Next Article in Journal
Viruses and Ticks: An Integrative Review of Virological Findings in Ticks
Previous Article in Journal
Omics Description (Metabolome and Microbiome) from Centuroides suffusus and Centuroides vittatus (Arachnida: Scorpiones)
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Rapid and Cost-Effective Differentiation of the Lobsters Homarus americanus, H. gammarus and Their F1 Hybrids Using DNA-Based Methods

1
Centre for Environment, Fisheries, and Aquaculture Science (Cefas), Weymouth DT4 8UB, UK
2
Biosciences, University of Exeter, Prince of Wales Road, Exeter EX4 4PS, UK
*
Author to whom correspondence should be addressed.
Arthropoda 2025, 3(4), 15; https://doi.org/10.3390/arthropoda3040015
Submission received: 24 August 2025 / Revised: 17 October 2025 / Accepted: 14 November 2025 / Published: 20 November 2025

Abstract

The American lobster (Homarus americanus) is a non-native species to Europe, but is imported as live seafood and has been identified in European waters. These introductions threaten native populations of the European lobster (Homarus gammarus) via disease introduction, competition, direct predation, and genetic introgression. Differentiating the two species and their hybrids based solely on morphological criteria can be difficult and unreliable. This study presents a real-time PCR assay targeting the cytochrome c oxidase gene 1 (cox1) for rapid detection and identification of H. americanus and H. gammarus. We have also designed a conventional duplex PCR from a previously described nuclear marker (Hgam98), which was sequenced and revealed the presence of a specific H. americanus insert downstream from a variable number tandem repeat region. The combination of these assays resulted in the accurate identification of the two lobster species and F1 hybrid specimens.

1. Introduction

The international trade and transport of live animals can result in species being introduced accidentally or maliciously to countries outside their native range. When this occurs, they are classified as a non-native species (NNS). If NNS reach the wild non-native range, either intentionally or accidentally, they may establish themselves, become invasive, and negatively impact local biodiversity. Invasive NNS disrupt ecosystems by introducing disease, preying on native species, and outcompeting them for food, territory, and mates [1]. Additionally, the economic burden of managing non-native aquaculture introductions in the UK has risen sharply, with costs increasing by 139.5% annually to GBP 18 million [2], highlighting the growing strain on national resources.
American lobsters (Homarus americanus) are a non-native species to Europe and are imported as live seafood, but they have been detected in the wild. They can carry pathogens such as gaffkaemia [3], which threaten European lobsters (Homarus gammarus); evidence also suggests that H. americanus prey on H. gammarus [4]. Furthermore, there are concerns about interbreeding between H. gammarus and H. americanus, which can result in hybrid offspring [5]. Effective regulations and monitoring are essential to protect local ecosystems from both intentional and accidental invasions [6]. Rapid and accurate methods to identify NNS and trace their origins are urgently needed. These tools would enable the implementation of movement restrictions, eradication measures, and, where appropriate, prosecutions against those endangering native biodiversity.
Previously, identification of H. americanus and H. gammarus has been carried out by morphological criteria such as exoskeleton colouration and presence/absence of the ventral spines on the rostrum. However, it has been demonstrated that identification based solely on morphological criteria can lead to potential misidentification [7,8,9]. Another method of identification is by polymerase chain reaction (PCR) of specific loci, which produces different-sized products [9]. These regions’ sequences are currently not published, and so the reason for the differences is uncertain, potentially limiting the accuracy of their use in speciation. Most recently, there have been advances in single-nucleotide polymorphism (SNP) array analysis [7], which can differentiate between H. gammarus and H. americanus and determine the likelihood of a specimen being a hybrid. However, this method requires specific equipment that not all laboratories have access to and is better suited to definitive analysis of pre-flagged sample batches rather than ad hoc screening and/or small-scale sampling due to cost per sample, with SNP analysis often costing upwards of GBP 20 per individual sample [10], against the real-time PCR cost of around GBP 5 to GBP 10 [10]. Savings can be made with SNPs on large-batch sample analysis; unfortunately, this requires access to several samples, whereas identification often is needed on a single sample on an ad hoc basis.
Here, we outline the process of sequencing the Hgam98 locus, a previously described diagnostic nuclear locus [9], and the cox1 gene for possible primer design locations. Since cox1 is mitochondrial, a cox1-based assay would detect any purebred American lobsters (both male and female). Females of the genus Homarus tend to prefer conspecific [11], and the chances of European females finding only American males in their local environment seem unlikely, whereas American females may find dominant European males. This would mean the likelihood that a hybrid animal would have American mitochondrial DNA. However, it is worth noting that American male parentage is also possible, which would not be detected by this assay. During the design process of this project, two animals were discovered off the coast of Cornwall (50°18′44.1″ N 4°40′09.0″ W), displaying potential H. americanus and H. gammarus mixed morphologies, which were also assessed for hybridisation, highlighting the importance of molecular analysis over morphological identification.

