Study on the Effects and Mechanism of Corilagin on A2780 Cell Apoptosis
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials and Reagents
2.2. Cell Culture
2.3. Cell Proliferation Assay
2.4. Cell Cycle Assay
2.5. Apoptosis Detection
2.6. Assessment of the Mitochondrial Membrane Potential
2.7. Intracellular Calcium Ion Concentration Assay
2.8. Transcriptomic Data Analysis
2.9. Real-Time Fluorescent Quantitative PCR
2.10. Western Blot Analysis
2.11. Statistical Analysis
3. Results
3.1. Effect of Corilagin on the Viability of Ovarian Cancer A2780 Cells
3.2. Effect of Corilagin on the A2780 Cell Cycle in Ovarian Cancer
3.3. Effect of Corilagin on Apoptosis of Ovarian Cancer A2780 Cells
3.4. Effect of Corilagin on the Membrane Potential of Mitochondria in Ovarian Cancer A2780 Cells
3.5. Effect of Corilagin on Intracellular Calcium Ion Concentration in Ovarian Cancer A2780 Cells
3.6. Effect of Corilagin on A2780 Cell Transcriptome Gene Sequencing
3.7. Effect of Corilagin on Gene Expression in Ovarian Cancer A2780 Cells
3.8. Effect of Corilagin on Protein Expression in Ovarian Cancer A2780 Cells
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Gogineni, V.; Morand, S.; Staats, H.; Royfman, R.; Devanaboyina, M.; Einloth, K.; Dever, D.; Stanbery, L.; Aaron, P.; Manning, L.; et al. Current Ovarian Cancer Maintenance Strategies and Promising New Developments. J. Cancer 2021, 12, 38–53. [Google Scholar] [CrossRef] [PubMed]
- Moufarrij, S.; Dandapani, M.; Arthofer, E.; Gomez, S.; Srivastava, A.; Lopez-Acevedo, M.; Villagra, A.; Chiappinelli, K.B. Epigenetic therapy for ovarian cancer: Promise and progress. Clin. Epigenet. 2019, 11, 7. [Google Scholar] [CrossRef]
- Stewart, C.; Ralyea, C.; Lockwood, S. Ovarian Cancer: An Integrated Review. Semin. Oncol. Nurs. 2019, 35, 151–156. [Google Scholar] [CrossRef]
- Zhang, Z.; Sun, Z.; Ye, Y.; Wang, X. Determination of Main Compositions in Phyllanthus urinaria and its Effects on Cyp450 in Rats. Curr. Pharm. Anal. 2020, 16, 520–528. [Google Scholar] [CrossRef]
- Li, N.; Lin, Z.; Chen, W.; Zheng, Y.; Ming, Y.; Zheng, Z.; Huang, W.; Chen, L.; Xiao, J.; Lin, H. Corilagin from longan seed: Identification, quantification, and synergistic cytotoxicity on SKOv3ip and hey cells with ginsenoside Rh2 and 5-fluorouracil. Food Chem. Toxicol. 2018, 119, 133–140. [Google Scholar] [CrossRef]
- Song, Z.; Chen, T.; Wang, S.; Shen, C.; Li, H.; Li, A.; Li, P.; Ma, Y.; Chen, Z.; Li, Y. Large-scale preparation of two minor polar polyphenols from Phyllanthus emblica Linn. by macroporous resin column chromatography and high-temperature preparative high-speed counter-current chromatography. J. Sep. Sci. 2022, 45, 3923–3929. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Li, X.; Yang, X.; Lei, Y.; He, M.; Xiang, X.; Wu, Q.; Liu, H.; Wang, J.; Wang, Q. Corilagin enhances the anti-tumor activity of 5-FU by downregulating the expression of GRP 78. Sci. Rep. 2023, 13, 22661. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Li, B.; Liu, G.; Han, Q.; Diao, Y.; Liu, J. Corilagin attenuates intestinal ischemia/reperfusion injury in mice by inhibiting ferritinophagy-mediated ferroptosis through disrupting NCOA4-ferritin interaction. Life Sci. 2023, 334, 122176. [Google Scholar] [CrossRef] [PubMed]
