Hepatic Insulin Resistance in Hyperthyroid Rat Liver: Vitamin E Supplementation Highlights a Possible Role of ROS
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Tissue Preparation
2.3. Mitochondria Preparation
2.4. Tissue Content of Vitamin E
2.5. Redox State Evaluation
2.6. Susceptibility to Oxidative Stress
2.7. Reactive Oxygen Species Determination
2.8. NAD(P)H Oxidase (NOX) Activity Assay
2.9. H2O2 Mitochondrial Release
2.10. Activities of Antioxidant Enzymes (GPX, GR, SOD, CAT)
2.11. Oxygen Consumption
2.12. Basal Glucose and Insulin Serum Level
2.13. Determination of Insulin Resistance
2.14. Western Blot Analysis
2.15. RNA Isolation, RT-PCR and qPCR
2.16. Data Analysis
3. Results
3.1. Body Parameters
3.2. Lipid and Protein Oxidative Damage and In Vitro Susceptibility to Oxidative Damage of Liver Homogenate and Isolated Mitochondria
3.3. ROS Content, Mitochondrial ROS Release and NADPH Oxidase Activity
3.4. Antioxidant Enzymes Activity of Liver Homogenate
3.5. Oxygen Consumption of Liver Homogenate and Isolated Mitochondria
3.6. Akt and JNK Activation
3.7. Glycaemic Homeostasis Parameters
3.8. Gene Expression Analysis of Slc2a1, Slc2a2, Pparg, Irs2, Ppara, Cd36 and Il1b
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Venditti, P.; Reed, T.T.; Victor, V.M.; Di Meo, S. Insulin resistance and diabetes in hyperthyroidism: A possible role for oxygen and nitrogen reactive species. Free Radic. Res. 2019, 53, 248–268. [Google Scholar] [CrossRef] [Scilit]
- Rohdenburg, G.L. Thyroid diabetes. Endocrinology 1920, 4, 63–70. [Google Scholar] [CrossRef] [Scilit]
- Kraegen, E.W.; Clark, P.W.; Jenkins, A.B.; Daley, E.A.; Chisholm, D.J.; Storlien, L.H. Development of Muscle Insulin Resistance After Liver Insulin Resistance in High-Fat-Fed Rats. Diabetes 1991, 40, 1397–1403. [Google Scholar] [CrossRef] [Scilit]
- Gierach, M.; Gierach, J.; Junik, R. Insulin resistance and thyroid disorders. Endokrynol. Pol. 2014, 65, 70–76. [Google Scholar] [CrossRef] [Scilit]
- Feng, X.; Jiang, Y.; Meltzer, P.; Yen, P.M. Thyroid hormone regulation of hepatic genes in vivo detected by complementary DNA microarray. Mol. Endocrinol. 2000, 14, 947–955. [Google Scholar] [CrossRef]
- Park, E.A.; Jerden, D.C.; Bahouth, S.W. Regulation of phosphoenolpyruvate carboxykinase gene transcription by thyroid hormone involves two distinct binding sites in the promoter. Biochem. J. 1995, 309, 913–919. [Google Scholar] [CrossRef] [Scilit]
- Weinberg, M.B.; Utter, M.F. Effect of thyroid hormone on the turnover of rat liver pyruvate carboxylase and pyruvate dehydrogenase. J. Biol. Chem. 1979, 254, 9492–9499. [Google Scholar] [CrossRef] [Scilit]
- Weinstein, S.P.; O’Boye, E.; Fisher, M.; Haber, R.S. Regulation of GLUT2 glucose transporter expression in liver by thyroid hormone: Evidence for hormonal regulation of the hepatic glucose transport system. Endocrinology 1994, 135, 649–654. [Google Scholar] [CrossRef] [Scilit]
- Höppner, W.; Süssmuth, W.; Seitz, H.J. Effect of thyroid state on cyclic AMP-mediated induction of hepatic phosphoenolpyruvate carboxykinase. Biochem. J. 1985, 226, 67–73. [Google Scholar] [CrossRef] [Scilit]
