Next Article in Journal / Special Issue
Activation of Defense Mechanisms against Pathogens in Mosses and Flowering Plants
Previous Article in Journal
Aggregation of p-Sulfonatocalixarene-Based Amphiphiles and Supra-Amphiphiles
Previous Article in Special Issue
The Transcriptome of Brassica napus L. Roots under Waterlogging at the Seedling Stage
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

A Novel Peroxidase CanPOD Gene of Pepper Is Involved in Defense Responses to Phytophtora capsici Infection as well as Abiotic Stress Tolerance

1
College of Horticulture, Northwest A&F University, Yangling 712100, Shaanxi, China
2
State Key Laboratory of Crop Stress Biology in Arid Areas, Northwest A&F University, Yangling 712100, Shaanxi, China
3
College of Horticulture, Henan Agricultural University, Zhengzhou 450002, Henan, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Int. J. Mol. Sci. 2013, 14(2), 3158-3177; https://doi.org/10.3390/ijms14023158
Submission received: 15 January 2013 / Revised: 30 January 2013 / Accepted: 30 January 2013 / Published: 4 February 2013
(This article belongs to the Special Issue Abiotic and Biotic Stress Tolerance Mechanisms in Plants)

Abstract

:
Peroxidases are involved in many plant processes including plant defense responses to biotic and abiotic stresses. We isolated a novel peroxidase gene CanPOD from leaves of pepper cultivar A3. The full-length gene has a 1353-bp cDNA sequence and contains an open reading frame (ORF) of 975-bp, which encodes a putative polypeptide of 324 amino acids with a theoretical protein size of 34.93 kDa. CanPOD showed diverse expression levels in different tissues of pepper plants. To evaluate the role of CanPOD in plant stress responses, the expression patterns of CanPOD were examined using Real-Time RT-PCR. The results indicated that CanPOD was significantly induced by Phytophtora capsici. Moreover, CanPOD was also up-regulated in leaves after salt and drought stress treatments. In addition, CanPOD expression was strongly induced by signaling hormones salicylic acid (SA). In contrast, CanPOD was not highly expressed after treatment with cold. Meanwhile, in order to further assess the role of gene CanPOD in defense response to P. capsici attack, we performed a loss-of-function experiment using the virus-induced gene silencing (VIGS) technique in pepper plants. In comparison to the control plant, the expression levels of CanPOD were obviously decreased in CanPOD-silenced pepper plants. Furthermore, we analyzed the effect of P. capsici on detached-leaves and found that the CanPOD-silenced plant leaves were highly susceptible to P. capsici infection. Taken together, our results suggested that CanPOD is involved in defense responses to P. capsici infection as well as abiotic stresses in pepper plants.

1. Introduction

Pepper (Capsicum annuum L.) is an agriculturally important vegetable of global significance. It also serves as one of several model crop systems representing the family of Solanaceae. Phytophthora capsici is a highly dynamic and destructive pathogen of vegetables. It attacks all cucurbits, pepper, tomato and eggplant, and, more recently, snap and lima beans [1]. Plants have evolved sophisticated defense mechanisms to combat an abundance of microbial pathogens [2]. Plants have also protected themselves against severe environmental abiotic stress conditions such as cold, salt, drought and heavy metal pollutants. Environmental stresses can produce excess concentrations of reactive oxygen species, resulting in oxidative damage to, or the apoptotic death of cells [3]. In their natural environment they are often simultaneously confronted with more than one type of stress [4]. To cope with these stresses, plants have evolved to counteract the effects of ROS with antioxidants and antioxidative enzymes that maintain ROS balance within the cell. Of the antioxidative enzymes, peroxidases (POD) play key roles in cellular ROS detoxification [5].
Plant peroxidases, which are encoded by a large number of superfamily genes, are secreted from plant cells or transported into vacuoles via the endoplasmic reticulum (ER) [6,7]. In plants, peroxidases play several biological roles, including lignin biosynthesis, suberization, indole-3-acetic acid (IAA) catabolism, scavenging hydrogen peroxide or organic hydroperoxides, growth regulation and tolerance against biotic and abiotic stresses [814]. Due to their physiologically significant roles in plants, peroxidases have become the subject of a broad range of biochemical and molecular biological studies [15]. Peroxidases exhibit diverse expression patterns in response to environmental stresses, both abiotic and biotic, such as wounding, ethylene, pathogen infection, drought, low-temperature, iron deficiency, light and plant growth regulators, which have been well documented [9,12,14,1623].
During the last few years, considerable progress has been made in understanding how plants protect themselves against biotic and abiotic stresses. Pathogenesis-related peroxidase gene Shpx2 has also been reported to enhance resistance against oomycete pathogens [24]. In Arabidopsis thaliana, the tissue-specific expression of 73 peroxidase genes was monitored by microarray assays [6,9]. In wheat, sequence-associated expression patterns of peroxidase genes have been demonstrated during powdery mildew (Blumeria graminis f.sp. tritici) infection [25]. Overexpression of sweet potato (Ipomoea batatas) swpa4 peroxidase significantly enhanced the salt and drought stress tolerance of tobacco plants (Nicotiana tabacum) [26]. More recently, overexpression of CaPO2 in transgenic Arabidopsis thaliana plants conferred enhanced tolerance to high salt, drought, and oxidative stress, while also enhancing resistance to infection by the necrotrophic fungal pathogen Alternaria brassicicola [27]. Do et al. suggested that CAPO1 may be involved in pepper defense against pathogen attack [28]. In addition, the expression of a peroxidase gene CAPO1 was highly unregulated by copper stress [29].
Although much progress has been made in elucidating the molecular and biochemical properties and physiological functions of the plant peroxidases, there is still limited knowledge because of their multitude isozyme forms, broad range of substrate specificity, complex expression profiles in response to temporal, spatial and environmental changes and the absence of simple correlations between sequence similarity and function [10]. It is necessary to improve our understanding on the molecular and functional properties of the pepper peroxidase gene CanPOD and to provide genetic evidence on the involvement of peroxidase in pathogen infection and abiotic stresses in pepper plants.
In this study, we isolated a peroxidase gene CanPOD from leaves of pepper cultivar A3. CanPOD showed tissue-specific expression in different organs of pepper plant. To better understand the possible roles of CanPOD in defense against biotic (P. capsici infection) and abiotic stresses (cold, salt, drought, salicylic acid and methyl jasmonate), a time course expression patterns of the CanPOD gene was performed using Real-Time RT-PCR. Furthermore, the loss-of-function of CanPOD in pepper plants was examined using a virus-induced gene silencing (VIGS) system. The results suggest that CanPOD may play an important role during the pathogen infection and abiotic stresses.

