Abiotic Stress Upregulates the Expression of Genes Involved in PSV and Autophagy Routes †
Abstract
1. Introduction
2. Experiments
2.1. Biological Material Preparation
2.2. cDNA Preparation
2.3. Quantitative RT-PCR
3. Results
3.1. Expression of A. thaliana Aspartic Proteinases under Stress Conditions
3.2. Expression of Endomembrane System Effectors under Stress Conditions
4. Discussion
4.1. The 3 Typical APs from Arabidopsis thaliana Are Differentially Expressed under Stress
4.2. Genes Involved in the Path to the PSV Are Positively Regulated under Stress
5. Conclusions
Supplementary Materials
Author Contributions
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Mousavi-Derazmahalleh, M.; Bayer, P.E.; Hane, J.K.; Valliyodan, B.; Nguyen, H.T.; Nelson, M.N.; Erskine, W.; Varshney, R.K.; Papa, R.; Edwards, D. Adapting legume crops to climate change using genomic approaches. Plant Cell Environ. 2019, 42, 6–19. [Google Scholar] [CrossRef] [Scilit]
- Kalinowska, K.; Isono, E. All roads lead to the vacuole—Autophagic transport as part of the endomembrane trafficking network in plants. J. Exp. Bot. 2018, 69, 1313–1324. [Google Scholar] [CrossRef] [Scilit]
- Zhu, J.-K. Salt and droght stress signal transduction in plants. Annu. Rev. Plant Biol. 2002, 53, 247–273. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cushman, J.C.; Bohnert, H.J. Genomic approaches to plant stress tolerance. Curr. Opin. Plant Biol. 2000, 3, 117–124. [Google Scholar] [CrossRef] [Scilit]
- Moellering, E.R.; Benning, C. Galactoglycerolipid metabolism under stress: A time for remodeling. Trends Plant Sci. 2011, 16, 98–107. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bassham, D.C.; Laporte, M.; Marty, F.; Moriyasu, Y.; Ohsumi, Y.; Olsen, L.J.; Yoshimoto, K. Autophagy in Development and Stress Responses of Plants. Autophagy 2006, 2, 2–11. [Google Scholar] [CrossRef] [Scilit]
- Chevalier, A.S.; Chaumont, F. Trafficking of Plant Plasma Membrane Aquaporins: Multiple Regulation Levels and Complex Sorting Signals. Plant Cell Physiol. 2015, 56, 819–829. [Google Scholar] [CrossRef] [Scilit]
- Hachez CLaloux, T.; Reinhardt, H.; Cavez, D.; Degand, H.; Grefen, C.; De Rycke, R.; Inzé, D.; Blatt, M.R.; Russinova, E.; Chaumont, F. Arabidopsis SNAREs SYP61 and SYP121 coordinate the trafficking of plasma membrane aquaporin PIP2;7 to modulate the cell membrane water permeability. Plant Cell 2014, 26, 3132–3147. [Google Scholar] [CrossRef] [Scilit]
- Ahmad, I.; Devonshire, J.; Mohamed, R.; Schultze, M.; Maathuis, F.J.M. Overexpression of the potassium channel TPKb in small vacuoles confers osmotic and drought tolerance to rice. New Phytol. 2016, 209, 1040–1048. [Google Scholar] [CrossRef] [Scilit]
- Pereira, C.; Pereira, S.; Satiat-Jeunemaitre, B.; Pissarra, J. Cardosin A contains two vacuolar sorting signals using different vacuolar routes in tobacco epidermal cells. Plant J. 2013, 76, 87–100. [Google Scholar] [CrossRef] [Scilit]
- Jürgens, G.; Pimpl, P. Plant membrane trafficking is coming of age. Semin. Cell Dev. Biol. 2018, 80, 83–84. [Google Scholar] [CrossRef] [Scilit]
- Vieira, V.; Peixoto, B.; Pereira, S.; Pissarra, J.; Pereira, C. N-Linked Glycosylation Modulates. Plants 2019, 8, 312. [Google Scholar] [CrossRef] [Scilit]
- Bryksa, B.C.; Grahame, D.A.; Yada, R.Y. Comparative structure-function characterization of the saposin-like domains from potato, barley, cardoon and Arabidopsis aspartic proteases. Biochim. Biophys. Acta Biomembr. 2017, 1859, 1008–1018. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cheung, L.K.Y.; Dupuis, J.H.; Dee, D.R.; Bryksa, B.C.; Yada, R.Y. Roles of Plant-Specific Inserts in Plant Defense. Trends Plant Sci. 2020, 25, 682–694. [Google Scholar] [CrossRef] [Scilit]
- Mazorra-Manzano, M.A.; Tanaka, T.; Dee, D.R.; Yada, R.Y. Structure-function characterization of the recombinant aspartic proteinase A1 from Arabidopsis thaliana. Phytochemistry 2010, 71, 515–523. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Robinson, D.G.; Ding, Y.; Jiang, L. Unconventional protein secretion in plants: A critical assessment. Protoplasma 2016, 253, 31–43. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pompa, A.; De Marchis, F.; Pallotta, M.T.; Benitez-Alfonso, Y.; Jones, A.; Schipper, K.; Moreau, K.; Žárský, V.; Di Sansebastiano, G.P.; Bellucci, M. Unconventional transport routes of soluble and membrane proteins and their role in developmental biology. Int. J. Mol. Sci. 2017, 18, 703. [Google Scholar] [CrossRef] [Scilit]