- Brenta, G. Why can insulin resistance be a natural consequence of thyroid dysfunction? J. Thyroid Res. 2011, 2011, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Venditti, P.; Di Meo, S. Thyroid hormone-induced oxidative stress. Cell. Mol. Life Sci. 2006, 63, 414–434. [Google Scholar] [CrossRef] [Scilit]
- Venditti, P.; De Rosa, R.; Di Meo, S. Effect of Thyroid State on H2O2 Production by Rat Liver Mitochondria. Mol. Cell. Endocrinol. 2003, 205, 185–192. [Google Scholar] [CrossRef] [Scilit]
- Di Meo, S.; Reed, T.T.; Venditti, P.; Victor, V.M. Role of ROS and RNS Sources in Physiological and Pathological Conditions. Oxidative Med. Cell. Longev. 2016, 2016, 1245049. [Google Scholar] [CrossRef] [Scilit]
- Solinas, G.; Karin, M. JNK1 and IKKβ: Molecular links between obesity and metabolic dysfunction. FASEB J. 2010, 24, 2596–2611. [Google Scholar] [CrossRef] [Scilit]
- Pal, M.; Febbraio, M.A.; Lancaster, G.I. The roles of c-Jun NH2-terminal kinases (JNKs) in obesity and insulin resistance. J. Physiol. 2016, 594, 267–279. [Google Scholar] [CrossRef] [Scilit]
- Evans, J.L.; Maddux, B.A.; Goldfine, I.D. The molecular Basis for Oxidative Stress-Induced Insulin Resistance. Antioxid. Redox Signal. 2005, 7, 1040–1052. [Google Scholar] [CrossRef] [Scilit]
- Birnbaum, M.J. Turning down insulin signalling. J. Clin. Investig. 2001, 108, 655–659. [Google Scholar] [CrossRef]
- Bloch-Damti, A.; Bashan, N. Proposed Mechanism for the Induction of Insulin Resistance by Oxidative Stress. Antioxid. Redox Signal. 2005, 7, 1553–1567. [Google Scholar] [CrossRef] [Scilit]
- Burgess, S.C. Regulation of Glucose Metabolism in the Liver. In International Textbook of Diabetes Mellitus; De Fronzo, R.A., Ferrannini, E., Zimmet, P., Eds.; John Wiley & Sons, Inc.: New York, NY, USA, 2015. [Google Scholar]
- Weisberg, S.P.; McCann, D.; Desai, M.; Rosenbaum, M.; Leibel, R.L.; Ferrante, A.W., Jr. Obesity is associated with macrophage accumulation in adipose tissue. J. Clin. Invest. 2003, 112, 1796–1808. [Google Scholar] [CrossRef]
- Gregor, M.F.; Hotamisligil, G.S. Inflammatory mechanisms in obesity. Annu. Rev. Immunol. 2011, 29, 415–445. [Google Scholar] [CrossRef] [Scilit]
- O’Rourke, R.W.; White, A.E.; Metcalf, M.D.; Winters, B.R.; Diggs, B.S.; Zhu, X.; Marks, D.L. Systemic inflammation and insulin sensitivity in obese IFN-γ knockout mice. Metabolism 2012, 61, 1152–1161. [Google Scholar] [CrossRef] [Scilit]
- Dimitriadis, G.; Parry-Billings, M.; Bevan, S.; Leighton, B.; Krause, U.; Piva, T.; Tegos, K.; Challiss, R.A.; Wegener, G.; Newsholme, E.A. The effects of insulin on transport and metabolism of glucose in skeletal muscle from hyperthyroid and hypothyroid rats. Eur. J. Clin. Invest. 1997, 27, 475–483. [Google Scholar] [CrossRef] [Scilit]
- Venditti, P.; Napolitano, G.; Barone, D.; Di Meo, S. Effect of training and vitamin E administration on rat liver oxidative metabolism. Free Radic. Res. 2014, 48, 322–332. [Google Scholar] [CrossRef] [Scilit]