2. Materials and Methods

2.1. Biological Material and DNA Extraction

Tissues of American and European lobsters were collected from adults sourced from their native ranges (Table 1) via the sub-lethal excision of pleopod and/or pereiopod sections [9,12]. Hybrids of the two species were collected as the larval offspring of an American female captured in Sweden and fertilised by a European male, as ascertained by previous research [9]. All samples were preserved in absolute ethanol and stored at −20 °C, prior to DNA being isolated via a modified salting-out protocol [12]. DNA from six individuals from each of these European, American, and hybrid lobster cohorts was obtained (Table 1).
Additionally, pleopod tissues were supplied from two adult lobsters captured in Cornwall, UK, by the Inshore Fisheries and Conservation Authorities (IFCA); these lobsters both exhibited the presence of a sub-rostral ‘tooth’ and reddish coloured spines, traits typically associated with American lobsters, albeit with broader morphologies characteristic of the European lobster.
DNA from these two samples was extracted by taking 0.1 g of tissue in a 1:10 dilution of G2 buffer and proteinase K at 0.2 ug/mL (Qiagen, Hilden, Germany) into a 2 mL lysing matrix A tube (MP biomedicals). The contents of these tubes were then subjected to mechanical disruption using a fast-prep 24 classic (MP biomedicals) at 4 m/s for sixty seconds before incubation overnight at 56 °C. Digests were then subject to extraction with the DNA tissue kit (Qiagen) via an EZ1 Extraction robot (Qiagen), and the nucleic acid was eluted into a 50 µL volume.

2.2. DNA Amplification and Sequencing

To amplify the Hgam98 locus, polymerase chain reaction (PCR) was performed in a 50 µL volume containing 2.5 µL of the DNA elution, 0.5 µL of 25 mM dNTPs, 10 µL of 5× green GoTaq flexi buffer, 5 µL of 25 mM MgCl2, 0.25 µL of GoTaq G2 Flexi DNA Polymerase (Promega, Madison, WI, USA), 0.5 µL of forward and reverse Hgam98 primers at 10 µM (Table 2) and made up to 50 µL with molecular biology-grade water. The cycling programme had an initial denaturation at 94 °C for five minutes, followed by 35 cycles of 94 °C for one minute, 55 °C for one minute, and 72 °C for one minute, with a final extension of 72 °C for ten minutes. PCR products were resolved on 3% agarose gel (w/v) agarose/TAE (40 mM Tris-acetate, pH 7.2, 1 mM EDTA) containing 1.0 µg/mL ethidium bromide, at 120 V for thirty minutes. Products of the expected size were excised, and the DNA purified using spin modules (MP Biomedicals, Irvine, CA, USA). Both strands of the DNA were sequenced in-house by Sanger sequencing, using Big Dye Terminator 3.1 methodology (Life Technologies, Carlsbad, CA, USA) following the manufacturer’s recommended protocol. The sequences were analysed on a 3500xl genetic analyser (Applied Biosystems, Foster City, CA, USA) and consensus sequences were generated using CLC Workbench (version 24.0) software (Qiagen, Hilden, Germany). Contigs were then aligned and compared using MEGA (version 7) software [13].

