −3.313 | 0.999 | 100.37 | 5 | 10 | 37 | ||
| CHV-1 (gB) | Singleplex | −3.264 | 0.999 | 102.48 | 12 | 100 | 35 | |
| Four-plex | −3.350 | 0.999 | 98.84 | 14 | 100 | 38 | ||
| CPnV (N) | Singleplex | −3.309 | 0.999 | 100.54 | 6 | 10 | 40 | |
| Four-plex | −3.379 | 0.996 | 97.67 | 6 | 10 | 36 | ||
| CRA_3 | S. equi subsp. zooepidemicus (sodA) | Singleplex | −3.240 | 0.999 | 103.54 | 6 | 10 | 34 |
| Four-plex | −3.169 | 0.998 | 106.80 | 15 | 100 | 35 | ||
| B. bronchiseptica (flaA-fliA-B) | Singleplex | −3.229 | 0.999 | 104.03 | 6 | 10 | 35 | |
| Four-plex | −3.150 | 0.999 | 107.71 | 43 | 100 | 40 | ||
| M. canis (tuf) | Singleplex | −3.222 | 0.999 | 104.35 | 28 | 100 | 35 | |
| Four-plex | −3.129 | 0.999 | 108.73 | 60 | 100 | 31 | ||
| M. cynos (tuf) | Singleplex | −3.266 | 0.999 | 102.39 | 43 | 100 | 38 | |
| Four-plex | −3.210 | 0.998 | 104.89 | 53 | 100 | 35 | ||
| CRA_4 | CIA - H3N2 (NA) | Singleplex | −3.345 | 0.999 | 99.05 | 6 | 10 | 37 |
| Four-plex | −3.324 | 0.998 | 99.91 | 8 | 10 | 34 | ||
| CIA - H1N1 (NA) | Singleplex | −3.262 | 0.998 | 102.56 | 5 | 10 | 35 | |
| Four-plex | −3.266 | 0.998 | 102.39 | 12 | 100 | 32 | ||
| CIA - H3N8 (HA) | Singleplex | −3.472 | 0.997 | 94.10 | 8 | 10 | 39 | |
| Four-plex | −3.418 | 0.997 | 96.14 | 8 | 10 | 35 | ||
| CIA (M) | Singleplex | −3.398 | 0.999 | 97.28 | 6 | 10 | 39 | |
| Four-plex | −3.379 | 0.999 | 97.67 | 8 | 10 | 38 |
| Assay | Target | Intra-Run Variability CV (%) # | Inter-Run Variability CV (%) # | ||||
|---|---|---|---|---|---|---|---|
| 105 Copies/µL | 104 Copies/µL | 103 Copies/µL | 105 Copies/µL | 104 Copies/µL | 103 Copies/µL | ||
| CRA_1 | CAdV-2 (H) | 0.55 | 2.58 | 2.00 | 1.19 | 0.83 | 1.92 |
| CPiV (NP) | 0.56 | 2.33 | 0.95 | 1.44 | 0.65 | 0.78 | |
| CDV (P) | 1.01 | 2.50 | 3.05 | 1.60 | 1.65 | 2.56 | |
| CIA (M) | 0.65 | 2.27 | 0.69 | 1.69 | 0.57 | 0.35 | |
| CRA_2 | CRCoV (N) | 1.09 | 1.19 | 2.66 | 0.88 | 1.05 | 1.72 |
| SARS-CoV-2 (N1) | 0.84 | 1.14 | 1.79 | 0.85 | 0.73 | 1.13 | |
| CHV-1 (gB) | 1.66 | 3.96 | 2.95 | 1.58 | 1.61 | 3.80 | |
| CPnV (N) | 0.66 | 0.89 | 2.49 | 1.77 | 1.57 | 1.79 | |
| CRA_3 | S. equi subsp. zooepidemicus (sodA) | 0.82 | 2.29 | 3.66 | 1.00 | 2.67 | 3.07 |
| B. bronchiseptica (flaA–fliA-B) | 0.43 | 1.86 | 2.96 | 0.57 | 1.14 | 4.83 | |
| M. canis (tuf) | 1.29 | 3.23 | 5.70 | 1.66 | 2.68 | 4.23 | |
| M. cynos (tuf) | 0.57 | 1.53 | 3.54 | 0.96 | 2.06 | 2.85 | |
| CRA_4 | CIA-H3N2 (NA) | 0.82 | 0.78 | 1.09 | 0.50 | 0.60 | 3.07 |
| CIA-H1N1 (NA) | 0.67 | 0.58 | 1.29 | 0.90 | 1.48 | 1.49 | |
| CIA-H3N8 (HA) | 1.42 | 1.80 | 3.93 | 1.20 | 1.42 | 4.19 | |
| CIA (M) | 0.28 | 0.43 | 0.86 | 1.23 | 1.45 | 2.67 | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Thieulent, C.J.; Carossino, M.; Peak, L.; Strother, K.; Wolfson, W.; Balasuriya, U.B.R. Development and Validation of a Panel of One-Step Four-Plex qPCR/RT-qPCR Assays for Simultaneous Detection of SARS-CoV-2 and Other Pathogens Associated with Canine Infectious Respiratory Disease Complex. Viruses 2023, 15, 1881. https://doi.org/10.3390/v15091881
Thieulent CJ, Carossino M, Peak L, Strother K, Wolfson W, Balasuriya UBR. Development and Validation of a Panel of One-Step Four-Plex qPCR/RT-qPCR Assays for Simultaneous Detection of SARS-CoV-2 and Other Pathogens Associated with Canine Infectious Respiratory Disease Complex. Viruses. 2023; 15(9):1881. https://doi.org/10.3390/v15091881
Chicago/Turabian StyleThieulent, Côme J., Mariano Carossino, Laura Peak, Keith Strother, Wendy Wolfson, and Udeni B. R. Balasuriya. 2023. "Development and Validation of a Panel of One-Step Four-Plex qPCR/RT-qPCR Assays for Simultaneous Detection of SARS-CoV-2 and Other Pathogens Associated with Canine Infectious Respiratory Disease Complex" Viruses 15, no. 9: 1881. https://doi.org/10.3390/v15091881
APA StyleThieulent, C. J., Carossino, M., Peak, L., Strother, K., Wolfson, W., & Balasuriya, U. B. R. (2023). Development and Validation of a Panel of One-Step Four-Plex qPCR/RT-qPCR Assays for Simultaneous Detection of SARS-CoV-2 and Other Pathogens Associated with Canine Infectious Respiratory Disease Complex. Viruses, 15(9), 1881. https://doi.org/10.3390/v15091881