- Venditti, P.; De Leo, T.; Di Meo, S. Vitamin E administration attenuates the tri-iodothyronine-induced modification of heart electrical activity in the rat. J. Exp. Biol. 1997, 200, 909–914. [Google Scholar] [CrossRef] [Scilit]
- Lang, J.K.; Gohil, K.; Packer, L. Simultaneous determination of tocopherols, ubiquinols, and ubiquinones in blood, plasma, tissue homogenates, and subcellular fractions. Anal. Biochem. 1986, 157, 106–116. [Google Scholar] [CrossRef] [Scilit]
- Heath, R.L.; Tappel, A.L. A new sensitive assay for the measurement of hydroperoxides. Anal. Biochem. 1976, 76, 184–191. [Google Scholar] [CrossRef] [Scilit]
- Mesquita, C.S.; Oliveira, R.; Bento, F.; Geraldo, D.; Rodrigues, J.V.; Marcos, J.C. Simplified 2,4-dinitrophenylhydrazine spectrophotometric assay for quantification of carbonyls in oxidized proteins. Anal. Biochem. 2014, 458, 69–71. [Google Scholar] [CrossRef] [Scilit]
- Driver, A.S.; Kodavanti, P.R.; Mundy, W.R. Age-related changes in reactive oxygen species production in rat brain homogenates. Neurotoxicol. Teratol. 2000, 22, 175–181. [Google Scholar] [CrossRef] [Scilit]
- Suzuki, Y.; Lehrer, R.I. NAD(P)H oxidase activity in human neutrophils stimulated by phorbol myristate acetate. J. Clin. Invest. 1980, 66, 1409–1418. [Google Scholar] [CrossRef] [Scilit]
- Minkenberg, I.; Ferber, E. Lucigenin-dependent chemiluminescence as a new assay for NAD(P)H-oxidase activity in particulate fractions of human polymorphonuclear leukocytes. J. Immunol. Methods 1984, 71, 61–67. [Google Scholar] [CrossRef] [Scilit]
- Hyslop, P.A.; Sklar, L.A. A quantitative fluorimetric assay for the determination of oxidant production by polymorphonuclear leukocytes: Its use in the simultaneous fluorimetric assay of cellular activation processes. Anal. Biochem. 1984, 141, 280–286. [Google Scholar] [CrossRef] [Scilit]
- Flohé, L.; Günzler, W.A. Assays of glutathione peroxidase. Methods Enzymol. 1984, 105, 114–121. [Google Scholar]
- Carlberg, I.; Mannervik, B. Purification and characterization of the flavoenzyme glutathione reductase from rat liver. J. Biol. Chem. 1975, 250, 5475–5480. [Google Scholar] [CrossRef] [Scilit]
- Aebi, H. Catalase in vitro. Methods Enzymol. 1984, 105, 121–126. [Google Scholar]
- Flohé, L.; Otting, F. Superoxide dismutase assays. Methods Enzymol. 1984, 105, 93–104. [Google Scholar]
- Napolitano, G.; Fasciolo, G.; Salbitani, G.; Venditti, P. Chlorella sorokiniana Dietary Supplementation Increases Antioxidant Capacities and Reduces Ros Release in Mitochondria of Hyperthyroid Rat Liver. Antioxidants 2020, 9, 883. [Google Scholar] [CrossRef] [Scilit]
- Appleton, D.J.; Rand, J.S.; Sunvold, G.D. Basal plasma insulin and homeostasis model assessment (HOMA) are indicators of insulin sensitivity in cats. J. Feline Med. Surg. 2005, 7, 83–93. [Google Scholar] [CrossRef] [Scilit]
- Venditti, P.; Napolitano, G.; Fasciolo, G.; Di Meo, S. Thyroid state affects H2O2 removal by rat heart mitochondria. Arch. Biochem. Biophys. 2019, 662, 61–67. [Google Scholar] [CrossRef] [Scilit]
