A New Heteroleptic Zn(II) Complex with Schiff Bases Sensitizes Triple-Negative Breast Cancer Cells to Doxorubicin and Paclitaxel
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemicals, Drugs, and Reagents
2.2. Synthesis of the Compounds
2.3. Physical Measurements
2.4. Crystal Structure Determination
2.5. Cell Culture
2.6. MTT Assay
2.7. Clonogenic Assay
2.8. Scratch Wound Healing Assay
2.9. Enzymatic Activity of Caspases 3 and 8
2.10. qPCR Assay
2.11. Chemosensitization Assay
2.12. Statistical Analysis
3. Results and Discussion
3.1. Synthesis and Characterization of Zn(II) Complexes
3.2. Cytotoxicity of Zn(II) Complexes to Cell Lines
3.3. Colony Formation and Migration of MDA-MB-231 Cells
3.4. Enzymatic Activity of CAS3 and CAS8
3.5. Transcriptional Modulation Mediated by Treatment with Complex 4
3.6. Complex 4 Sensitizes MDA-MB231 Cells to Treatment with Doxorubicin and Paclitaxel
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- WHO. Breast Cancer. Available online: https://www.who.int/news-room/fact-sheets/detail/breast-cancer (accessed on 30 October 2024).
- Alagoz, O.; Lowry, K.P. Impact of the COVID-19 Pandemic on Breast Cancer Mortality in the US: Estimates From Collaborative Simulation Modeling. JNCI J. Natl. Cancer Inst. 2021, 113, 1484–1494. [Google Scholar] [CrossRef] [PubMed]
- Harbeck, N.; Penault-Llorca, F.; Cortes, J.; Gnant, M.; Houssami, N.; Poortmans, P.; Ruddy, K.; Tsang, J.; Cardoso, F. Breast cancer. Nat. Rev. Dis. Primers 2019, 5, 66. [Google Scholar] [CrossRef] [PubMed]
- Bai, X.; Ni, J.; Beretov, J.; Graham, P.; Li, Y. Triple-negative breast cancer therapeutic resistance: Where is the Achilles’ heel? Cancer Lett. 2021, 497, 100–111. [Google Scholar] [CrossRef] [PubMed]
- Yin, L.; Duan, J.J.; Bian, X.W.; Yu, S.C. Triple-negative breast cancer molecular subtyping and treatment progress. Breast Cancer Res. 2020, 22, 61. [Google Scholar] [CrossRef]
- McGee, S.F. Understanding Metastasis: Current Paradigms and Therapeutic Challenges in Breast Cancer Progression; RCSI University of Medicine and Health Sciences: Dublin, Ireland, 2023. [Google Scholar]
- Qu, Z.; Liu, Q.; Kong, X.; Wang, X.; Wang, Z.; Wang, J.; Fang, Y. A Systematic Study on Zinc-Related Metabolism in Breast Cancer. Nutrients 2023, 15, 1703. [Google Scholar] [CrossRef]
- Rusch, P.; Hirner, A.V.; Schmitz, O.; Kimmig, R.; Hoffmann, O.; Diel, M. Zinc distribution within breast cancer tissue of different intrinsic subtypes. Arch. Gynecol. Obstet. 2021, 303, 195–205. [Google Scholar] [CrossRef]
- Chandler, P.; Kochupurakkal, B.S.; Alam, S.; Richardson, A.L.; Soybel, D.I.; Kelleher, S.L. Subtype-specific accumulation of intracellular zinc pools is associated with the malignant phenotype in breast cancer. Mol. Cancer 2016, 15, 2. [Google Scholar] [CrossRef]
- Geraki, K.; Farquharson, M.J.; Bradley, D.A. Concentrations of Fe, Cu and Zn in breast tissue: A synchrotron XRF study. Phys. Med. Biol. 2002, 47, 2327–2339. [Google Scholar] [CrossRef]
- Fahmy, H.M.; Mosleh, A.M.; El-Sayed, A.A.; El-Sherif, A.A. Novel palladium(II) and Zinc(II) Schiff base complexes: Synthesis, biophysical studies, and anticancer activity investigation. J. Trace Elem. Med. Biol. Organ Soc. Miner. Trace Elem. (GMS) 2023, 79, 127236. [Google Scholar] [CrossRef]
