Monobac System–A Single Baculovirus for the Production of rAAV
Abstract
:1. Introduction
2. Materials and Methods
2.1. Recombination of rep2-cap8 and cap8 Expression Cassettes at Bacmid egt Locus of AcMNPV Bacmid
2.2. Insertion of AAV rep2-cap8 Genes and Recombinant AAV Genomes into Bacmid by Transposition at Tn7 Site
2.3. Insertion of GFP and YFP into Bacmid by Transposition at Tn7 Site
2.4. Cell Line, Baculovirus, and rAAV Production
2.5. rAAV Purification and Characterization
2.6. Determination of rAAV Genome Titer
2.7. SDS-PAGE and Western Blot
2.8. Analytical Ultra Centrifugation
2.9. In Vivo Injection, Sample Collection, and Gamma Sarcoglycan Protein Detection
3. Results
3.1. Production of rAAV Using Dual Baculovirus System Encoding Fluorescent Protein Genes
3.2. Kinetic rAAV Genome Replication in Comparison to the Baculovirus Replication
3.3. Generation of the Monobac and Production of rAAV Vectors
3.4. In Vivo Performance of rAAV8 Vectors Produced Using the Monobac
4. Discussion
5. Patents
Author Contributions
Funding
Institutional Review Board Statement
Acknowledgments
Conflicts of Interest
References
- Casto, B.C.; Atchison, R.W.; Hammon, W.M.D. Studies on the relationship between adeno-associated virus type I (AAV-1) and adenoviruses. I. Replication of AAV-1 in certain cell cultures and its effect on helper adenovirus. Virology 1967, 32, 52–59. [Google Scholar] [CrossRef]
- Alazard-Dany, N.; Nicolas, A.; Ploquin, A.; Strasser, R.; Greco, A.; Epstein, A.L.; Fraefel, C.; Salvetti, A. Definition of herpes simplex virus type 1 helper activities for adeno-associated virus early replication events. PLoS Pathog. 2009, 5, e1000340. [Google Scholar] [CrossRef] [Green Version]
- Schlehofer, J.R.; Ehrbar, M.; Hausen, H. zur Vaccinia virus, herpes simplex virus, and carcinogens induce DNA amplification in a human cell line and support replication of a helpervirus dependent parvovirus. Virology 1986, 152, 110–117. [Google Scholar] [CrossRef]
- Wang, Z.; Deng, X.; Zou, W.; Engelhardt, J.F.; Yan, Z.; Qiu, J. Human Bocavirus 1 Is a Novel Helper for Adeno-associated Virus Replication. J. Virol. 2017, 91, e00710-17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tan, Y.Z.; Aiyer, S.; Mietzsch, M.; Hull, J.A.; McKenna, R.; Grieger, J.; Samulski, R.J.; Baker, T.S.; Agbandje-McKenna, M.; Lyumkis, D. Sub-2 Å Ewald curvature corrected structure of an AAV2 capsid variant. Nat. Commun. 2018, 9, 3628. [Google Scholar] [CrossRef]
- Ward, P.; Berns, K.I. Minimum Origin Requirements for Linear Duplex AAV DNA Replication in Vitro. Virology 1995, 209, 692–695. [Google Scholar] [CrossRef]
- Hong, G.; Ward, P.; Berns, K.I. In vitro replication of adeno-associated virus DNA. Proc. Natl. Acad. Sci. USA 2006, 89, 4673–4677. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- King, J.A.; Dubielzig, R.; Grimm, D.; Kleinschmidt, J.A. DNA helicase-mediated packaging of adeno-associated virus type 2 genomes into preformed capsids. EMBO J. 2001, 20, 3282–3291. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Samulski, R.J.; Zhu, X.; Xiao, X.; Brook, J.D.; Housman, D.E.; Epstein, N.; Hunter, L.A. Targeted integration of adeno-associated virus (AAV) into human chromosome 19. EMBO J. 1991, 10, 3941–3950. [Google Scholar] [CrossRef]