- Liu, F.-C.; Liao, C.-C.; Lee, H.-C.; Chou, A.-H.; Yu, H.-P. Effects of Corilagin on Lipopolysaccharide-Induced Acute Lung Injury via Regulation of NADPH Oxidase 2 and ERK/NF-κB Signaling Pathways in a Mouse Model. Biology 2022, 11, 1058. [Google Scholar] [CrossRef] [PubMed]
- Wu, M.; Jiang, Y.; Wang, J.; Luo, T.; Yi, Y.; Wang, H.; Wang, L. The Effect and Mechanism of Corilagin from Euryale Ferox Salisb Shell on LPS-Induced Inflammation in Raw264.7 Cells. Foods 2023, 12, 979. [Google Scholar] [CrossRef] [PubMed]
- Jia, L.; Jin, H.; Zhou, J.; Chen, L.; Lu, Y.; Ming, Y.; Yu, Y.J.B.C. A potential anti-tumor herbal medicine, Corilagin, inhibits ovarian cancer cell growth through blocking the TGF-β signaling pathways. BMC Complement. Altern. Med. 2013, 13, 33. [Google Scholar] [CrossRef]
- Jia, L.; Zhou, J.; Zhao, H.; Jin, H.; Lv, M.; Zhao, N.; Zheng, Z.; Lu, Y.; Ming, Y.; Yu, Y. Corilagin sensitizes epithelial ovarian cancer to chemotherapy by inhibiting Snail-glycolysis pathways. Oncol. Rep. 2017, 38, 2464–2470. [Google Scholar] [CrossRef]
- Attar, R.; Cincin, Z.B.; Bireller, E.S.; Cakmakoglu, B. Apoptotic and genomic effects of corilagin on SKOV3 ovarian cancer cell line. OncoTargets Ther. 2017, 10, 1941–1946. [Google Scholar] [CrossRef] [PubMed]
- Barboza, J.R.; Pereira, F.A.N.; Fernandes, R.A.; Vasconcelos, C.C.; Cartágenes, M.d.S.d.S.; Oliveira Lopes, A.J.; Melo, A.C.d.; Guimarães, I.d.S.; Rocha, C.Q.d.; Ribeiro, M.N.d.S. Cytotoxicity and Pro-Apoptotic, Antioxidant and Anti-Inflammatory Activities of Geopropolis Produced by the Stingless Bee Melipona fasciculata Smith. Biology 2020, 9, 292. [Google Scholar] [CrossRef]
- Huang, X.J.; Huang, Y.R.; Peng, B.; Wang, J.F.; Tang, H.Y.; Chen, Y.M. CLG promotes mTOR/ULK1 pathway-mediated autophagy to inhibit OS development by inhibiting TRAF6-mediated FLT3 ubiquitination. Cancer Sci. 2024, 115, 3466–3480. [Google Scholar] [CrossRef]
- Wang, L.M.; Jiang, Y.H.; Li, X.Y.; Wu, M.R.; Xu, Z.Y.; Li, L.J.; Yi, Y.; Wang, H.X. In Vivo and In Vitro Study on the Mechanism of Anticervical Cancer Effects of Corilagin in Mice. J. Food Biochem. 2024, 2024, 4822900. [Google Scholar] [CrossRef]
- Pucci, B.; Kasten, M.; Giordano, A. Cell cycle and apoptosis. Neoplasia 2000, 2, 291–299. [Google Scholar] [CrossRef] [PubMed]
- Zaib, S.; Hayyat, A.; Ali, N.; Gul, A.; Naveed, M.; Khan, I. Role of Mitochondrial Membrane Potential and Lactate Dehydrogenase A in Apoptosis. Anti-Cancer Agents Med. Chem. 2022, 22, 2048–2062. [Google Scholar] [CrossRef]
- Kondratskyi, A.; Kondratska, K.; Skryma, R.; Prevarskaya, N. Ion channels in the regulation of apoptosis. Biochim. Biophys. Acta-Biomembr. 2015, 1848, 2532–2546. [Google Scholar] [CrossRef]
- Kakiuchi, N.; Hattori, M.; Namba, T.; Nishizawa, M.; Yamagishi, T.; Okuda, T.J.J.o.N.P. Inhibitory Effect of Tannins on Reverse Transcriptase from RNA Tumor Virus. J. Nat. Prod. 1985, 48, 614. [Google Scholar] [CrossRef]