- Manikandamathavan, V.M.; Weyhermüller, T.; Parameswari, R.P.; Sathishkumar, M.; Subramanian, V.; Nair, B.U. DNA/protein interaction and cytotoxic activity of imidazole terpyridine derived Cu(II)/Zn(II) metal complexes. Dalton Trans. 2014, 43, 13018–13031. [Google Scholar] [CrossRef]
- Narwane, M.; Dorairaj, D.P.; Chang, Y.L. Tris-(2-pyridyl)-pyrazolyl Borate Zinc(II) Complexes: Synthesis, DNA/Protein Binding and In Vitro Cytotoxicity Studies. Molecules 2021, 26, 7341. [Google Scholar] [CrossRef] [PubMed]
- Mahadevi, P.; Sumathi, S. Schiff base metal complexes: Synthesis, optoelectronic, biological studies, fabrication of zinc oxide nanoparticles and its photocatalytic activity. Results Chem. 2023, 6, 101026. [Google Scholar] [CrossRef]
- Bashir, M.; Dar, A.A.; Yousuf, I. Syntheses, Structural Characterization, and Cytotoxicity Assessment of Novel Mn(II) and Zn(II) Complexes of Aroyl-Hydrazone Schiff Base Ligand. ACS Omega 2023, 8, 3026–3042. [Google Scholar] [CrossRef] [PubMed]
- Çakmak, R.; Ay, B.; Çınar, E.; Başaran, E.; Akkoç, S.; Boğa, M.; Taş, E. Synthesis, spectroscopic, thermal analysis and in vitro cytotoxicity, anticholinesterase and antioxidant activities of new Co (II), Ni (II), Cu (II), Zn (II), and Ru (III) complexes of pyrazolone-based Schiff base ligand. J. Mol. Struct. 2023, 1292, 136225. [Google Scholar] [CrossRef]
- Lopes, E.D.O.; Oliveira, C.G.d.; Silva, P.B.d.; Eismann, C.E.; Suárez, C.A.; Menegário, A.A.; Leite, C.Q.F.; Deflon, V.M.; Pavan, F.R. Novel Zinc(II) Complexes [Zn(atc-Et)2] and [Zn(atc-Ph)2]: In Vitro and in Vivo Antiproliferative Studies. Int. J. Mol. Sci. 2016, 17, 781. [Google Scholar] [CrossRef]
- Lobana, T.S.; Kumari, P.; Hundal, G.; Butcher, R.J.; Castineiras, A.; Akitsu, T. Metal derivatives of N1-substituted thiosemicarbazones: Synthesis, structures and spectroscopy of nickel (II) and cobalt (III) complexes. Inorg. Chim. Acta 2013, 394, 605–615. [Google Scholar] [CrossRef]
- Pavan, F.R.; Maia, P.I.d.S.; Leite, S.R.; Deflon, V.M.; Batista, A.A.; Sato, D.N.; Franzblau, S.G.; Leite, C.Q. Thiosemicarbazones, semicarbazones, dithiocarbazates and hydrazide/hydrazones: Anti–Mycobacterium tuberculosis activity and cytotoxicity. Eur. J. Med. Chem. 2010, 45, 1898–1905. [Google Scholar] [CrossRef]
- Kovala-Demertzi, D.; Yadav, P.N.; Wiecek, J.; Skoulika, S.; Varadinova, T.; Demertzis, M.A. Zinc (II) complexes derived from pyridine-2-carbaldehyde thiosemicarbazone and (1E)-1-pyridin-2-ylethan-1-one thiosemicarbazone. Synthesis, crystal structures and antiproliferative activity of zinc (II) complexes. J. Inorg. Biochem. 2006, 100, 1558–1567. [Google Scholar] [CrossRef]
- Bermejo, E.; Carballo, R.; Castiñeiras, A.; Domĺnguez, R.; Maichle-Mössmer, C.; Strähle, J.; West, D.X. Synthesis, characterization and antifungal activity of group 12 metal complexes of 2-acetylpyridine-4N-ethylthiosemicarbazone (H4EL) and 2-acetylpyridine-N-oxide-4N-ethylthiosemicarbazone (H4ELO). Polyhedron 1999, 18, 3695–3702. [Google Scholar] [CrossRef]
- Kasuga, N.C.; Sekino, K.; Ishikawa, M.; Honda, A.; Yokoyama, M.; Nakano, S.; Shimada, N.; Koumo, C.; Nomiya, K. Synthesis, structural characterization and antimicrobial activities of 12 zinc (II) complexes with four thiosemicarbazone and two semicarbazone ligands. J. Inorg. Biochem. 2003, 96, 298–310. [Google Scholar] [CrossRef]
- SADABS-2016/2; Bruker: Madison, WI, USA, 2001.