- Araujo, A.S.; Schenkel, P.; Enzveiler, A.T.; Fernandes, T.R.; Partata, W.A.; Llesuy, S.; Ribeiro, M.F.; Khaper, N.; Singal, P.K.; Belló-Klein, A. The role of redox signaling in cardiac hypertrophy induced by experimental hyperthyroidism. J. Mol. Endocrinol. 2008, 41, 423–430. [Google Scholar] [CrossRef] [Scilit]
- Napolitano, G.; Fasciolo, G.; Di Meo, S.; Venditti, P. Vitamin E Supplementation and Mitochondria in Experimental and Functional Hyperthyroidism: A Mini-Review. Nutrients 2019, 11, 2900. [Google Scholar] [CrossRef] [Scilit]
- Venditti, P.; De Leo, T.; Di Meo, S. Antioxidant-sensitive shortening of ventricular action potential in hyperthyroid rats is independent of lipid peroxidation. Mol. Cell. Endocrinol. 1998, 142, 15–23. [Google Scholar] [CrossRef] [Scilit]
- Venditti, P.; Pamplona, R.; Portero-Otin, M.; De Rosa, R.; Di Meo, S. Effect of experimental and cold exposure induced hyperthyroidism on H2O2 production and susceptibility to oxidative stress of rat liver mitochondria. Arch. Biochem. Biophys. 2006, 447, 11–22. [Google Scholar] [CrossRef] [Scilit]
- Fernández, V.; Barrientos, X.; Kipreos, K.; Valenzuela, A.; Videla, L.A. Superoxide radical generation, NADPH oxidase activity, and cytochrome P-450 content of rat liver microsomal fractions in an experimental hyperthyroid state: Relation to lipid peroxidation. Endocrinology 1985, 117, 496–501. [Google Scholar] [CrossRef] [Scilit]
- Cachia, O.; Benna, J.E.; Pedruzzi, E.; Descomps, B.; Gougerot-Pocidalo, M.A.; Leger, C.L. alpha-tocopherol inhibits the respiratory burst in human monocytes. Attenuation of p47(phox) membrane translocation and phosphorylation. J. Biol. Chem. 1998, 273, 32801–32805. [Google Scholar] [CrossRef] [Scilit]
- Calvisi, D.F.; Ladu, S.; Hironaka, K.; Factor, V.M.; Thorgeirsson, S.S. Vitamin E down-modulates iNOS and NADPH oxidase in c-Myc/TGF-alpha transgenic mouse model of liver cancer. J. Hepatol. 2004, 41, 815–822. [Google Scholar] [CrossRef] [Scilit]
- Chow, C.K. Vitamin E Regulation of Mitochondrial Superoxide Generation. Neurosignals 2001, 10, 112–124. [Google Scholar] [CrossRef] [Scilit]
- Costilla, M.; Macri Delbono, R.; Klecha, A.; Cremaschi, G.A.; Barreiro Arcos, M.L. Oxidative Stress Produced by Hyperthyroidism Status Induces the Antioxidant Enzyme Transcription through the Activation of the Nrf-2 Factor in Lymphoid Tissues of Balb/c Mice. Oxid. Med. Cell. Longev. 2019, 2019, 1–14. [Google Scholar] [CrossRef] [Scilit]
- Taniguchi, C.M.; Emanuelli, B.; Kahn, C.R. Critical nodes in signalling pathways: Insights into insulin action. Nat. Rev. Mol. Cell. Biol. 2006, 7, 85–96. [Google Scholar] [CrossRef] [Scilit]
- Sarbassov, D.D.; Guertin, D.A.; Ali, S.M. Phosphorylation and Regulation of Akt/PKB by the rictor-mTOR complex. Science 2005, 307, 1098–1102. [Google Scholar] [CrossRef] [Scilit]
- Santoleri, D.; Titchenell, P.M. Resolving the Paradox of Hepatic Insulin Resistance. Cell. Mol. Gastroenterol. Hepatol. 2019, 7, 447–456. [Google Scholar] [CrossRef] [Scilit]
- Solinas, G.; Becattini, B. JNK at the crossroad of obesity, insulin resistance, and cell stress response. Mol. Metab. 2016, 6, 174–184. [Google Scholar] [CrossRef] [Scilit]