- Tong, Y.; Zhang, G.; Li, Y.; Xu, J.; Yuan, J.; Zhang, B.; Hu, T.; Song, G. Corilagin inhibits breast cancer growth via reactive oxygen species-dependent apoptosis and autophagy. J. Cell. Mol. Med. 2018, 22, 3795–3807. [Google Scholar] [CrossRef]
- Deng, Y.; Li, X.; Li, X.; Zheng, Z.; Huang, W.; Chen, L.; Tong, Q.; Ming, Y. Corilagin induces the apoptosis of hepatocellular carcinoma cells through the mitochondrial apoptotic and death receptor pathways. Oncol. Rep. 2018, 39, 2545–2552. [Google Scholar] [CrossRef]
- Liu, C.; Liu, H.; Huang, H.; Hao, J.; Lv, Y.; Zhang, J.; Ma, Y.; Wu, C.; Qin, R.; Yang, X. Corilagin induces laryngeal cancer antiproliferation and inhibits growth factor and cytokine signaling pathways in vitro and in vivo. J. Funct. Foods 2020, 69, 103947. [Google Scholar] [CrossRef]
- Zhang, L.; Jia, B.; Velu, P.; Wu, H. Corilagin induces apoptosis and inhibits HMBG1/PI3K/AKT signaling pathways in a rat model of gastric carcinogenesis induced by methylnitronitrosoguanidine. Environ. Toxicol. 2022, 37, 1222–1230. [Google Scholar] [CrossRef]
- Pan, Z.H.; Luo, Y.C.; Xia, Y.; Zhang, X.; Qin, Y.; Liu, W.J.; Li, M.J.; Liu, X.N.; Zheng, Q.S.; Li, D.F. Cinobufagin induces cell cycle arrest at the S phase and promotes apoptosis in nasopharyngeal carcinoma cells. Biomed. Pharmacother. 2020, 122, 109763. [Google Scholar] [CrossRef] [PubMed]
- Karimian, A.; Ahmadi, Y.; Yousefi, B. Multiple functions of p21 in cell cycle, apoptosis and transcriptional regulation after DNA damage. DNA Repair 2016, 42, 63–71. [Google Scholar] [CrossRef]
- Manousakis, E.; Miralles, C.M.; Esquerda, M.G.; Wright, R.H.G. CDKN1A/p21 in Breast Cancer: Part of the Problem, or Part of the Solution? Int. J. Mol. Sci. 2023, 24, 17488. [Google Scholar] [CrossRef]
- Shaikh, A.; Wesner, A.A.; Abuhattab, M.; Kutty, R.G.; Premnath, P. Cell cycle regulators and bone: Development and regeneration. Cell Biosci. 2023, 13, 35. [Google Scholar] [CrossRef] [PubMed]
- Mansilla, S.F.; De La Vega, M.B.; Calzetta, N.L.; Siri, S.O.; Gottifredi, V. CDK-Independent and PCNA-Dependent Functions of p21 in DNA Replication. Genes 2020, 11, 593. [Google Scholar] [CrossRef] [PubMed]
- Kowalski, S.; Karska, J.; Łapińska, Z.; Hetnał, B.; Saczko, J.; Kulbacka, J. An overview of programmed cell death: Apoptosis and pyroptosis—Mechanisms, differences, and significance in organism physiology and pathophysiology. J. Cell. Biochem. 2023, 124, 765–784. [Google Scholar] [CrossRef]
- Liu, W.; Jin, W.; Zhu, S.; Chen, Y.; Liu, B. Targeting regulated cell death (RCD) with small-molecule compounds in cancer therapy: A revisited review of apoptosis, autophagy-dependent cell death and necroptosis. Drug Discov. Today 2022, 27, 612–625. [Google Scholar] [CrossRef]
- Yang, Y.; Chen, Y.; Wu, J.H.; Ren, Y.; Liu, B.; Zhang, Y.; Yu, H. Targeting regulated cell death with plant natural compounds for cancer therapy: A revisited review of apoptosis, autophagy-dependent cell death, and necroptosis. Phytother. Res. 2023, 37, 1488–1525. [Google Scholar] [CrossRef]