2.3. Duplex Conventional PCRs

Using the sequencing data from the Hgam98, an additional primer (HAMER) was designed from the H. americanus insert (Table 2 and Figure 1), which was combined with the primers of the Hgam98 assay. This PCR was conducted using the same method as above, but with the addition of 0.5 µL of the HAMER F primer.

2.4. Real-Time PCR Design and Application

A real-time PCR assay was developed targeting the Cytochrome c oxidase subunit I gene (cox1) since regions of this gene can be used to identify H. americanus and H. gammarus. The primer pair COX1_H_SP_F/R (Table 2) was designed to amplify a 90 bp fragment of cox1. Primers and probes were designed in silico by aligning sequences obtained from the Blastn search engine (Basic Local Alignment Search Tool [14]). The real-time assays were performed in a 20 µL duplex reaction volume containing 2.5 µL of DNA template extracted from American and European lobster samples, 10 µL of TaqMan universal master mix (Life Technologies, Carlsbad, CA, USA), 1 µL of each primer and probe, and made up to 20 µL with molecular-grade water. Assays were performed on a Quantstudio 3 thermocycler (Applied Biosystems Foster City, CA, USA) using cycling settings with an initial hold stage of 95 °C for 10 min, followed by 50 cycles of 95 °C for 15 s and 62 °C for 1 min. Each plate included two negative controls (NEG) to ensure the absence of contamination.

3. Results

3.1. Duplex Conventional PCR

When used in conjunction with the Hgam98 assay, the HAMER primer produced no additional product for H. gammarus samples but did produce PCR products of ~150 bp for H. americanus (Figure 2). When sequenced, these products showed 100% nucleotide sequence similarity to the H. americanus insert. In the hybrids tested, the 152 bp insert was observed, and again, with 100% nucleotide similarity to the H. americanus insert.
The putative hybrids from Cornwall showed only H. gammarus products, and no H. americanus or HAMER products.

3.2. Sequencing the Hgam98 Locus

The Hgam98 PCR products showed the expected size for H. americanus (~440–500 bp) and H. gammarus (~290–330 bp) (Figure 3). The sequencing of six H. americanus and six H. gammarus animals showed a segmental similarity, where H. americanus and H. gammarus share an identical 5′ 211 bp region before diverging into variable nucleotide tandem repeat (VNTR) regions. In H. gammarus samples, the number of repeats remains mostly the same, whereas H. americanus samples showed a greater range of sizes (Table 1). Additionally, H. americanus has a 120 bp insert that is absent from H. gammarus. The two species then reconverge with an identical 40 bp sequence at the 3′ end (Figure 3). In the case of hybrids, alleles with the expected size for H. americanus and H. gammarus were observed in some of the individuals genotyped (lanes 10 and 11). However, for other individuals, very faint or no bands were observed for Hgam98 (lanes 7, 8, and 9), but a clear band with the expected size was observed using the HAMER primer (lanes 7 to 12). With hybrid animals, one allele was a match to the H. americanus (including the insert), and one allele matched H. gammarus minus the insert, with fewer VNTRs.

3.3. Real-Time PCR

The linearity of the assays was checked through the analysis of three replicates of a ten-fold serial dilution of known DNA (108 to 10 copies of template). The regression coefficient (R2) and slope for the H. americanus assay were 0.999 and –3.376, respectively. For the H. gammarus assay, the R2 and slope were 0.999 and –3.327, respectively (Figure S1). These results indicate that, within the range of DNA amounts tested, the assays gave reliable results, and both assays could detect positives at 10 copies with Ct values of 34.7 for H. americanus and 33.7 for H. gammarus.
The potential hybrid material from Cornwall produced only positives with the H. gammarus probe (Figure S2). These animals were then subjected to the SNP analysis [9] to confirm results as part of the validation, formally identifying these animals as native European lobsters (H. gammarus).