- Sheldrick, G.M. A short history of SHELX. Acta Crystallogr. Sect. A Found. Crystallogr. 2008, 64, 112–122. [Google Scholar] [CrossRef] [PubMed]
- Sheldrick, G.M. SHELXT–Integrated space-group and crystal-structure determination. Acta Crystallogr. Sect. A Found. Adv. 2015, 71, 3–8. [Google Scholar] [CrossRef] [PubMed]
- Sheldrick, G.M. Crystal structure refinement with SHELXL. Acta Crystallogr. Sect. C Struct. Chem. 2015, 71, 3–8. [Google Scholar] [CrossRef] [PubMed]
- Dolomanov, O.V.; Bourhis, L.J.; Gildea, R.J.; Howard, J.A.; Puschmann, H. OLEX2: A complete structure solution, refinement and analysis program. J. Appl. Crystallogr. 2009, 42, 339–341. [Google Scholar] [CrossRef]
- Farrugia, L.J. WinGX and ORTEP for Windows: An update. J. Appl. Crystallogr. 2012, 45, 849–854. [Google Scholar] [CrossRef]
- Macrae, C.F.; Edgington, P.R.; McCabe, P.; Pidcock, E.; Shields, G.P.; Taylor, R.; Towler, M.; Streek, J. Mercury: Visualization and analysis of crystal structures. J. Appl. Crystallogr. 2006, 39, 453–457. [Google Scholar] [CrossRef]
- Huang, Z.; Yu, P.; Tang, J. Characterization of triple-negative breast cancer MDA-MB-231 cell spheroid model. OncoTargets Ther. 2020, 13, 5395–5405. [Google Scholar] [CrossRef]
- Araujo, T.G.; Marangoni, K.; Rocha, R.M.; Maia, Y.C.; Araujo, G.R.; Alcântar, T.M.; Alves, P.T.; Calábria, L.; Neves, A.F.; Soares, F.A. Dynamic dialog between cytokeratin 18 and annexin A1 in breast cancer: A transcriptional disequilibrium. Acta Histochem. 2014, 116, 1178–1184. [Google Scholar] [CrossRef]
- Ferreira, H.S.V.; Ramos, L.M.S.; Silva, F.C.; Alves, D.L.; de Menezes Pereira, G.; de Oliveira Santiago, P.H.; de Almeida, A.M.; Ellena, J.; Corbi, P.P.; Oliveira, C.G. A new copper (II) complex containing long-chain aliphatic hydrazide and 1, 10-phenanthroline upregulates ADP hydrolysis in triple-negative breast cancer cells. J. Inorg. Biochem. 2024, 255, 112524. [Google Scholar] [CrossRef]
- Badisa, R.B.; Darling-Reed, S.F.; Joseph, P.; Cooperwood, J.S.; Latinwo, L.M.; Goodman, C.B. Selective cytotoxic activities of two novel synthetic drugs on human breast carcinoma MCF-7 cells. Anticancer Res. 2009, 29, 2993–2996. [Google Scholar]
- Souza, R.A.C.; Cunha, V.L.; de Faria Franca, E.; Deflon, V.M.; Maia, P.I.; Oliveira, C.G. Synthesis, Structural Characterization, X-ray, Hirshfeld Surfaces, DFT calculations, In Silico ADME Approach and a Molecular Docking Study of a New Nickel (II) Complex. ChemistrySelect 2022, 7, e202202409. [Google Scholar] [CrossRef]