2. Results and Discussion

2.1. Cloning and Sequence Analysis of CanPOD Gene

To investigate the role of the peroxidase gene in pepper plant response to pathogen infection, the CanPOD gene was identified and characterized. The full sequence of CanPOD cDNA comprised of 1353-bp, containing the start code ATG, stop code TAG, a 5′-untranslated region (UTR) of 67-bp, an open reading frame (ORF) of 975-bp and a 3′-UTR of 311-bp with a poly (A+) tail of 28-bp. The cDNA sequence has been submitted to GenBank as accession number FJ596178. The ORF encodes a predicted protein of 324 amino acids. The calculated molecular mass of the mature protein is 34.93 kDa, with an estimated pI of 9.220. TMpred showed that CanPOD protein contained three inside to outside helices and one outside to inside helice, which score more than 500. Therefore, CanPOD protein contained transmembrane stuctures. The CanPOD protein would be a secretory protein with signal peptide and transmembrane structures, the resorts of NCBI Blast also sustain this viewpoint. CanPOD protein contained four conserved domains (Figure 1). The rectangle indicates the heme binding site with 29 residues; ellipse indicates the active site with 31 residues; # indicates the substrate binding site with 10 residues; Δ indicates the calcium binding sites with 9 residues. Eight conserved cysteine residues (C38, C71, C76, C118, C124, C203, C229 and C320) yielded four disulfide bridges.
Multiple amino acid sequence alignment revealed that the deduced amino acid sequence of CanPOD displayed substantial homology with other proteins (Figure 2), including Nicotiana tabacum peroxidase (BAA82306.1, 88%), Vitis vinifera peroxidase 4 (XP_002278996.1, 78%), Rubia cordifolia peroxidase 6 (ADN96693.1, 78%), Glycine max peroxidase 52-like (XP_003523269.1, 81%), Ipomoea batatas anionic peroxidase swpb3 (AAP42508.1, 82%), Gossypium hirsutum class III peroxidase (AAP76387.1, 82%), Catharanthus roseus putative secretory peroxidase (AAX44001.2, 78%) and Medicago truncatula Peroxidase (XP_003616748.1, 77%), respectively.
To evaluate the molecular evolutionary relationships of CanPOD against other peroxidases, a phylogenetic tree was carried out using Mega5.1. Two clusters were formed using the full-length cDNA sequences of 18 peroxidase genes from Catharanthus roseus, Arachis, Catharanthus roseus, Glycine max, Gossypium hirsutum, Ipomoea batatas, Medicago truncatula, Nicotiana tabacum, Quercus, Rubia cordifolia, Solanum tuberosum and Vitis vinifera (Figure 3). CanPOD gene (FJ596178) was grouped together with POD a2 from Solanum tuberosum, which is a secretory peroxidase, belongs to the plant peroxidase super family. All of the bioinformatics analysis results suggested that CanPOD should be a plant peroxidase.

2.2. Tissue-Specific Expression of CanPOD Gene in Different Tissues of Pepper Plants

In order to investigate the expression levels of CanPOD gene in different tissues of pepper cultivar A3 plants, total RNA was extracted from roots, stems, leaves, flowers and immature fruits. The results were shown in Figure 4. Differences were observed among the different tissues of pepper plants. In general, the highest expression levels of CanPOD gene were detected in leaves, followed by roots, stems and flowers, respectively. However, CanPOD gene was slightly expressed in immature fruits. The results suggest that CanPOD gene is differentially expressed in the tissues of pepper cultivar A3 plant. This finding is in agreement with previous studies showing that the expression of many peroxidase genes is tissue specific [6,7,9,14,16,20]. The relatively high expression of CanPOD gene in leaves suggests that CanPOD gene may be associated with defense responses in leaves.

2.3. Expression Profiles of CanPOD Gene in Response to Biotic and Different Aboitic Stress Treatments

Plants possess an elaborate and finely regulated defense system to defend against various biotic and abiotic stresses [27]. To study the relationship between the CanPOD gene and stress response of pepper, the expression patterns of CanPOD gene in response to diverse stresses were measured, including biotic stress (pathogen infection) and abiotic stresses (cold, salt, drought, SA and MeJA), using Real-Time RT-PCR.

2.3.1. Expression Analysis of CanPOD Gene in Response to Phytophthora capsici Infection

It have been reported that the peroxidases are known to be induced by various pathogens infection [3,14,27]. To explore whether CanPOD is involved in pathogen defense, the expression levels of this gene were measured in leaves after inoculation with the avirulent strain of P. capsici. The results from Real-Time RT-PCR showed that the CanPOD gene transcripts were strongly induced in the incompatible interaction with P. capsici (Figure 5a). Increased levels of CanPOD transcript was detectable at 6 h after inoculation, and maintained for 12 h and reached the maximal level at 48 h after inoculation. From 48 to 96 h, the expression levels of CanPOD gene presented a decreased trend. However, compared with the control plants, the expression levels of CanPOD gene were up-regulated in leaves in response to inoculation with the avirulent strain of P. capsici. Infection of rice leaves by Xanthomonas oryzae pv. oryzae, the causal pathogen of rice blight, strongly induces a Peroxidase isoform in xylem vessels, which results in secondary wall thickening and reduced access of the pathogen to the pit membrane, which is the pathogen’s contact point in living cells [8]. Do et al. reported that the strong accumulation of CAPOA1, CAPOT1 and CAPO1 transcripts in the incompatible interaction was induced in the pepper leaves infected by P. capsici, which suggests that the peroxidase gene expression may be related to ROS-associated defense response of pepper to P. capsici infection [28]. Sarowar et al. showed that CAPOA1-overexpressed tobacco plants exhibited increased resistance to the oomycete pathogen, Phytophthora nicotianae [3]. However, the transgenic plants were not found to be resistant to the bacterial pathogen, Pseudomonas syringae pv. tabaci, but were weakly resistant against the bacterial pathogen R. solanacearum. A previous study demonstrated that overexpression of CaPO2 in Arabidopsis were to exhibit enhanced resistance to P. syringae pv. tomato DC3000 infection [14]. Choi et al. reported that the CaPO2-OX lines exhibited enhanced resistance to infection by the necrotrophic fungal pathogen A. brassicicola, but not to H. arabidopsidis isolate Noco2 [27]. This suggests that, although some peroxidases are clearly involved in host resistance to certain pathogen, not all the peroxidases play such a defensive role. When considering these previous studies, our results indicate that expression of CanPOD is very rapidly induced upon pathogen infection, and suggesting that CanPOD might be play an important role in the pepper plant defense response to P. capsici attack.