- Duan, D.; Sharma, P.; Yang, J.; Yue, Y.; Dudus, L.; Zhang, Y.; Fisher, K.J.; Engelhardt, J.F. Circular intermediates of recombinant adeno-associated virus have defined structural characteristics responsible for long-term episomal persistence in muscle tissue. J. Virol. 1998, 72, 8568–8577. [Google Scholar] [CrossRef]
- Ogden, P.J.; Kelsic, E.D.; Sinai, S.; Church, G.M. Comprehensive AAV capsid fitness landscape reveals a viral gene and enables machine-guided design. Science 2019, 366, 1139–1143. [Google Scholar] [CrossRef]
- Sonntag, F.; Schmidt, K.; Kleinschmidt, J.A. A viral assembly factor promotes AAV2 capsid formation in the nucleolus. Proc. Natl. Acad. Sci. USA 2010, 107, 10220–10225. [Google Scholar] [CrossRef] [Green Version]
- Bainbridge, J.W.B.; Mehat, M.S.; Sundaram, V.; Robbie, S.J.; Barker, S.E.; Ripamonti, C.; Georgiadis, A.; Mowat, F.M.; Beattie, S.G.; Gardner, P.J.; et al. Long-Term Effect of Gene Therapy on Leber’s Congenital Amaurosis. N. Engl. J. Med. 2015, 372, 1887–1897. [Google Scholar] [CrossRef] [Green Version]
- Weleber, R.G.; Pennesi, M.E.; Wilson, D.J.; Kaushal, S.; Erker, L.R.; Jensen, L.; McBride, M.T.; Flotte, T.R.; Humphries, M.; Calcedo, R.; et al. Results at 2 Years after Gene Therapy for RPE65-Deficient Leber Congenital Amaurosis and Severe Early-Childhood-Onset Retinal Dystrophy. Ophthalmology 2016, 123, 1606–1620. [Google Scholar] [CrossRef] [Green Version]
- Nathwani, A.C.; Reiss, U.M.; Tuddenham, E.G.D.; Rosales, C.; Chowdary, P.; Mcintosh, J.; Della Peruta, M.; Lheriteau, E.; Patel, N.; Raj, D.; et al. Long-Term Safety and Efficacy of Factor IX Gene Therapy in Hemophilia B. N. Engl. J Med 2014, 21371, 1994–2004. [Google Scholar] [CrossRef] [Green Version]
- Knop, D.R.; Harrell, H. Bioreactor production of recombinant herpes simplex virus vectors. Biotechnol. Prog. 2007, 23, 715–721. [Google Scholar] [CrossRef]
- Urabe, M.; Ding, C.; Kotin, R.M. Insect cells as a factory to produce adeno-associated virus type 2 vectors. Hum. Gene Ther. 2002, 13, 1935–1943. [Google Scholar] [CrossRef] [PubMed]
- Savy, A.; Kaikkonen, M.U.; Léger, A.; Dickx, Y.; Galibert, L.; Merten, O. Genetics instability of wtAAV2 genome and AAV promoter activities in the Baculovirus/Sf9 cells system. PLoS ONE 2018, 13, e0199866. [Google Scholar] [CrossRef]
- Kozak, M. Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell 1986, 44, 283–292. [Google Scholar] [CrossRef]
- Smith, R.H.; Levy, J.R.; Kotin, R.M. A simplified baculovirus-AAV expression vector system coupled with one-step affinity purification yields high-titer rAAV stocks from insect cells. Mol. Ther. 2009, 17, 1888–1896. [Google Scholar] [CrossRef] [PubMed]
- Chen, H. Intron splicing-mediated expression of AAV Rep and Cap genes and production of AAV vectors in insect cells. Mol. Ther. 2008, 16, 924–930. [Google Scholar] [CrossRef] [Green Version]