4. Discussion

The results obtained have explained the product size differences between H. americanus and H. gammarus when using the HGAM98 PCR assay. This aids in the justification of its use but highlights limitations, as fewer repeats could be misread as a H. gammarus positive. The further development of the HAMER duplex protocol helps identify not only NNS American lobsters, but potentially also H. americanus × H. gammarus F1 hybrids. Additionally, the results also suggest that the real-time PCR assay can accurately detect H. americanus mitochondrial DNA (mtDNA). Since the assay could detect DNA at 10 copies and the detection of the hybrid material was positive for H. americanus, it highlights the potential to detect American maternal F1 hybrid animals rapidly and more cost-effectively on an ad hoc sample basis. Additionally, whilst the assay is designed as a duplex reaction to simultaneously detect H. americanus and H. gammarus, it can also be applied in a single-plex format as a presence/absence assay to further reduce costs.
In the case of the lobsters of mixed morphology captured off the coast of Cornwall, all tests identified the individuals as being H. gammarus, a determination confirmed by the SNP-based method of Ellis et al. [9] (data not presented). This highlights the importance of having additional reliable molecular methods of species determination, since morphological traits are unreliable and can show signatures of mixture that cannot be attributed to hybridisation, and SNP-based methods may be too expensive for some authorities to set up if only sporadic testing is likely.
During this experiment, it was discovered that the salting-out [12] incurred PCR inhibitors [15], which were mitigated by diluting each sample 1:10 with molecular biology-grade water. It is also worth noting that sequence data for hybrids is extremely limited due to their rare occurrence. In this study, all six hybrid animals were full siblings that were hatchery-produced. This means there is the possibility that this range of methods may not detect certain types of hybrids, such as H. gammarus (female) × H. americanus (male), or any potential F2 or backcrossed hybrids. However, it is hoped that the methods outlined in this study will not only improve the efficiency and practicality of monitoring for non-native H. americanus but also aid in the detection of hybridisation amongst wild lobster stocks. The HAMER duplex protocol adequately detected the hybrid siblings we tested, and the real-time PCR assay for cox1 could provide rapid flagging of hybrids with H. americanus maternity, even if they displayed European morphologies. These molecular resources can enhance the toolkit available to monitor the presence of H. americanus, H. gammarus, and F1 hybrids in regions where they might have been introduced, offering rapid and cheap screening compatible with bulk sample processing or routine monitoring.

5. Conclusions

In summary, the assays developed in this study provide a rapid and cost-effective means of differentiating Homarus americanus, H. gammarus, and their potential F1 hybrids. The introduction of the HAMER assay enables fast identification of H. americanus and hybrid individuals, as the 120 bp insert appears to be unique to the H. americanus lineage. When multiplexed with the Hgam98 assay, the combined approach improves accuracy by reducing the uncertainty associated with variable VNTR regions, which can otherwise lead to false negatives when assessed visually.
As the adoption of real-time qPCR continues to grow, rapidly replacing conventional PCR methods [16], the qPCR assay presented here adds another tool for efficient identification of non-native lobsters. The demonstrated sensitivity of the H. americanus assay suggests potential application to environmental DNA (eDNA) monitoring, enabling early detection of NNS introductions and helping to localise potential invasion sites.
Although this study was limited by the availability of confirmed hybrid specimens, it provides proof of concept for molecular differentiation within Homarus species. Future work, including additional hybrid lineages and eDNA field validation, could further refine the assay and evaluate its effectiveness and reliability for detecting advanced-generation hybrids or backcrossed individuals. The approach outlined here contributes toward the development of reliable, rapid diagnostic tools that can enhance monitoring and management of NNS in European waters.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/arthropoda3040015/s1, Figure S1: Standard curve Real-time plots for Homarus sp.; Figure S2: Real-time results on Homarus sp. samples.

Author Contributions

Conceptualisation, M.E.; methodology, M.E. and C.E.; resources, M.E. and C.E.; writing: original draft preparation, M.E.; writing: review and editing, C.E. and F.B.; supervision, F.B. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Cefas SEEDCORN team, grant number DP3000Z.