2.3.2. Expression Analysis of CanPOD Gene in Response to Cold, Salt and Drought Stress Treatments

Plant peroxidases are known to function as an important antioxidant system, along with superoxide dismutase, catalase and glutathione reductase. They play a role in combating the oxidative stress induced by cold, salt and drought [5,30,31]. To evaluate the possible roles of the CanPOD in the defense response of pepper against various abiotic (cold, salt and drought) stresses, the CanPOD expression analysis was carried out by Real-Time RT-PCR using gene-specific primers. The results showed diverse expression patterns in response to cold, salt and drought stresses (Figure 5b–d).
Temperature stress raises ROS levels in plants and would be expected induce various kinds of antioxidant enzymes to overcome the resulting oxidative stress [32]. In our study, the CanPOD transcript levels were somewhat increased in response to cold stress. During the first 3 h, the expression of CanPOD decreased down to 42% of the control. As time progressed, the expression level of CanPOD was gradually increased and reached a peak (1.7-fold) at 9 h. After that, the CanPOD expression level began to decrease. At 24 h, CanPOD mRNA level was only 0.7-fold compared with the control. On the contrary, Choi found that cold stress strongly induced the CaPO2 gene in pepper leaves up to 25 h after treatment [27]. Park reported that six POD genes showed different expression levels in response to chilling, which only gene swpa4 was strongly expressed at 4 °C. However, the expression level of swpb3 was decreased [20]. These results suggest that there exist changes in gene expression patterns under cold stress.
In contrast to the results for cold stress, the CanPOD gene expression levels were significantly enhanced in pepper leaves under salt stress, showing a 10.5-fold induction at 9 h after 0.4 M NaCl treatment. Moreover, the CanPOD was up-regulated throughout the entire treatment period (Figure 5c). Consistent with these results, previous studies also showed that POD genes are up-regulated by salinity stress in plants [27,33,34]. Therefore, we conclude that the CanPOD gene involves in pepper plant resistance to salt stress.
Previous studies demonstrated upregulation of POD genes in response to drought stress, and transgenic plants expressing exogenous POD genes showed high levels of tolerance to drought stress [26,35]. In our study, the expression levels of CanPOD were also up-regulation in response to drought stress. However, the CanPOD expression levels was substantially lower than the one in response to salt stress, and reached maximum 4.3-fold at 3 h (Figure 5d). The result is in accordance with the results of Choi that the CaPO2 gene was strongly induced by drought stress [27]. However, other researched proposed the different outcome that PoPOD1 expression was down-regulated by PEG, which induce the generation of ROS in plant cells [15,36,37]. These results suggest that the pepper peroxidase gene CanPOD may be inducible during the drought stress.

2.3.3. Expression Analysis of CanPOD Gene in Response to SA and MeJA Treatments

Various plant hormones, such as salicylic acid (SA) and methyl jasmonic acid (MeJA), are important signaling molecules that contribute to the establishment of disease resistance and abiotic stress tolerance in pepper plants [3840]. SA typically mediates basal defence to biotrophic pathogens, while JA generally controls defense reactions to necrotrophs [41]. To determine whether these defense-related signaling molecules can induce CanPOD gene expression, we performed Real-Time RT-PCR in pepper leaves treated with 5 mM SA or 50 μM MeJA.
Response to SA stress treatment, the expression of CanPOD was induced dramatically (Figure 5e). The CanPOD transcripts accumulated as early as 3 h after treatment, and presented a gradual increase. The highest transcript levels of CanPOD occurred (20.7-fold) at 24 h, comparing to the control. There was a sharply decrease at 48 h, which was the last observed time point (Figure 5e), indicated that CanPOD expression was considerably induced or up-regulated by the signal molecule SA. In contrast, Choi et al. reported that SA cannot induce CanPOD gene expression [27]. SA (20 μM), which controls the systemic acquired plant pathogen response, did not affect the steady-state levels of PoPOD1 transcripts [15]. These opposite opinions may be due to SA have been shown to activate different sets of plant PR genes and act either synergistically or antagonistically during defense signaling dependent on their concentrations [42].
To assess the possible involvement of CanPOD in signaling pathways utilized by MeJA stress, 50 μM MeJA was sprayed as the same method used for the SA stress. As shown in Figure 5f, CanPOD transcript levels were slowly increased between 3 and 6 h after treatment, but they decreased to the basal level at 9 h. The strongest response to MeJA was observed (4.6-fold) at 24 h, compared to the control. Similarly, MeJA enhanced the expression of some POD genes from sweetpotato, such as swpa4, swpa5 and swpb2 [29]. However, there was a different result that expression of the wound-inducible basic POD gene tpoxN1 was not enhanced by MeJA in tobacco plants [16]. These results suggest that while CanPOD gene may be involved in the JA-dependent signaling pathway.
Taken together with these results, we demonstrated that CanPOD may be potentially valuable gene for the genetic engineering of plants for pathogen infection as well as abiotic stress resistance.

2.4. Virus-Induced Gene Silencing (VIGS) of CanPOD Gene in Pepper Plants

To examine the effect of loss-of-function of the CanPOD gene in pepper plants, VIGS was performed in pepper cultivar A3 using the tobacco rattle virus (TRV)-based virus-induced gene silencing (VIGS) technique [14,4346]. A fragment from the 3′ end of the CanPOD open reading frame was cloned into the pTRV2 vector and generated pTRV2-CanPOD vector (Figure 6). Empty vector (pTRV-00) was used as a negative control.
The pTRV2-CaPDS, which silences phytoene desaturase gene (PDS) and induces a photo-bleaching phenotype, was used as a positive control to determine the success of gene silencing. As shown in Figure 7a, symptoms of photo-bleaching were occurred on the leaves of CaPDS silenced plants. This provided the evidence that VIGS is successful in our study. There was no morphological difference between the control plant (pTRV-00) and the CanPOD silenced plant (pTRV2-CanPOD) 35 d after inoculation (Figure 7a). Meanwhile, the efficiency of the VIGS was investigated by Real-Time RT-PCR (Figure 7b). The results revealed that the levels of CanPOD expression in CanPOD silenced plant (pTRV2-CanPOD) were reduced drastically comparing to the control pepper plant (pTRV-00). These RT-PCR data indicate that CanPOD was silenced effectively in pepper plants. In order to further confirm the efficiency of VIGS on CanPOD, the peroxidase (POD) enzymatic activity in pepper leaves was tested in the control plant (pTRV-00) and CanPOD silenced plant (pTRV2-CanPOD). As shown in Figure 7c, the activities of POD enzyme were decreased in the CanPOD silenced plants comparing to the control plant, which were essentially identical to the results from the Real-Time RT-PCR, proving the validity of RT-PCR analysis. These findings further suggest that VIGS was successful and effective for CanPOD silencing on pepper plants.
It is well known that peroxidase be induced by various pathogens infection [12,14,20,27]. The CanPOD expression in pepper leaves was significantly induced in the incompatible interaction with avirulent strain of P. capsici. To determine the role played by CanPOD in the basal defense response of pepper, we analyzed the levels of resistance to P. capsici infection in leaves of CanPOD silenced plants. Five weeks after VIGS, the fourth leaves from the top of control plants (pTRV2-00) and silenced pepper plants (pTRV2-CanPOD) were detached and inoculated by addition of 20ul zoospores suspension (104 cfu mL−1) of P. capsici by using a syringe without needle. Disease symptoms were observed in the CanPOD silenced plant leaves 3 d after inoculation. However, the control (pTRV-00) plant leaves did not exhibit any cell death or disease symptoms (Figure 8). Therefore, we demonstrate that CanPOD-silenced plants are more susceptible to P. capsici infection than the control plants. One paper had reported similar results to our study [14]. As a whole, the CanPOD gene is involved in the defense responses to pathogen infection of pepper plants.

3. Experimental Section

3.1. Plant Materials and Growth Conditions

Pepper cultivar A3 was used in this study, which provided by pepper breeding group in Northwest A&F University, China. Seeds were soaked in warm water (55 °C) for approximately 20 min to promote germination. The seeds were rinsed twice every day and then placed on moist gauze in an incubator (28 °C, 60% relative humidity in darkness). When the seeds were at least 80% germinated, they were sown in a soil mix [grass charcoal/perlite (3/1, v/v)] in plastic pots. Pepper plants were grown in a growth chamber with a 16 h light and 8 h dark photoperiod at 25 °C.