- Souza, R.A.; Cunha, V.L.; de Souza, J.H.; Martins, C.H.; Franca, E.d.F.; Pivatto, M.; Ellena, J.A.; Faustino, L.A.; Patrocinio, A.O.d.T.; Deflon, V.M. Zinc (II) complexes bearing N, N, S ligands: Synthesis, crystal structure, spectroscopic analysis, molecular docking and biological investigations about its antifungal activity. J. Inorg. Biochem. 2022, 237, 111995. [Google Scholar] [CrossRef] [PubMed]
- Porchia, M.; Pellei, M.; Del Bello, F.; Santini, C. Zinc complexes with nitrogen donor ligands as anticancer agents. Molecules 2020, 25, 5814. [Google Scholar] [CrossRef] [PubMed]
- Balakrishnan, N.; Haribabu, J.; Dhanabalan, A.K.; Swaminathan, S.; Sun, S.; Dibwe, D.F.; Bhuvanesh, N.; Awale, S.; Karvembu, R. Thiosemicarbazone (s)-anchored water soluble mono-and bimetallic Cu (II) complexes: Enzyme-like activities, biomolecular interactions, anticancer property and real-time live cytotoxicity. Dalton Trans. 2020, 49, 9411–9424. [Google Scholar] [CrossRef]
- Gong, Y.; Fan, Z.; Luo, G.; Yang, C.; Huang, Q.; Fan, K.; Cheng, H.; Jin, K.; Ni, Q.; Yu, X. The role of necroptosis in cancer biology and therapy. Mol. Cancer 2019, 18, 100. [Google Scholar] [CrossRef]
- Vecchi, L.; Mota, S.T.S.; Zóia, M.A.P.; Martins, I.C.; de Souza, J.B.; Santos, T.G.; Beserra, A.d.O.; de Andrade, V.P.; Goulart, L.R.; Araújo, T.G. Interleukin-6 signaling in triple negative breast cancer cells elicits the annexin A1/formyl peptide receptor 1 axis and affects the tumor microenvironment. Cells 2022, 11, 1705. [Google Scholar] [CrossRef]
- Abd-Ellatef, G.E.F.; Gazzano, E.; El-Desoky, A.H.; Hamed, A.R.; Kopecka, J.; Belisario, D.C.; Costamagna, C.; Marie, M.A.S.; Fahmy, S.R.; Abdel-Hamid, A.-H.Z. Glabratephrin reverses doxorubicin resistance in triple negative breast cancer by inhibiting P-glycoprotein. Pharmacol. Res. 2022, 175, 105975. [Google Scholar] [CrossRef]
- Rudolf, K.; Rudolf, E. Increased Intracellular Free Zinc Has Pleiotropic Effects on Doxorubicin-Induced Cytotoxicity in hiPCS-CMs Cells. Int. J. Mol. Sci. 2023, 24, 4518. [Google Scholar] [CrossRef]
- Xue, Y.N.; Yu, B.B.; Liu, Y.N.; Guo, R.; Li, J.L.; Zhang, L.C.; Su, J.; Sun, L.K.; Li, Y. Zinc promotes prostate cancer cell chemosensitivity to paclitaxel by inhibiting epithelial-mesenchymal transition and inducing apoptosis. Prostate 2019, 79, 647–656. [Google Scholar] [CrossRef]
Gene | Sequence (Forward–Reverse) 5′–3′ | Amplicon (pb) |
---|---|---|
CDH1 | F:CTGGCGTCTGTAGGAAGGC R:GCTGGCTCAAGTCAAAGTCCTG | 240 |
VIM | F:GAGACGCATTGTCAACATCCTG R:CAAGAACACCCGCACCAAC | 356 |
CK18 | F:GCTCTGGGTTGACCGTGG R:GTGGTGCTCTCCTCAATCTGC | 151 |
ANXA1 | F:GATTCAGATGCCAGGGCCT R:CACTCTGCGAAGTTGTGGAT | 111 |
IL6 | F:GATTCCAAAGATGTAGCCGCC R:ATTTTCACCAGGCAAGTCTCCTC | |