Institutional Review Board Statement

This study was reviewed and granted an exemption by the Animal Welfare and Ethical Review Bodies (AWERB). No live animals were handled, and all samples of Homarus americanus and Homarus gammarus were collected post-mortem and therefore, the work did not fall under regulations requiring ethical approval. The study was conducted in accordance with international standards for research integrity and animal welfare (ARRIVE guidelines: https://arriveguidelines.org).

Data Availability Statement

Data is contained within the article or supplementary material. Further inquiries can be directed to the corresponding author.

Acknowledgments

We thank Carly Daniels for supplying samples from the Cornish Inshore Fisheries & Conservation Authority (IFCA).

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
Cox1Cytochrome c Oxidase gene 1
NNSNon-Native Species
PCRPolymerase Chain Reaction
SNPSingle-Nucleotide Polymorphism
IFCAInshore Fisheries and Conservation Authorities
VNTRVariable Nucleotide Tandem Repeat
eDNAEnvironmental DNA

References

  1. Manchester, S.J.; Bullock, J.M. The impacts of non-native species on UK biodiversity and the effectiveness of control. J. Appl. Ecol. 2000, 37, 845–864. [Google Scholar] [CrossRef] [Scilit]
  2. Eschen, R.; Kadzamira, M.; Stutz, S.; Ogunmodede, A.; Djeddour, D.; Shaw, R.; Pratt, C.; Varia, S.; Constantine, K.; Williams, F. An updated assessment of the direct costs of invasive non-native species to the United Kingdom. Biol. Invasions 2023, 25, 3265–3276. [Google Scholar] [CrossRef] [Scilit]
  3. Stewart, J.E. Gaffkemia, the Fatal Infection of Lobsters (Genus Homarus) Caused by Aerococcus viridans (var.) homari: A Review. Mar. Fish. Rev. 1975, 37, 20–24. [Google Scholar]
  4. Øresland, V.; Ulmestrand, M.; Agnalt, A.L.; Oxby, G. Recorded captures of American lobster (Homarus Americanus) in Swedish waters and an observation of predation on the European lobster (Homarus gammarus). Can. J. Fish. Aquat. Sci. 2017, 74, 1503–1506. [Google Scholar] [CrossRef] [Scilit]
  5. Stebbing, P.; Johnson, P.; Delahunty, A.; Clark, P.F.; McCollin, T.; Hale, C.; Clark, S. Reports of american lobsters, Homarus americanus (H. Milne Edwards, 1837), in British waters. BioInvasions Rec. 2012, 1, 17–23. [Google Scholar] [CrossRef] [Scilit]
  6. Mozer, A.; Prost, S. An introduction to illegal wildlife trade and its effects on biodiversity and society. Forensic Sci. Int. Anim. Environ. 2023, 3, 100064. [Google Scholar] [CrossRef] [Scilit]
  7. Ellis, C.D.; Jenkins, T.L.; Svanberg, L.; Eriksson, S.P.; Stevens, J.R. Crossing the pond: Genetic assignment detects lobster hybridisation. Sci. Rep. 2020, 10, 7781. [Google Scholar] [CrossRef] [Scilit]
  8. Jacquet, J.L.; Pauly, D. Trade secrets: Renaming and mislabeling of seafood. Mar. Policy 2008, 32, 309–318. [Google Scholar] [CrossRef] [Scilit]
  9. Jørstad, K.E.; Prodohl, P.A.; Agnalt, A.L.; Hughes, M.; Farestveit, E.; Ferguson, A.F. Comparison of genetic and morphological methods to detect the presence of American lobsters, Homarus americanus H. Milne Edwards, 1837 (Astacidea: Nephropidae) in Norwegian waters. Hydrobiologia 2007, 590, 103–114. [Google Scholar] [CrossRef] [Scilit]
  10. Mariani, S. Validating the Origin of Capture of Fish—Genetic Methodologies; MMO Project No: 1191; Marine Management Organisation: Newcastle upon Tyne, UK, 2019; p. 19. [Google Scholar]