3.2. Pathogen Preparation and Inoculation Procedures

Preparation of P. capsici inocula was described previously [47]. The avirulent strain PC of P. capsici was grown on potato dextrose agar (PDA) medium in darkness at 28 °C for 7 days. The mycelia were scraped and incubated under fluorescent light for 2 days to promote sporangium formation. Zoospores were prepared by sporulating cultures with sterile distilled water and incubating at 4 °C for 1 h followed by 30 min at 28 °C to initiate zoospore release. The zoospores were collected by filtering through four layers of cheesecloth and estimated using a hemacytometer. The concentration of the zoospore suspension was adjusted to 1 × 104 zoospores per millimeter with sterile water.
For pathogen stress treatment, pepper plants at six-true leaf stage were inoculated by addition of 2.5 mL zoospores suspension (104 cfu. mL−1) of P. capsici each pot.
For virus-induced gene silencing (VIGS) of CanPOD gene in pepper plants, the fourth leaves from the top of control plants (pTRV2-00) and silenced pepper plants (pTRV2-CanPOD) after inoculation 5 weeks were collected and sterilized with 75% ethanol for 1 min, washed three times with sterile water, then injected by addition of 20ul zoospores suspension (104 cfu. mL−1) of P. capsici by using a syringe without needle. After inoculation, the leaves were grown in a growth chamber at 28 °C under a 16 h light/8 h dark photoperiod cycle with 60% relative humidity.

3.3. Cloning and Sequence Analysis of CanPOD Gene

Total RNA was extracted from young leaves of pepper cultivar A3 using the Trizol (Invitrogen) method. To isolate the complete 5′ and 3′ regions of the putative CanPOD gene, the rapid amplification of cDNA ends (RACE) method was used. First-strand cDNA synthesis was performed using Smart RACE cDNA amplification kit (Clontech). Gene-specific primer GSP1: (5′-GCTTCGTCAATGGATGTGATGGA-3′) was used for 3′-RACE and the gene-specific primer GSP2: (5′-TGGAAGAAAAGGCGAAGCAGAGA-3′) was used for 5′-RACE, respectively. The universal primers for 5′ and 3′ RACE are given in the kit. The full-length cDNA sequence of CanPOD gene was obtained by PCR amplification using forward (5′-GGTGCTCAACACACACTTTA-3′) and reverse (5′-TTGTTTAAGTTATTCATGAT-3′) primers. The PCR products were cloned into pMD19-T vector (Takara) and sequenced by Shanghai GeneCore Biotechnologies Co. (GeneCore).
NCBI bioinformatics tools [48] were used to compare and analyze the nucleotide and protein sequences data. Multiple sequence alignments of CanPOD gene with peroxidase from other species were performed by the Clustal X1.83 analysis program of DNAstar software (LaserGene, Madison, WI, USA). The phylogenetic tree was constructed using Mega5.1 by the neighbor-joining method. Conserved domains in protein were identified in Conserved Domain database [49].

3.4. CanPOD Gene Expression Patterns Analysis

3.4.1. Tissue-Specific Expression of CanPOD Gene

To evaluate the expression levels of CanPOD gene in different organs of pepper plants under normal conditions, root, stem, leaf, flower, and immature fruit samples were collected from pepper cultivar A3 plants, then frozen in liquid nitrogen and kept at −80 °C for further gene expression analysis.

3.4.2. Stress Treatments

Pepper plants at the six-true leaf stage were used for biotic stress and treatments with environmental stresses and plant hormone.
For pathogen treatment, pepper plants were inoculated by addition of 2.5 mL zoospores suspension (104 cfu. mL−1) of the avirulent strain of P. capsici. Mock plants were inoculated with distilled water. Leaves from non-infected and infected plants were collected at 0, 6, 12, 24, 48, 72 and 96 h after inoculation, immediately frozen in liquid nitrogen and kept at −80 °C.
For cold stress treatment, pepper plants were placed at 4 °C for low temperature treatment. For salt and drought stress treatments, the seedlings were watered into their roots with solutions of 0.4 M sodium chloride (NaCl) or 0.4 M mannitol. Control plants were treated with sterile ddH2O. Leaves from mock and stress-treated plants were collected at 0, 3, 6, 9, 12 and 24 h after treatment, immediately frozen in liquid nitrogen and kept at −80 °C.
For plant hormone treatments, pepper plants were sprayed with 5 mM salicylic acid (SA) or 50 μM methyl jasmonate (MeJA) solutions. Mock plants were sprayed with sterile ddH2O and placed in a separate chamber. Leaves from mock and treated plants were collected at 0, 3, 6, 9, 12, 24 and 48 h after treatment, immediately frozen in liquid nitrogen and kept at −80 °C.
All treatments were placed in a growth chamber at 25 °C (except cold stress) under a 16 h light/8 h dark photoperiod cycle with 60% relative humidity. All treatments were performed and analyzed triplicate in separate experiments.

3.5. RNA Isolation and Real-Time RT-PCR Analysis

Total RNA was extracted from pepper leaves of different time points after diverse stress treatments using Trizol (Invitrogen) method. The concentration of total RNA was measured spectrophotometrically using a NanoDrop instrument (Thermo Scientific NanoDrop 2000C Technologies, Wilmington, DE, USA), and the purity was assessed using the A260/280 and A260/230 ratios provided by NanoDrop. For quantitative Real-Time RT-PCR analysis, first strand cDNA was synthesized from 500 ng total RNA using a PrimeScript™ Kit (TaKaRa, Bio Inc, China) following the manufacturer’s protocols. Real-Time RT-PCR was carried out using SYBR® Premix Ex Taq™ II (TaKaRa, Bio Inc., China). Real-Time RT-PCR analysis was performed on a 20 μL mixture containing 10.0 μL SYBR® Premix Ex Taq™ II, 2.0 μL diluted cDNA, 0.8 μL of forward and reverse primers. The amplification was completed with the following cycling parameters: 95 °C for 1 min, followed by 45 cycles at 95 °C for 10 s, 52 °C for 30 s, and 72 °C for 30 s. The gene of Ubi3 (AY486137.1) was used as internal control (reference gene) in this study [50]. The primer sequences used for Real-Time RT-PCR were shown in Table 1. The relative expression levels of gene were determined by using comparative threshold method of 2−ΔΔCt [51]. All samples were performed in triplicate and each had at least three independent biological replicates.