- Mietzsch, M.; Grasse, S.; Zurawski, C.; Weger, S.; Bennett, A.; Agbandje-McKenna, M.; Muzyczka, N.; Zolotukhin, S.; Heilbronn, R. OneBac: Platform for Scalable and High-Titer Production of Adeno-Associated Virus Serotype 1–12 Vectors for Gene Therapy. Hum. Gene Ther. 2014, 25, 212–222. [Google Scholar] [CrossRef] [Green Version]
- Mietzsch, M.; Casteleyn, V.; Weger, S.; Zolotukhin, S.; Heilbronn, R. OneBac 2.0:Sf9cell lines for production of AAV5 vectors with enhanced infectivity and minimal encapsidation of foreign DNA. Hum Gene Ther. 2015, 26, 688–697. [Google Scholar] [CrossRef] [Green Version]
- Suzuki, N.; Nonaka, H.; Tsuge, Y.; Inui, M.; Yukawa, H. New multiple-deletion method for the Corynebacterium glutamicum genome, using a mutant lox sequence. Microbiology 2005, 71, 8472–8480. [Google Scholar] [CrossRef] [Green Version]
- Marek, M.; Van Oers, M.M.; Devaraj, F.F.; Vlak, J.M.; Merten, O.W. Engineering of baculovirus vectors for the manufacture of virion-free biopharmaceuticals. Biotechnol. Bioeng. 2011, 108, 1056–1067. [Google Scholar] [CrossRef]
- Luckow, V.A.; Lee, S.C.; Barry, G.F.; Olins, P.O. Efficient generation of infectious recombinant baculoviruses by site-specific transposon-mediated insertion of foreign genes into a baculovirus genome propagated in Escherichia coli. J. Virol. 1993, 67, 4566–4579. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Noad, R.J.; Stewart, M.; Boyce, M.; Celma, C.C.; Willison, K.R.; Roy, P. Multigene expression of protein complexes by iterative modification of genomic Bacmid DNA. BMC Mol. Biol 2009, 10, 87. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Datsenko, K.A.; Wanner, B.L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 2000, 97, 6640–6645. [Google Scholar] [CrossRef] [Green Version]
- Herson, S.; Hentati, F.; Rigolet, A.; Behin, A.; Romero, N.B.; Leturcq, F.; Laforêt, P.; Maisonobe, T.; Amouri, R.; Haddad, H.; et al. A phase i trial of adeno-associated virus serotype 1-γ-sarcoglycan gene therapy for limb girdle muscular dystrophy type 2C. Brain 2012, 135, 483–492. [Google Scholar] [CrossRef] [Green Version]
- Schmutz, S.; Valente, M.; Cumano, A.; Novault, S. Spectral cytometry has unique properties allowing multicolor analysis of cell suspensions isolated from solid tissues. PLoS ONE 2016, 11, 1–15. [Google Scholar] [CrossRef] [Green Version]
- Pijlman, G.P.; van Schinjndel, J.E.; Vlak, J.M. Spontaneous excision of BAC vector sequences from bacmid-derived baculovirus expression vectors upon passage in insect cells. J. Gen. Virol. 2003, 84, 2669–2678. [Google Scholar] [CrossRef] [PubMed]
- Inagaki, K.; Fuess, S.; Storm, T.A.; Gibson, G.A.; Mctiernan, C.F.; Kay, M.A.; Nakai, H. Robust systemic transduction with AAV9 vectors in mice: Efficient global cardiac gene transfer superior to that of AAV8. Mol. Ther. 2006, 14, 45–53. [Google Scholar] [CrossRef] [PubMed]