  11. van der Meeren, G.I.; Chandrapavan, A.; Breithaupt, T. Sexual and aggressive interactions in a mixed species group of lobsters Homarus gammarus and H. americanus. Aquat. Biol. 2008, 2, 191–200. [Google Scholar] [CrossRef] [Scilit]
  12. Jenkins, T.L.; Ellis, C.D.; Stevens, J.R.; Jenkins, T.L. SNP discovery in European lobster (Homarus gammarus) using RAD sequencing. Conserv. Genet. Resour. 2019, 11, 253–257. [Google Scholar] [CrossRef] [Scilit]
  13. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef] [PubMed]
  15. Schrader, C.; Schielke, A.; Ellerbroek, L.; Johne, R. PCR inhibitors—Occurrence, properties and removal. J. Appl. Microbiol. 2012, 113, 1014–1026. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Kaltenboeck, B.; Wang, C. Advances in real-time PCR: Application to clinical laboratory diagnostics. Adv. Clin. Chem. 2005, 40, 219–259. [Google Scholar] [PubMed]
Figure 1. A diagram of the amplicon layout, highlighting the cause of the size discrepancies (H. americanus shown with minimum/maximum repeats) and the location of PCR primers.
Figure 1. A diagram of the amplicon layout, highlighting the cause of the size discrepancies (H. americanus shown with minimum/maximum repeats) and the location of PCR primers.
Arthropoda 03 00015 g001
Figure 2. A schematic representation of a gel for the HAMER assay; Green (solid line) denoting the presence of the insert region. Blue (dashed line) denoting the European HGam98 allele. Red (double line) denoting the American HGam98 allele, with arrows to indicate the variability in size for H. gammarus (H.gam), H. americanus (H. ame), and first filial with maternal gammarus and americanus (F1 GA and F1 AG, respectively) hybrids.
Figure 2. A schematic representation of a gel for the HAMER assay; Green (solid line) denoting the presence of the insert region. Blue (dashed line) denoting the European HGam98 allele. Red (double line) denoting the American HGam98 allele, with arrows to indicate the variability in size for H. gammarus (H.gam), H. americanus (H. ame), and first filial with maternal gammarus and americanus (F1 GA and F1 AG, respectively) hybrids.
Arthropoda 03 00015 g002
Figure 3. A gel image showing the results from the Hgam98 duplex assay, flanked by a Promega 100 bp ladder (L). Bands can be seen in the H. americanus section (A), the H. gammarus section (G), and the HAMER98 H. americanus-only product (X). Lanes 1–6 show H. americanus samples, 7–12 show Hybrid samples, 13–18 show H. gammarus samples, 19 and 20 show Cornish IFCA samples, lane 21 shows known H. americanus, lane 22 shows known H. gammarus, and lane 23 is a negative PCR control.
Figure 3. A gel image showing the results from the Hgam98 duplex assay, flanked by a Promega 100 bp ladder (L). Bands can be seen in the H. americanus section (A), the H. gammarus section (G), and the HAMER98 H. americanus-only product (X). Lanes 1–6 show H. americanus samples, 7–12 show Hybrid samples, 13–18 show H. gammarus samples, 19 and 20 show Cornish IFCA samples, lane 21 shows known H. americanus, lane 22 shows known H. gammarus, and lane 23 is a negative PCR control.
Arthropoda 03 00015 g003
Table 1. Identities of various lobster samples, their locations of origin, and the number of their smallest variable nucleotide tandem repeat (VNTR) products. Homarus americanus (HAM), hybrid (AxG), and Homarus gammarus GAM supplied by University of Exeter. Suspect samples observed in Cornwall, UK (Corn), supplied by IFCA.