TGFβ1 | F:GTACCTGAACCCGTGTTGCTC R:CAGGAATTGTTGCTGTATTTCTGG | 107 |
IL1β | F:ACAGGATATGGAGCAACAAGTGG R:GGGCTTATCATCTTTCAACACGC | 136 |
β2M | F:CCTGCCGTGTGAAC-CATGT R:CGGCATCTTCAAACCTCC | 94 |
IC50 (μM) | |||
---|---|---|---|
MCF7 | MDA-MB-453 | MDA-MB-231 | |
Complex 1 | 9.43 | 0.32 | 0.24 |
Complex 2 | 18.49 | <0.01 | 0.92 |
Complex 3 | 19.34 | <0.01 | 0.16 |
Complex 4 | 10.41 | 12.82 | 16.3 |
Hatc-Et | NA | <0.01 | 0.27 |
Hatc-Ch | NA | NA | 6.25 |
Hhz | NA | 4.11 | 30.3 |
Hsc | NA | NA | NA |
ZnCl2 | NA | <0.01 | NA |
IC50 (μM) | SI (Non-Tumor/MDA-MB231) | |||||
---|---|---|---|---|---|---|
MCF10A | HUVEC | HFF | MCF10A | HUVEC | HFF | |
Complex 1 | <0.01 | 2.52 | 4.57 | NS | 10.50 | 19.04 |
Complex 2 | <0.01 | 20.38 | 9.49 | NS | 22.15 | 10.31 |
Complex 3 | <0.01 | 10.09 | 4.22 | NS | 63.06 | 26.37 |
Complex 4 | 12.54 | NA | 131.25 | 0.77 | HS | 8.05 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Machado, R.A.d.S.; Siqueira, R.P.; da Silva, F.C.; Matos, A.C.P.d.; Borges, D.S.; Rocha, G.G.; Souza, T.C.P.d.; Souza, R.A.C.; Oliveira, C.R.d.; Ferreira, A.G.; et al. A New Heteroleptic Zn(II) Complex with Schiff Bases Sensitizes Triple-Negative Breast Cancer Cells to Doxorubicin and Paclitaxel. Pharmaceutics 2024, 16, 1610. https://doi.org/10.3390/pharmaceutics16121610
Machado RAdS, Siqueira RP, da Silva FC, Matos ACPd, Borges DS, Rocha GG, Souza TCPd, Souza RAC, Oliveira CRd, Ferreira AG, et al. A New Heteroleptic Zn(II) Complex with Schiff Bases Sensitizes Triple-Negative Breast Cancer Cells to Doxorubicin and Paclitaxel. Pharmaceutics. 2024; 16(12):1610. https://doi.org/10.3390/pharmaceutics16121610
Chicago/Turabian StyleMachado, Raiane Aparecida dos Santos, Raoni Pais Siqueira, Fernanda Cardoso da Silva, André Carlos Pereira de Matos, Dayanne Silva Borges, Gislaine Gonçalves Rocha, Thais Cristina Prado de Souza, Rafael Aparecido Carvalho Souza, Clayton Rodrigues de Oliveira, Antônio G. Ferreira, and et al. 2024. "A New Heteroleptic Zn(II) Complex with Schiff Bases Sensitizes Triple-Negative Breast Cancer Cells to Doxorubicin and Paclitaxel" Pharmaceutics 16, no. 12: 1610. https://doi.org/10.3390/pharmaceutics16121610
APA StyleMachado, R. A. d. S., Siqueira, R. P., da Silva, F. C., Matos, A. C. P. d., Borges, D. S., Rocha, G. G., Souza, T. C. P. d., Souza, R. A. C., Oliveira, C. R. d., Ferreira, A. G., Maia, P. I. d. S., Deflon, V. M., Oliveira, C. G., & Araújo, T. G. (2024). A New Heteroleptic Zn(II) Complex with Schiff Bases Sensitizes Triple-Negative Breast Cancer Cells to Doxorubicin and Paclitaxel. Pharmaceutics, 16(12), 1610. https://doi.org/10.3390/pharmaceutics16121610