3.6. Virus-Induced Gene Silencing (VIGS) Analysis of CanPOD Gene in Pepper Plants

The tobacco rattle virus (TRV)-based VIGS system was used for gene silencing in pepper plants as described by [14,52]. Phytoene desaturase (PDS) encodes an enzyme involved in the carotenoid biosynthesis pathway [53]. The CaPDS (phytoene desaturase from C. annuum, GenBank: X68058.1) has been used as a visual marker for the effectiveness of VIGS in pepper plants. A fragment of coding region of CaPDS gene was amplified using gene-specific primers (Forward: 5′-GGGGAATTCTGTTGTCAAAACTCCAAGGTCTGTA-3′ with an EcoRI restriction site and Reverse: 5′-GGGGGATCCTTTCTCCCACTTGGTTCACTCTTGT-3′ with a BamHI restriction site). The resulting product was inserted into pTRV2 vector to generate pTRV2-CaPDS. A fragment of coding region of CanPOD gene was amplified using gene-specific primers (Forward: 5′-GGGTCTAGAGTGCTCAACACACACTTTATTCTTCTC-3′ with an XbaI restriction site and Reverse: 5′-GGGGGATCCCCAAGAATGACAACAGAGTCCCTA-3′ with a Bam HI restriction site). The resulting product was inserted into pTRV2 vector to generate pTRV2-CanPOD. The pTRV1, pTRV2, pTRV2-CaPDS and pTRV2-CanPOD vectors were transformed into the Agrobacterium tumefaciens strain GV3101, respectively. Agrobacterium tumefaciens strain GV3101 carrying pTRV1 were respectively mixed with pTRV2, pTRV2-CaPDS and pTRV2-CanPOD at a 1:1 ratio. The suspensions of agrobacterium inocula containing pTR1 and pTRV2-00, pTRV2-CaPDS or pTRV2-CanPOD (OD600 = 1.0) was infiltrated into the fully expanded cotyledons of pepper plants using a 1.0 mL sterilized syringe without a needle. The agrobacterium-inoculated pepper plants were grown in a growth chamber at 18 °C in darkness for 2 days with 45% relative humidity, and then transferred into a growth chamber at 22 °C under a 16 h light/8 h dark photoperiod cycle with 60% relative humidity. Leaves of control plants (pTRV2-00) and silenced pepper plants (pTRV2-CanPOD) after inoculation five weeks were used for CanPOD gene analysis.

3.7. Peroxidase (EC 1.11.1.7) Activity Assay

Activities of Peroxidase (POD) enzyme were quantified using the technique of Beffa [54]. The samples were collected from leaves of control plants (pTRV2-00) and silenced plants (pTRV2-CanPOD) 35 d after inoculation and stored at −80 °C. The lyophilised leaf powder (approximately 1.0 g) was ground in a mortar and homogenised with 5.0 mL pre-chilled extraction buffer (0.1 M potassium phosphate buffer (pH 7.5), 1mM EDTA, and 4% polyvinylpyrrolidone). The homogenate was centrifuged at 12,000 rpm for 25 min. The supernatant fraction was used as a crude extract for the enzyme activity assays. All procedures were carried out at 4 °C. The reaction mixtures contained 25 μL 50 mM H2O2, 5 μL 250 mM guaiacol, 195 μL 12.5 mM 3,3-dimethylglutaric acid (3,3-DGA)-NaOH (pH 6.0) and 25 μL enzyme extract. The optical density was recorded at 470 nm. The amount of enzyme required for the formation of 1 μmol tetraguaiacol min−1 at room temperature was defined as 1 unit (U) of PX activity. Each treatment was conducted in three independent experiments and each measurement was repeated three times.

3.8. Statistical Analysis

All data were expressed as the mean ± SD of three independent replicates (n = 3). Data from replicates of the same experiment were pulled together for one-way analysis of Variance (ANOVA), and differences among means of treatments were determined using the least significant difference (LSD). Statistical procedures were performed using Statistical Analysis System software (SAS Institute, version 8.2). Values of p ≤ 0.05 were considered statistically significant.

4. Conclusions

In conclusion, we isolated a peroxidase gene, named CanPOD, from leaves of pepper cultivar A3. CanPOD transcript level is diverse in different organs. The expression patterns of CanPOD were examined in leaves of pepper plants during biotic and abiotic stresses. The results indicated that CanPOD was strongly induced upon inoculation with P. capsici. Moreover, CanPOD expression was significantly up-regulated by SA treatment. Thus, expression analyses demonstrated that the CanPOD gene was also involved in other abiotic stresses, including salt, drought and MeJA. However, the CanPOD gene was not evidently expressed under cold stress comparing to the other abiotic stresses. In addition, virus-induced gene silencing (VIGS) of CanPOD revealed that it was more susceptible to P. capsici attack in CanPOD-silenced leaves than in the control plants. On the basis of these studies, we will perform genetic transformation to further explore the functional role of CanPOD in disease resistance of pepper plants. Taken together, these results suggest that CanPOD playes an important role in defense response to P. capsici infection and abiotic stresses.

Acknowledgments

This research was supported by the National Natural Science Foundation of China (No. 31272163), “The Twelfth Five-Year” Plan of National Science and Technology in Rural Areas (No. 2011BAD12B03) and the Shaanxi Provincial Science and Technology Coordinating Innovative Engineering Project (2012KTCL02-09).

Conflict of Interest

The authors declare no conflict of interest.