- O’Reilly, D.R.; Miller, L.K. Regulation of expression of a baculovirus ecdysteroid UDPglucosyltransferase gene. J. Virol. 1990, 64, 1321–1328. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ros, V.I.D.; Van Houte, S.; Hemerik, L.; Van Oers, M.M. Baculovirus-induced tree-top disease: How extended is the role of egt as a gene for the extended phenotype? Mol. Ecol. 2015, 24, 249–258. [Google Scholar] [CrossRef]
- Galibert, L.; Savy, A.; Dickx, Y.; Bonnin, D.; Bertin, B.; Mushimiyimana, I.; van Oers, M.M.; Merten, O.W. Origins of truncated supplementary capsid proteins in rAAV8 vectors produced with the baculovirus system. PLoS ONE 2018, 13, e020741. [Google Scholar] [CrossRef]
- Wang, X.S.; Ponnazhagan, S.; Srivastava, A. Rescue and replication signals of the adeno-associated virus 2 genome. J. Mol. Biol. 1995, 250, 573–580. [Google Scholar] [CrossRef]
- Chen, Y.-R.; Zhong, S.; Fei, Z.; Hashimoto, Y.; Xiang, J.Z.; Zhang, S.; Blissard, G.W. The transcriptome of the baculovirus Autographa californica multiple nucleopolyhedrovirus in Trichoplusia ni cells. J. Virol. 2013, 87, 6391–6405. [Google Scholar] [CrossRef] [Green Version]
- Pijlman, G.P.; Dortmans, J.C.F.M.; Vermeesch, A.M.G.; Yang, K.; Martens, D.E.; Goldbach, R.W.; Vlak, J.M. Pivotal role of the non-hr origin of DNA replication in the genesis of defective interfering baculoviruses. J. Virol. 2002, 76, 5605–5611. [Google Scholar] [CrossRef] [Green Version]
- Pijlman, G.P.; Vermeesch, A.M.G.; Vlak, J.M. Cell line-specific accumulation of the baculovirus non-hr origin of DNA replication in infected insect cells. J. Invertebr. Pathol. 2003, 84, 214–219. [Google Scholar] [CrossRef]
- Krell, P.J. Passage effect of virus infection in insect cells. Cytotechnology 1996, 20, 125–137. [Google Scholar] [CrossRef]
- Aslanidi, G.; Lamb, K.; Zolotukhin, S. An inducible system for highly efficient production of recombinant adeno-associated virus (rAAV) vectors in insect Sf9 cells. Proc. Natl. Acad. Sci. USA 2009, 106, 5059–5064. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, Y.; Jiang, L.; Geng, H.; Yang, T.; Han, Z.; He, X.; Lin, K.; Xu, F. A Recombinant Baculovirus Efficiently Generates Recombinant Adeno-Associated Virus Vectors in Cultured Insect Cells and Larvae. Mol. Ther. Methods Clin. Dev. 2018, 10, 38–47. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Savy, A.; Dickx, Y.; Nauwynck, L.; Bonnin, D.; Merten, O.-W.; Galibert, L. Impact of ITR integrity on rAAV8 production using baculovirus/Sf9 cells system. Hum. Gene Ther. Methods 2017. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Penaud-Budloo, M.; Lecomte, E.; Guy-Duché, A.; Saleun, S.; Roulet, A.; Lopez-Roques, C.; Tournaire, B.; Cogné, B.; Léger, A.; Blouin, V.; et al. Accurate Identification and Quantification of DNA Species by Next-Generation Sequencing in Adeno-Associated Viral Vectors Produced in Insect Cells. Hum. Gene Ther. Methods 2017, 28, 148–162. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hasnain, S.E.; Jain, A.; Habib, S.; Ghosh, S.; Chatterji, U.; Ramachandran, A.; Das, P.; Venkaiah, B.; Pandey, S.; Liang, B.; et al. Involvement of host factors in transcription from baculovirus very late promoters—A review. Gene 1997, 190, 113–118. [Google Scholar] [CrossRef]