- Yan, H.; Gao, Y.; Zhang, Y. Inhibition of JNK suppresses autophagy and attenuates insulin resistance in a rat model of nonalcoholic fatty liver disease. Mol. Med. Rep. 2017, 15, 180–186. [Google Scholar] [CrossRef] [Scilit]
- Hirosumi, J.; Tuncman, G.; Chang, L.; Görgün, C.Z.; Uysal, K.T.; Maeda, K.; Karin, M.; Hotamisligil, G.S. A central role for JNK in obesity and insulin resistance. Nature 2002, 420, 333–336. [Google Scholar] [CrossRef] [Scilit]
- Shen, H.M.; Liu, Z.G. JNK signaling pathway is a key modulator in cell death mediated by reactive oxygen and nitrogen species. Free Radic. Biol. Med. 2006, 40, 928–939. [Google Scholar] [CrossRef] [Scilit]
- Gavrilova, O.; Haluzik, M.; Matsusue, K.; Cutson, J.J.; Johnson, L.; Dietz, K.R.; Nicol, C.J.; Vinson, C.; Gonzalez, F.J.; Reitman, M.L. Liver peroxisome proliferator-activated receptor gamma contributes to hepatic steatosis, triglyceride clearance, and regulation of body fat mass. J. Biol. Chem. 2003, 278, 34268–34276. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Nakajima, T.; Gonzalez, F.J.; Tanaka, N. PPARs as Metabolic Regulators in the Liver: Lessons from Liver-Specific PPAR-Null Mice. Int. J. Mol. Sci. 2020, 21, 2061. [Google Scholar] [CrossRef] [Scilit]
- Nishimura, T.; Nakatake, Y.; Konishi, M.; Itoh, N. Identification of a novel FGF, FGF-21, preferentially expressed in the liver. Biochim. Biophys. Acta 2000, 1492, 203–206. [Google Scholar] [CrossRef] [Scilit]
- Kharitonenkov, A.; Adams, A.C. Inventing new medicines: The FGF21 story. Mol. Metab. 2013, 3, 221–229. [Google Scholar] [CrossRef] [Scilit]
- Hajri, T.; Han, X.X.; Bonen, A.; Abumrad, N.A. Defective fatty acid uptake modulates insulin responsiveness and metabolic responses to diet in CD36-null mice. J. Clin. Invest. 2002, 109, 1381–1389. [Google Scholar] [CrossRef]
- Goudriaan, J.R.; Dahlmans, V.E.; Teusink, B.; Ouwens, D.M.; Febbraio, M.; Maassen, J.A.; Romijn, J.A.; Havekes, L.M.; Voshol, P.J. CD36 deficiency increases insulin sensitivity in muscle but induces insulin resistance in the liver in mice. J. Lipid Res. 2003, 44, 2270–2277. [Google Scholar] [CrossRef] [Scilit]
- Miquilena-Colina, M.E.; Lima-Cabello, E.; Sánchez-Campos, S.; García-Mediavilla, M.V.; Fernández-Bermejo, M.; Lozano-Rodríguez, T.; Vargas-Castrillón, J.; Buqué, X.; Ochoa, B.; Aspichueta, P.; et al. Hepatic fatty acid translocase CD36 upregulation is associated with insulin resistance, hyperinsulinaemia and increased steatosis in non-alcoholic steatohepatitis and chronic hepatitis C. Gut 2011, 60, 1394–1402. [Google Scholar] [CrossRef] [Scilit]
- Steneberg, P.; Sykaras, A.G.; Backlund, F.; Straseviciene, J.; Söderström, I.; Edlund, H. Hyperinsulinemia enhances hepatic expression of the fatty acid transporter Cd36 and provokes hepatosteatosis and hepatic insulin resistance. J. Biol. Chem. 2015, 290, 19034–19043. [Google Scholar] [CrossRef] [Scilit]
- Wilson, C.G.; Tran, J.L.; Erion, D.M.; Vera, N.B.; Febbraio, M.; Weiss, E.J. Hepatocyte-Specific Disruption of CD36 Attenuates Fatty Liver and Improves Insulin Sensitivity in HFD-Fed Mice. Endocrinology 2016, 157, 570–585. [Google Scholar] [CrossRef] [Scilit]