References

  1. Lamour, K.H.; Stam, R.; Jupe, J.; Huitema, E. The oomycete broad-host-range pathogen Phytophthora capsici. Mol. Plant Pathol 2012, 13, 329–337. [Google Scholar]
  2. Jones, J.D.G.; Dangl, J.L. The plant immune system. Nature 2006, 444, 323–329. [Google Scholar]
  3. Sarowar, S.; Kim, E.N.; Kim, Y.J.; Ok, K.D.; Kim, K.D.; Hwang, B.K.; Shin, J.S. Overexpression of a pepper ascorbate peroxidase-like 1 gene in tobacco plants enhances tolerance to oxidative stress and pathogens. Plant Sci 2005, 1, 55–63. [Google Scholar]
  4. Dang, F.F.; Wang, Y.N.; Yu, L.; Eulgem, T.; Lai, Y.; Liu, Z.Q.; Wang, X.; Qiu, A.L.; Zhang, T.X.; Lin, J.; et al. CaWRKY40, a WRKY protein of pepper, plays an important role in the regulation of tolerance to heat stress and resistance to Ralstonia solanacearum infection. Plant Cell Environ. 2012. [Google Scholar] [CrossRef]
  5. Passardi, F.; Penel, C.; Dunand, C. Performing the paradoxical: How plant peroxidases modify the cell wall. Trends Plant Sci 2004, 11, 534–540. [Google Scholar]
  6. Tognolli, M.; Penel, C.; Greppin, H.; Simon, P. Analysis and expression of the class III peroxidase large gene family in Arabidopsis thaliana. Gene 2002, 288, 129–138. [Google Scholar]
  7. Welinder, K.G.; Justesen, A.F.; Inger, V.H.; Kjærsgård, I.V.H.; Jensen, R.B.; Rasmussen, S.K.; Jespersen, H.M.; Duroux, L. Structural diversity and transcription of class III peroxidases from Arabidopsis thaliana. Eur. J. Biochem 2002, 269, 6063–6381. [Google Scholar]
  8. Hiraga, S.; Sasaki, K.; Ito, H.; Ohashi, Y.; Matsui, H. A large family of class III plant peroxidases. Plant Cell Physiol 2001, 42, 462–468. [Google Scholar]
  9. Valerio, L.; Meyer, M.D.; Penel, C.; Dunand, C. Expression analysis of the Arabidopsis peroxidase multigenic family. Phytochemistry 2004, 65, 1331–1342. [Google Scholar]
  10. Kim, S.S.; Choi, S.Y.; Park, J.H.; Lee, D.J. Regulation of the activity of Korean radish cationic peroxidase promoter during dedifferentiation and differentiation. Plant Physiol. Biochem 2004, 42, 763–772. [Google Scholar]
  11. Bae, H.; Roberts, D.P.; Lim, H.S.; Strem, M.D.; Park, S.C.; Ryu, C.M.; Melnick, R.L.; Bailey, B.A. Endophytic trichoderma isolates from tropical environments delay disease onset and induce resistance against Phytophthora capsici in hot pepper using multiple mechanisms. Mol. Plant-Microbe Interact 2011, 24, 336–351. [Google Scholar]
  12. Passardi, F.; Cosio, C.; Penel, C.; Dunand, C. Peroxidases have more functions than a Swiss army knife. Plant Cell Rep 2005, 24, 255–265. [Google Scholar]
  13. Veloso, J.; Díaz, J. Fusarium oxysporum Fo47 confers protection to pepper plants against Verticillium dahliae and Phytophthora capsici, and induces the expression of defence genes. Plant Pathol 2012, 61, 281–288. [Google Scholar]
  14. Choi, H.W.; Kim, Y.J.; Lee, S.C.; Hong, J.K.; Hwang, B.K. Hydrogen peroxide generation by the pepper extracellular peroxidase CaPO2 activates local and systemic cell death and defense response to bacterial pathogens. Plant Physiol 2007, 145, 890–904. [Google Scholar]
  15. Bae, E.K.; Lee, H.; Lee, J.S.; Noh, E.W.; Jo, J. Molecular cloning of a peroxidase gene from poplar and its expression in response to stress. Tree Physiol 2006, 26, 1405–1412. [Google Scholar]
  16. Hiraga, S.; Yamamoto, K. Diverse expression profiles of 21 rice peroxidase genes. FEBS Lett 2000, 471, 245–250. [Google Scholar]
  17. Ito, H.; Hiraga, S.; Tsugawa, H.; Matsui, H.; Honma, M.; Otsuki, Y.; Murakami, T.; Ohashi, Y. Xylem-specific expression of wound-inducible rice peroxidase genes in transgenic plants. Plant Sci 2000, 155, 85–100. [Google Scholar]
  18. Kim, K.Y.; Kwon, H.K.; Kwon, S.Y.; Lee, H.S.; Hur, Y.; Bang, J.W.; Choi, K.S.; Kwak, S.S. Differential expression of four sweet potato peroxidase genes in response to abscisic acid and ethephon. Phytochemistry 2000, 54, 19–22. [Google Scholar]
  19. Yoshida, K.; Kaothien, P.; Matsui, T.; Kawaoka, A.; Shinmyo, A. Molecular biology and application of plant Peroxidase genes. Appl. Microbiol. Biot 2003, 60, 665–670. [Google Scholar]
  20. Park, S.Y.; Ryu, S.H.; Kwon, S.Y.; Lee, H.S.; Kim, J.G.; Kwak, S.S. Differential expression of six novel peroxidase cDNAs from cell cultures of sweetpotato in response to stress. Mol. Genet. Genomics 2003, 269, 542–552. [Google Scholar]
  21. Matin, M.N.; Pandeya, D.; Baek, K.H.; Lee, D.S.; Lee, J.H.; Kang, H.; Kang, S.G. Phenotypic and genotypic analysis of rice lesion mimic mutants. Plant Pathology J 2010, 26, 159–169. [Google Scholar]
  22. Sang, M.K.; Kim, J.G.; Kim, K.D. Biocontrol activity and induction of systemic resistance in pepper by compost water extracts against Phytophthora capsici. Phytopathology 2010, 100, 774–783. [Google Scholar]
  23. Sang, M.K.; Kim, K.D. Biocontrol activity and primed systemic resistance by compost water extracts against anthracnoses of pepper and cucumber. Phytopathology 2011, 101, 732–740. [Google Scholar]
  24. Way, H.M.; Kazan, K.; Goulter, K.C.; Birch, R.G.; Manners, J.M. Expression of the Shpx2 peroxidase gene of Stylosanthes humilis in transgenic tobacco leads to enhanced resistance to Phytophthora parasitica pv. nicotianae and Cercospora nicotianae. Mol. Plant Pathol 2000, 1, 223–232. [Google Scholar]
  25. Liu, G.; Sheng, X.; Greenshields, D.L.; Ogieglo, A.; Kaminskyj, S.; Selvaraj, G.; Wei, Y. Profiling of wheat class III peroxidase genes derived from powdery mildew-attacked epidermis reveals distinct sequence-associated expression patterns. Mol. Plant-Microbe Interact 2005, 18, 730–741. [Google Scholar]
  26. Kim, Y.H.; Kim, C.Y.; Song, W.K.; Park, D.S.; Kwon, S.Y.; Lee, H.S.; Bang, J.B.; Kwak, S.S. Overexpression of sweetpotato swpa4 peroxidase results in increased hydrogen peroxide production and enhances stress tolerance in tobacco. Planta 2008, 227, 867–881. [Google Scholar]
  27. Choi, H.; Hwang, B. The pepper extracellular peroxidase CaPO2 is required for salt, drought and oxidative stress tolerance as well as resistance to fungal pathogens. Planta 2012, 235, 1369–1382. [Google Scholar]
  28. Do, H.M.; Hong, J.K.; Jung, H.W.; Kim, S.H.; Ham, J.H.; Hwang, B.K. Expression of peroxidase-like genes, H2O2 production, and peroxidase activity during the hypersensitive response to Xanthomonas campestris pv. vesicatoria in Capsicum annuum. Mol. Plant-Microbe Interact 2003, 16, 196–205. [Google Scholar]
  29. Chmielowska, J.; Veloso, J.; Gutierrez, J.; Silvar, C.; Diaz, J. Cross-protection of pepper plants stressed by copper against a vascular pathogen is accompanied by the induction of a defence response. Plant Sci 2010, 178, 176–182. [Google Scholar]
  30. Blokhina, O.; Virolainen, E.; Fagerstedt, K.V. Antioxidants, oxidative damage and oxygen deprivation stress: A review. Ann. Bot-London 2003, 91, 179–194. [Google Scholar]
  31. Baltruschat, H.; Fodor, J.; Harrach, B.D.; Niemczyk, E.; Barna, B.; Gullner, G.; Janeczko, A.; Kogel, K.H.; Schäfer, P.; Schwarczinger, I.; et al. Salt tolerance of barley induced by the root endophyte Piriformospora indica is associated with a strong increase in antioxidants. New Phytol 2008, 180, 501–510. [Google Scholar]
  32. Murata, N.; Ishizaki, N.O.; Higashi, S.; Hayashi, H.; Tasaka, Y.; Nishida, I. Genetically engineered alteration in the chilling sensitivity of plants. Nature 1992, 356, 710–713. [Google Scholar]
  33. Sreenivasulu, N.; Grimm, B.; Wobus, U.; Weschke, W. Differential response of antioxidant compounds to salinity stress in salt tolerant and salt sensitive seedlings of foxtail millet (Setaria italica). Physiol Plantarum 2000, 109, 435–442. [Google Scholar]
  34. Menezes-Benavente, L.; Teixeira, F.K.; Kamei, C.L.A.; Pinheiro, M.M. Salt stress induces altered expression of genes encoding antioxidant enzymes in seedlings of a Brazilian indica rice (Oryza sativa L.). Plant Sci 2004, 166, 323–331. [Google Scholar]
  35. Koussevitzky, S.; Suzuki, N.; Huntington, S.; Armijo, L.; Sha, W.; Cortes, D.; Shulaev, V.; Mittler, R. Ascorbate peroxidase 1 plays a key role in the response of Arabidopsis thaliana to stress combination. J. Biol. Chem 2008, 283, 34197–34203. [Google Scholar]
  36. Donahue, J.L.; Okpodu, C.M.; Cramer, C.L.; Grabau, E.A.; Alscher, R.G. Responses of antioxidants to paraquat in pea leaves. Plant Physiol 1997, 113, 249–257. [Google Scholar]
  37. Cazale, A.C.; Rouet-Mayer, M.A.; Barbier-Brygoo, H.; Mathieu, Y.; Lauriere, C. Oxidative burst and hypoosmotic stress in tobacco cell suspension. Plant Physiol 1998, 116, 659–669. [Google Scholar]
  38. An, S.H.; Sohn, K.H.; Choi, H.W.; Hwang, I.S.; Lee, S.C.; Hwang, B.K. Pepper pectin methylesterase inhibitor protein CaPMEI1 is required for antifungal activity, basal disease resistance and abiotic stress tolerance. Planta 2008, 228, 61–78. [Google Scholar]
  39. Lee, S.C.; Hwang, B.K. Functional roles of the pepper antimi-crobial protein gene, CaAMP1, in abscisic acid signaling and salt and drought tolerance in Arabidopsis. Planta 2009, 229, 383–391. [Google Scholar]
  40. Choi, D.S.; Hwang, B.K. Proteomics and functional analyses of pepper abscisic acid-responsive 1 (ABR1), which is involved in cell death and defense signaling. Plant Cell 2011, 23, 823–842. [Google Scholar]
  41. Glazebrook, J. Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens. Annu. Rev. Phytopathol 2005, 43, 205–227. [Google Scholar]
  42. Mur, L.A.J.; Kenton, P.; Atzorn, R.; Miersch, O.; Wasternack, C. The outcomes of concentration-specific interactions between salicylate and jasmonate signaling include synergy, antagonism, and oxidative stress leading to cell death. Plant Physiol 2006, 140, 249–262. [Google Scholar]