| Primer | Sequence 5′ to 3′ | Purpose | 
|---|---|---|
| EGT-lox-F | TTACGGTCGTCAAGCCCAAACTGTTTGCGTATTCAACTAAAACTTATTGCGGTAATATCACTACCGTTCGTATAGCATACATTATACGAAGTTATAATAGGAACTTCATTTAAATGGCGC | PCR product for rep2-cap8 and cap8 cloning at egt | 
| EGT-SV40-R | TCCCGGCTTCCAAGGCCTCGTCGCTCGATTGTAGTCCGCCTTGCGTAATAAACGCCGCCATTTTTTTATGACGCAGCACGG CAGACATGATAAGATACATTGATGAGTTTG | PCR product for rep2-cap8 cloning at egt | 
| EGT-p10-R | TTACGGTCGTCAAGCCCAAACTGTTTGCGTATTCAACTAAAACTTATTGCGGTAATATCACTACCGTTCGATATAGCATACATTATACGAAGTTATAATAGGAACTTCATTTAAATGGCGC | PCR product for cap8 cloning at egt | 
| EGT-F | ATGACTATTCTCTGCTGGC | KI verification | 
| EGT-R | ATTGGCCGTGTTTCCTAC | KI verification | 
| M13 PUC F | CCAGTCACGACGTTGTAAAACG | Verification of transposed bacmids | 
| M13 PUC R | AGCGGATAACAATTTCACACAGG | Verification of transposed bacmids | 
| Genta | AGCCACCTACTCCCAACATC | Verification of transposed bacmids | 
| ITR-F | CTCCACTAGGGGTTCCTTG | QPCR rAAV ITR | 
| ITR-R | GTAGATAAGTAGCATGGC | QPCR rAAV ITR | 
| ITR-P | [FAM] TAGTTAATGATTAACCC [MGB-NFQ] | QPCR rAAV ITR | 
| BAC-F | ATTAGCGTGGCGTGCTTTTAC | QPCR DNApol AcMNPV | 
| BAC-R | GGGTCAGGCTCCTCTTTGC | QPCR DNApol AcMNPV | 
| BAC-P | [VIC] CAAACACGCGCATTAACGAGAGCACC [TAMRA] | QPCR DNApol AcMNPV | 
| Rep52-F | GCCGAGGACTTGCATTTCTG | QPCR rep2 | 
| Rep52-R | TCGGCCAAAGCCATTCTC | QPCR rep2 | 
| Rep52-P | [VIC] TCCACGCGCACCTTGCTTCCTC [TAMRA] | QPCR rep2 | 
| Cap8-F | TTCTGCAGCTCCCATTCAATT | QPCR cap8 | 
| Cap8-R | TCAACCAGTCAAAGCTGAACTCTT | QPCR cap8 | 
| Cap8-P | [VIC] CCACGCTGACCTGTCCGGTGC [TAMRA] | QPCR cap8 | 
| Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. | 
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Galibert, L.; Jacob, A.; Savy, A.; Dickx, Y.; Bonnin, D.; Lecomte, C.; Rivollet, L.; Sanatine, P.; Boutin Fontaine, M.; Le Bec, C.; et al. Monobac System–A Single Baculovirus for the Production of rAAV. Microorganisms 2021, 9, 1799. https://doi.org/10.3390/microorganisms9091799
Galibert L, Jacob A, Savy A, Dickx Y, Bonnin D, Lecomte C, Rivollet L, Sanatine P, Boutin Fontaine M, Le Bec C, et al. Monobac System–A Single Baculovirus for the Production of rAAV. Microorganisms. 2021; 9(9):1799. https://doi.org/10.3390/microorganisms9091799
Chicago/Turabian StyleGalibert, Lionel, Aurélien Jacob, Adrien Savy, Yohann Dickx, Delphine Bonnin, Christophe Lecomte, Lise Rivollet, Peggy Sanatine, Marjorie Boutin Fontaine, Christine Le Bec, and et al. 2021. "Monobac System–A Single Baculovirus for the Production of rAAV" Microorganisms 9, no. 9: 1799. https://doi.org/10.3390/microorganisms9091799
APA StyleGalibert, L., Jacob, A., Savy, A., Dickx, Y., Bonnin, D., Lecomte, C., Rivollet, L., Sanatine, P., Boutin Fontaine, M., Le Bec, C., & Merten, O.-W. (2021). Monobac System–A Single Baculovirus for the Production of rAAV. Microorganisms, 9(9), 1799. https://doi.org/10.3390/microorganisms9091799
 
         
                                                

 
       