- Wang, C.; Hu, L.; Zhao, L.; Yang, P.; Moorhead, J.F.; Varghese, Z.; Chen, Y.; Ruan, X.Z. Inflammatory stress increases hepatic CD36 translational efficiency via activation of the mTOR signalling pathway. PLoS ONE 2014, 9, e103071. [Google Scholar] [CrossRef] [Scilit]
- Fazakerley, D.J.; Minard, A.Y.; Krycer, J.R.; Thomas, K.C.; Stöckli, J.; Harney, D.J.; Burchfield, J.G.; Maghzal, G.J.; Caldwell, S.T.; Hartley, R.C.; et al. Mitochondrial oxidative stress causes insulin resistance without disrupting oxidative phosphorylation. J. Biol. Chem. 2018, 293, 7315–7328. [Google Scholar] [CrossRef] [Scilit]
- Ali, M.A.; Eid, R.M.H.M.; Hanafi, M.Y. Vitamin C and E chronic supplementation differentially affect hepatic insulin signaling in rats. Life Sci. 2018, 194, 196–204. [Google Scholar] [CrossRef] [Scilit]
- Meng, Z.; Liu, M.; Zhang, Q.; Liu, L.; Song, K.; Tan, J.; Jia, Q.; Zhang, G.; Wang, R.; He, Y.; et al. Gender and Age Impacts on the Association Between Thyroid Function and Metabolic Syndrome in Chinese. Medicine 2015, 94, e2193. [Google Scholar] [CrossRef] [Scilit]








| Gene Symbol | c | Sense Primer (5′---3′) | Antisense Primer (5′---3′) |
|---|---|---|---|
| Cd36 | NM_031561.2 | TTACTGGAGCCGTTATTGGTG | CCTTGATCTTGCTGCTATTCT |
| Il1b | NM_031512.2 | AGGCTGACAGACCCCAAAAG | AAGCTCCACGGGCAAGACAT |
| Irs2 | NM_001168633.1 | GCCAGCACCTACGCAAGCA | AGCCCTGCCTCTTGGTTCC |
| Ppara | NM_013196.2 | CCACTTGAAGCAGATGACCT | CATTGCCAGGGGACTCATCT |
| Pparg | NM_013124.3; NM_001145366.1; NM_001145367.1 | GTCGGATCCACAAAAAGAGTA | TTTGTCTGTTGTCTTTCCTGT |
| Slc2a1 | NM_138827.2 | GCGGGCTGTGCTGTGCTC | CCACAGCAACAGCAGCAG |
| Slc2a2 | NM_012879.2 | GGGAAGAAGAGACTGAAGGA | CTTCCAGCAATGATGAGAGC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fasciolo, G.; Napolitano, G.; Aprile, M.; Cataldi, S.; Costa, V.; Ciccodicola, A.; Di Meo, S.; Venditti, P. Hepatic Insulin Resistance in Hyperthyroid Rat Liver: Vitamin E Supplementation Highlights a Possible Role of ROS. Antioxidants 2022, 11, 1295. https://doi.org/10.3390/antiox11071295
Fasciolo G, Napolitano G, Aprile M, Cataldi S, Costa V, Ciccodicola A, Di Meo S, Venditti P. Hepatic Insulin Resistance in Hyperthyroid Rat Liver: Vitamin E Supplementation Highlights a Possible Role of ROS. Antioxidants. 2022; 11(7):1295. https://doi.org/10.3390/antiox11071295
Chicago/Turabian StyleFasciolo, Gianluca, Gaetana Napolitano, Marianna Aprile, Simona Cataldi, Valerio Costa, Alfredo Ciccodicola, Sergio Di Meo, and Paola Venditti. 2022. "Hepatic Insulin Resistance in Hyperthyroid Rat Liver: Vitamin E Supplementation Highlights a Possible Role of ROS" Antioxidants 11, no. 7: 1295. https://doi.org/10.3390/antiox11071295
APA StyleFasciolo, G., Napolitano, G., Aprile, M., Cataldi, S., Costa, V., Ciccodicola, A., Di Meo, S., & Venditti, P. (2022). Hepatic Insulin Resistance in Hyperthyroid Rat Liver: Vitamin E Supplementation Highlights a Possible Role of ROS. Antioxidants, 11(7), 1295. https://doi.org/10.3390/antiox11071295