  43. Liu, Y.; Schiff, M.; Dinesh-Kumar, S.P. Virus-induced gene silencing in tomato. Plant J 2002, 31, 777–786. [Google Scholar]
  44. Chung, E.; Seong, E.; Kim, Y.C.; Chung, E.J.; Oh, S.K.; Lee, S.; Park, J.M.; Joung, Y.H.; Choi, D. A method of high frequency virus-induced gene silencing in chili pepper (Capsicum annuum L.cv.Bukang). Mol. Cells 2004, 17, 377–380. [Google Scholar]
  45. An, S.H.; Choi, H.W.; Hwang, I.S.; Hong, J.K.; Hwang, B.K. A novel pepper membrane-located receptor-like protein gene CaMRP1 is required for disease susceptibility, methyl jasmonate insensitivity and salt tolerance. Plant Mol. Biol 2008, 67, 519–533. [Google Scholar]
  46. Hwang, I.S.; Hwang, B.K. The pepper 9-lipoxygenase gene CaLOX1 functions in defense and cell death responses to microbial pathogens. Plant Physiol 2010, 152, 948–967. [Google Scholar]
  47. Kim, H.J.; Nahm, S.H.; Lee, H.R.; Yoon, G.B.; Kim, K.T.; Kang, B.C.; Choi, D.; Kweon, O.Y.; Cho, M.C.; Kwon, J.K. BAC-derived markers converted from RFLP linked to Phytophthora capsici resistance in pepper (Capsicum annuum L.). Theor. Appl. Genet 2008, 118, 15–27. [Google Scholar]
  48. Bioinformatics Tool. Available online: http:/blast.ncbi.nlm.nih.gov (accessed on 15 December 2012.
  49. Bioinformatics Tool. Available online: http://www.ncbi.nlm.nih.gov/stucture/cdd.shtml accessed on 15 December 2012.
  50. Wan, H.J.; Yuan, W.; Ruan, M.; Ye, Q.; Wang, R.; Li, Z.; Zhou, G.; Yao, Z.; Zhao, J.; Liu, S.; Yang, Y. Identification of reference genes for reverse transcription quantitative real-time PCR normalization in pepper (Capsicum annuum L.). Biochem. Biophy. Res. Co 2011, 416, 24–30. [Google Scholar]
  51. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C (T)) Method. Methods 2001, 25, 402–408. [Google Scholar]
  52. Liu, Y.; Schiff, M.; Marathe, R.; Dinesh-Kumar, S.P. Tobacco Rar1, EDS1 and NPR1/NIM1 like genes are required for N-mediated resistance to tobacco mosaic virus. Plant J 2002, 30, 415–429. [Google Scholar]
  53. Cunningham, F.X.; Gantt, E. Genes and enzymes of cartotenoid biosynthesis in plants. Plant Mol. Biol 1998, 49, 557–583. [Google Scholar]
  54. Beffa, R.; Martin, H.V.; Pilet, P.E. In vitro oxidation of indoleacetic acid by soluble auxin-oxidasesand peroxidases from maize roots. Plant Physiol 1990, 94, 485–491. [Google Scholar]
Figure 1. The nucleotide sequence (above) and deduced amino acid sequence (below) CanPOD. The nucleotide and amino acid positions are numbered on the left. The signal peptide is shown in solid line. The rectangle indicates the heme binding site; ellipse indicates the active site; # indicates the substrate binding site; Δ indicates the calcium binding sites.
Figure 1. The nucleotide sequence (above) and deduced amino acid sequence (below) CanPOD. The nucleotide and amino acid positions are numbered on the left. The signal peptide is shown in solid line. The rectangle indicates the heme binding site; ellipse indicates the active site; # indicates the substrate binding site; Δ indicates the calcium binding sites.
Ijms 14 03158f1
Figure 2. Multiple sequence alignment of amino acid sequence of CanPOD with amino acid sequences of NtPOD (Nicotiana tabacum, AB027752.1), IbPOD (Ipomoea batatas, AY206414.1), CrPOD (Catharanthus roseus, AY837788.2), VvPOD (Vitis vinifera, XM_002278960.1), GhPOD (Gossypium hirsutum, AY311597.1), GmPOD (Glycine max, XM_003523221.1), MtPOD (Medicago truncatula, XM_003616700.1) and RcPOD (Rubia cordifolia, HM807273.1). Asterisks represent identical amino acids among the different species. Period and semicolon mark positions where amino acids are similar. Gaps (-) were introduced to maximize alignment.
Figure 2. Multiple sequence alignment of amino acid sequence of CanPOD with amino acid sequences of NtPOD (Nicotiana tabacum, AB027752.1), IbPOD (Ipomoea batatas, AY206414.1), CrPOD (Catharanthus roseus, AY837788.2), VvPOD (Vitis vinifera, XM_002278960.1), GhPOD (Gossypium hirsutum, AY311597.1), GmPOD (Glycine max, XM_003523221.1), MtPOD (Medicago truncatula, XM_003616700.1) and RcPOD (Rubia cordifolia, HM807273.1). Asterisks represent identical amino acids among the different species. Period and semicolon mark positions where amino acids are similar. Gaps (-) were introduced to maximize alignment.
Ijms 14 03158f2
Figure 3. Phylogenetic tree of proteins homologous to CanPOD and peroxidase proteins from other species. The rooted gene tree (majority-rule consensus from 1000 bootstrap replicates) resulted from heuristic searching in Mega5.1.Bootstrap values are indicated at each branch node. GenBank accession numbers are in parentheses after each species and gene name. Scale bar indicates similarity coefficient.
Figure 3. Phylogenetic tree of proteins homologous to CanPOD and peroxidase proteins from other species. The rooted gene tree (majority-rule consensus from 1000 bootstrap replicates) resulted from heuristic searching in Mega5.1.Bootstrap values are indicated at each branch node. GenBank accession numbers are in parentheses after each species and gene name. Scale bar indicates similarity coefficient.
Ijms 14 03158f3
Figure 4. Tissue-specific expression of CanPOD gene in different tissues of pepper plants. Error bars represent the mean ± SD of three independent biological replicates.
Figure 4. Tissue-specific expression of CanPOD gene in different tissues of pepper plants. Error bars represent the mean ± SD of three independent biological replicates.
Ijms 14 03158f4
Figure 5. Real-Time RT-PCR analysis of relative CanPOD gene expression levels in leaves of pepper plants after biotic and different abiotic stress treatments. (a) Phytophthora capsici Infection; (b) Cold stress; (c) Salt stress; (d) Drought stress; (e) SA stress and (f) MeJA stress. Error bars represent the mean ± SD of three independent biological replicates.
Figure 5. Real-Time RT-PCR analysis of relative CanPOD gene expression levels in leaves of pepper plants after biotic and different abiotic stress treatments. (a) Phytophthora capsici Infection; (b) Cold stress; (c) Salt stress; (d) Drought stress; (e) SA stress and (f) MeJA stress. Error bars represent the mean ± SD of three independent biological replicates.
Ijms 14 03158f5
Figure 6. Schematic representation of the tobacco rattle virus (TRV), pTRV2-CaPDS and pTRV2-CanPOD constructs. LB: left borders of the T-DNA; RB: right borders of the T-DNA; 2 × 35S: two copies of the cauliflower mosaic virus 35S promoter; CP: coat protein; RdRp: RNA-dependent RNA polymerase; MP: movement protein; 16K: 16 KDa protein; R: ribozyme; N: nos-terminator; MCS: multiple cloning sites. (a) TRV vector; (b) pTRV2-CaPDS vector; (c) pTRV2-CanPOD vector.
Figure 6. Schematic representation of the tobacco rattle virus (TRV), pTRV2-CaPDS and pTRV2-CanPOD constructs. LB: left borders of the T-DNA; RB: right borders of the T-DNA; 2 × 35S: two copies of the cauliflower mosaic virus 35S promoter; CP: coat protein; RdRp: RNA-dependent RNA polymerase; MP: movement protein; 16K: 16 KDa protein; R: ribozyme; N: nos-terminator; MCS: multiple cloning sites. (a) TRV vector; (b) pTRV2-CaPDS vector; (c) pTRV2-CanPOD vector.
Ijms 14 03158f6
Figure 7. Eeffect of CanPOD gene silencing on pepper plants. The photographs were taken 35 d after inoculation. (a) Phenotypes of gene silencing pepper plants. Left: control plant (pTRV2-00); Middle: CaPDS-silenced plant (pTRV2-CaPDS); Right: CanPOD-silenced plant (pTRV2-CanPOD). (b) Real-Time RT-PCR analysis of CanPOD expression levels in control (pTRV2-00) and silenced (pTRV2-CanPOD) pepper plants (#1, #2 and #3) 35 d after inoculation. (c) Peroxidase (POD) activities in leaves of the control plant (pTRV2-00) and the silenced (pTRV2-CanPOD) pepper plants (#1, #2 and #3) 35 d after inoculation. Error bars represent the mean ± SD of three independent biological replicates. Letters indicate significant differences using Fisher’s LSD test at p ≤ 0.05.
Figure 7. Eeffect of CanPOD gene silencing on pepper plants. The photographs were taken 35 d after inoculation. (a) Phenotypes of gene silencing pepper plants. Left: control plant (pTRV2-00); Middle: CaPDS-silenced plant (pTRV2-CaPDS); Right: CanPOD-silenced plant (pTRV2-CanPOD). (b) Real-Time RT-PCR analysis of CanPOD expression levels in control (pTRV2-00) and silenced (pTRV2-CanPOD) pepper plants (#1, #2 and #3) 35 d after inoculation. (c) Peroxidase (POD) activities in leaves of the control plant (pTRV2-00) and the silenced (pTRV2-CanPOD) pepper plants (#1, #2 and #3) 35 d after inoculation. Error bars represent the mean ± SD of three independent biological replicates. Letters indicate significant differences using Fisher’s LSD test at p ≤ 0.05.
Ijms 14 03158f7
Figure 8. Disease symptoms in detached-leaves of the control plant (pTRV2-00) and the silenced pepper plant (pTRV2-CanPOD) after inoculation with P. capsici.
Figure 8. Disease symptoms in detached-leaves of the control plant (pTRV2-00) and the silenced pepper plant (pTRV2-CanPOD) after inoculation with P. capsici.
Ijms 14 03158f8
Table 1. Primer sequences used for Real-Time RT-PCR analysis.
Table 1. Primer sequences used for Real-Time RT-PCR analysis.
GenePrimerSequence (5′-3′)
CaUbi3QCaUbi3-FTGTCCATCTGCTCTCTGTTG
QCaUbi3-RCACCCCAAGCACAATAAGAC
CanPODQCanPOD-FCAAGGTTCAATGTGTGTTACC
QCanPOD-RATGATGATACAAATACAGTGCC
F: forward primer; R: reverse primer.