Table 1. Identities of various lobster samples, their locations of origin, and the number of their smallest variable nucleotide tandem repeat (VNTR) products. Homarus americanus (HAM), hybrid (AxG), and Homarus gammarus GAM supplied by University of Exeter. Suspect samples observed in Cornwall, UK (Corn), supplied by IFCA.
IdentificationSpeciesLocationNumber of VNTRs (A[C/T]AG)Accession
Number
HAM1H. americanusBrowns Bank, Massachusetts, USA17PQ106807
HAM2H. americanusCaraquet, New Brunswick, Canada18PQ106808
HAM3H. americanusCoastal New Hampshire, USA5PQ106809
HAM4H. americanusFortune Bay, Newfoundland and Labrador, Canada17PQ106810
HAM5H. americanusMalpeque Bay, Prince Edward Island, Canada26PQ106811
HAM6H. americanusMusquodoboit Harbour, Nova Scotia, Canada26PQ106812
AxG1Hybrid animalLysekil, Sweden15PQ106813
AxG2Hybrid animalLysekil, Sweden15
AxG3Hybrid animalLysekil, Sweden15
AxG4Hybrid animalLysekil, Sweden15
AxG5Hybrid animalLysekil, Sweden15
AxG6Hybrid animalLysekil, Sweden15
GAM1H. gammarusBergen, Norway15PQ106814
GAM2H. gammarusFlodevigen, Norway15
GAM3H. gammarusLysekil, Sweden15PQ106815
GAM4H. gammarusTangiers, Morocco15PQ106816
GAM5H. gammarusTangiers, Morocco15
GAM6H. gammarusTangiers, Morocco15
Corn1UnknownCornwall, UK15N/A
Corn2UnknownCornwall, UK15N/A
Table 2. Primers used in this experiment, their sequences, target species, and their references.
Table 2. Primers used in this experiment, their sequences, target species, and their references.
Primer/Probe NamePrimer SequenceTarget SpeciesReference
Hgam98 F5′-GCCTCCGTCGGGTTTCCTG-3′H. gammarus/H. americanusJørstad et al. 2007 [9] (modified)
Hgam98 R5′-AATATGTCTTTCAATGGCTTCTCC-3′H. gammarus/H. americanusJørstad et al. 2007 [9] (modified)
Hamer F5′-ATAACGAGATAGTGTAGGG-3′H. americanus (Insert)This study
COX1_H_SP_F5′-ACTGGRTGAACTGTCTACCC-3′H. gammarus/H. americanusThis study
COX1_H_SP_R5′-CCAGCYAGATGAAGCGAGAA-3′H. gammarus/H. americanusThis study
COX1_HA_Pr5′-[6FAM]
CTCACGCAGGTGCTTCCGTTGA
[TAM]-3′
H. americanusThis study
COX1_HGam_Pr5′-[HEX] CGCTTCTGTTGATTTAGGAATTTTCTCGCT [TAM]-3′H. gammarusThis study
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Edwards, M.; Ellis, C.; Batista, F. Rapid and Cost-Effective Differentiation of the Lobsters Homarus americanus, H. gammarus and Their F1 Hybrids Using DNA-Based Methods. Arthropoda 2025, 3, 15. https://doi.org/10.3390/arthropoda3040015

AMA Style

Edwards M, Ellis C, Batista F. Rapid and Cost-Effective Differentiation of the Lobsters Homarus americanus, H. gammarus and Their F1 Hybrids Using DNA-Based Methods. Arthropoda. 2025; 3(4):15. https://doi.org/10.3390/arthropoda3040015

Chicago/Turabian Style

Edwards, Matt, Charlie Ellis, and Frederico Batista. 2025. "Rapid and Cost-Effective Differentiation of the Lobsters Homarus americanus, H. gammarus and Their F1 Hybrids Using DNA-Based Methods" Arthropoda 3, no. 4: 15. https://doi.org/10.3390/arthropoda3040015

APA Style

Edwards, M., Ellis, C., & Batista, F. (2025). Rapid and Cost-Effective Differentiation of the Lobsters Homarus americanus, H. gammarus and Their F1 Hybrids Using DNA-Based Methods. Arthropoda, 3(4), 15. https://doi.org/10.3390/arthropoda3040015

Article Metrics

Back to TopTop