- Chan, K.-H.; Zheng, B.-X.; Leung, A.S.-L.; Long, W.; Zhao, Y.; Zheng, Y.; Wong, W.-L. A NRAS mRNA G-quadruplex structure-targeting small-molecule ligand reactivating DNA damage response in human cancer cells for combination therapy with clinical PI3K inhibitors. Int. J. Biol. Macromol. 2024, 279, 135308. [Google Scholar] [CrossRef]
- Gao, Y.; Zhang, Y.; Li, J.; Zhang, H.; Li, X. Precise engineering of nanoassembled Corilagin small molecule into supramolecular nanoparticles for the treatment and care against cervical carcinoma. Process Biochem. 2021, 106, 103–111. [Google Scholar] [CrossRef]
- Sponchioni, M.; Capasso Palmiero, U.; Moscatelli, D. Thermo-responsive polymers: Applications of smart materials in drug delivery and tissue engineering. Mater. Sci. Eng. C 2019, 102, 589–605. [Google Scholar] [CrossRef]
- Yang, H.; Liu, Z.; Song, Y.; Hu, C. Hyaluronic acid-functionalized bilosomes for targeted delivery of tripterine to inflamed area with enhancive therapy on arthritis. Drug Deliv. 2019, 26, 820–830. [Google Scholar] [CrossRef] [PubMed]













| Gene | Gene Forward Primer (5’→3’) | Reverse Primer (5’→3’) |
|---|---|---|
| P53 | GTTCCGAGAGCTGAATGAGG | TCTGAGTCAGGCCCTTCTGT |
| P21 | GACACCACTGGAGGGTGACT | CAGGTCCACATGGTCTTCCT |
| CYCLIND | AACTACCTGGACCGCTTCCT | CCACTTGAGCTTGTTCACCA |
| BAX | AAGAAGCTGAGCGAGTGTCT | GTTCTGATCAGTTCCGGCAC |
| BCL-2 | GCCTTCTTTGAGTTCGGTGG | CAAATCAAACAGAGGCCGCA |
| CASPEASE3 | ACTGGACTGTGGCATTGAGA | GCACAAAGCGACTGGATGAA |
| CASPASE9 | GCCCCATATGATCGAGGACA | CAGAAACGAAGCCAGCATGT |
| CYTOCHROME C | ATGAAGTGTTCCCAGTGCCA | CTCTCCCCAGATGATGCCTT |
| PERP | TGCCATCATTCTCATTGCAT | AACCCCAGTTGAACTCATGG |
| PUMA | GAGGAGGAACAGTGGGCC | GGAGTCCCATGATGAGATTGT |
| β-ACTIN | CATCCGCAAAGACCTGTACG | CCTGCTTGCTGATCCACATC |
| Cells | Compound | Time (h) | IC50 Value (μmol/mL) |
|---|---|---|---|
| A2780 Cells | Corilagin | 24 | 61.32 |
| 48 | 47.81 | ||
| 5-Fu | 24 | 36.46 | |
| 48 | 22.81 | ||
| IOSE-80 Cells | Corilagin | 24 | 263.72 |
| 48 | 174.52 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, Z.; Jiang, Y.; Shan, T.; Hu, L.; Wu, M.; Ji, H.; Li, L.; Yi, Y.; Wang, H.; Wang, L. Study on the Effects and Mechanism of Corilagin on A2780 Cell Apoptosis. Curr. Issues Mol. Biol. 2025, 47, 105. https://doi.org/10.3390/cimb47020105
Xu Z, Jiang Y, Shan T, Hu L, Wu M, Ji H, Li L, Yi Y, Wang H, Wang L. Study on the Effects and Mechanism of Corilagin on A2780 Cell Apoptosis. Current Issues in Molecular Biology. 2025; 47(2):105. https://doi.org/10.3390/cimb47020105
Chicago/Turabian StyleXu, Ziyang, Yuhan Jiang, Tiantian Shan, Lei Hu, Minrui Wu, Hanxu Ji, Longjie Li, Yang Yi, Hongxun Wang, and Limei Wang. 2025. "Study on the Effects and Mechanism of Corilagin on A2780 Cell Apoptosis" Current Issues in Molecular Biology 47, no. 2: 105. https://doi.org/10.3390/cimb47020105
APA StyleXu, Z., Jiang, Y., Shan, T., Hu, L., Wu, M., Ji, H., Li, L., Yi, Y., Wang, H., & Wang, L. (2025). Study on the Effects and Mechanism of Corilagin on A2780 Cell Apoptosis. Current Issues in Molecular Biology, 47(2), 105. https://doi.org/10.3390/cimb47020105