Share and Cite

MDPI and ACS Style

Wang, J.-E.; Liu, K.-K.; Li, D.-W.; Zhang, Y.-L.; Zhao, Q.; He, Y.-M.; Gong, Z.-H. A Novel Peroxidase CanPOD Gene of Pepper Is Involved in Defense Responses to Phytophtora capsici Infection as well as Abiotic Stress Tolerance. Int. J. Mol. Sci. 2013, 14, 3158-3177. https://doi.org/10.3390/ijms14023158

AMA Style

Wang J-E, Liu K-K, Li D-W, Zhang Y-L, Zhao Q, He Y-M, Gong Z-H. A Novel Peroxidase CanPOD Gene of Pepper Is Involved in Defense Responses to Phytophtora capsici Infection as well as Abiotic Stress Tolerance. International Journal of Molecular Sciences. 2013; 14(2):3158-3177. https://doi.org/10.3390/ijms14023158

Chicago/Turabian Style

Wang, Jun-E, Ke-Ke Liu, Da-Wei Li, Ying-Li Zhang, Qian Zhao, Yu-Mei He, and Zhen-Hui Gong. 2013. "A Novel Peroxidase CanPOD Gene of Pepper Is Involved in Defense Responses to Phytophtora capsici Infection as well as Abiotic Stress Tolerance" International Journal of Molecular Sciences 14, no. 2: 3158-3177. https://doi.org/10.3390/ijms14023158

APA Style

Wang, J.-E., Liu, K.-K., Li, D.-W., Zhang, Y.-L., Zhao, Q., He, Y.-M., & Gong, Z.-H. (2013). A Novel Peroxidase CanPOD Gene of Pepper Is Involved in Defense Responses to Phytophtora capsici Infection as well as Abiotic Stress Tolerance. International Journal of Molecular Sciences, 14(2), 3158-3177. https://doi.org/10.3390/ijms14023158

Article Metrics

Back to TopTop