- Di Sansebastiano, G.; Barozzi, F.; Piro, G.; Denecke, J.; de Marcos Lousa, C. Trafficking routes to the plant vacuole: Connecting alternative and classical pathways. J. Exp. Bot. 2018, 69, 79–90. [Google Scholar] [CrossRef] [Scilit]
- Wang, W.; Vinocur, B.; Altman, A. Plant responses to drought, salinity and extreme temperatures: Towards genetic engineering for stress tolerance. Planta 2003, 218, 1–14. [Google Scholar] [CrossRef] [Scilit]
- Brzin, J.; Kidrič, M. Proteinases and their inhibitors in plants: Role in normal growth and in response to various stress conditions. Biotechnol. Genet. Eng. Rev. 1996, 13, 421–468. [Google Scholar] [CrossRef] [Scilit]
- Simões, I.; Faro, C. Structure and function of plant aspartic proteinases. Eur. J. Biochem. 2004, 271, 2067–2075. [Google Scholar] [CrossRef] [Scilit]
- Faro, C.; Gal, S. Aspartic Proteinase Content of the Arabidopsis Genome. Curr. Protein Pept. Sci. 2005, 6, 493–500. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Egas CLavoura, N.; Resende, R.; Brito, R.M.; Pires, E.; de Lima, M.C.; Faro, C. The Saposin-like Domain of the Plant Aspartic Proteinase Precursor Is a Potent Inducer of Vesicle Leakage. J. Biol. Chem. 2002, 275, 38190–38196. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Terauchi, K.; Asakura, T.; Ueda, H.; Tamura, T.; Tamura, K.; Matsumoto, I.; Misaka, T.; Hara-Nishimura, I.; Abe, K. Plant-specific insertions in the soybean aspartic proteinases, soyAP1 and soyAP2, perform different functions of vacuolar targeting. J. Plant Physiol. 2006, 163, 856–862. [Google Scholar] [CrossRef] [Scilit]
- Frey, M.E.; D’Ippolito, S.; Pepe, A.; Daleo, G.R.; Guevara, M.G. Transgenic expression of plant-specific insert of potato aspartic proteases (StAP-PSI) confers enhanced resistance to Botrytis cinerea in Arabidopsis thaliana. Phytochemistry 2018, 149, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Chen, X.; Pfeil, J.E.; Gal, S. The three typical aspartic proteinase genes of Arabidopsis thaliana are differentially expressed. Eur. J. Biochem. 2002, 269, 4675–4684. [Google Scholar] [CrossRef] [Scilit]
- Contour-Ansel, D.; Torres-Franklin, M.L.; Zuily-Fodil, Y.; de Carvalho, M.H.C. An aspartic acid protease from common bean is expressed ‘on call’ during water stress and early recovery. J. Plant Physiol. 2010, 167, 1606–1612. [Google Scholar] [CrossRef] [Scilit]
- Guo, R.; Zhao, J.; Wang, X.; Guo, C.; Li, Z.; Wang, Y.; Wang, X. Constitutive expression of a grape aspartic protease gene in transgenic Arabidopsis confers osmotic stress tolerance. Plant Cell. Tissue Organ Cult. 2015, 121, 275–287. [Google Scholar] [CrossRef] [Scilit]
- Jürgens, G. Membrane trafficking in plants. Annu. Rev. Cell Dev. Biol. 2004, 20, 481–504. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Xu, M.; Gao, C.; Zeng, Y.; Cui, Y.; Shen, W.; Jiang, L. The roles of endomembrane trafficking in plant abiotic stress responses. J. Integr. Plant Biol. 2020, 62, 55–69. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shen, Y.; Wang, J.; Ding, Y.; Lo, S.W.; Gouzerh, G.; Neuhaus, J.M.; Jiang, L. The rice RMR1 associates with a distinct prevacuolar compartment for the protein storage vacuole pathway. Mol. Plant 2011, 4, 854–868. [Google Scholar] [CrossRef] [Scilit]
- Xiang, L.; Etxeberria, E.; Van Den Ende, W. Vacuolar protein sorting mechanisms in plants. FEBS J. 2013, 280, 979–993. [Google Scholar] [CrossRef] [Scilit]
- Lee, Y.; Jang, M.; Song, K.; Kang, H.; Lee, M.H.; Lee, D.W.; Zouhar, J.; Rojo, E.; Sohn, E.J.; Hwang, I. Functional identification of sorting receptors involved in trafficking of soluble lytic vacuolar proteins in vegetative cells of Arabidopsis. Plant Physiol. 2013, 161, 121–133. [Google Scholar] [CrossRef] [Scilit]
- Stigliano, E.; Sansebastiano, G.-P.; Neuhaus, J.-M. Contribution of Chitinase A’s C-Terminal Vacuolar Sorting Determinant to the Study of Soluble Protein Compartmentation. Int. J. Mol. Sci. 2014, 15, 11030–11039. [Google Scholar] [CrossRef] [Scilit]
- Di Sansebastiano, G.P.; Faraco, M.; Zouhar, J.; Dalessandro, G. The study of plant SNAREs specificity in vivo. Plant Biosyst. 2009, 143, 621–629. [Google Scholar] [CrossRef] [Scilit]
- Sanmartín, M.; Ordóñez, A.; Sohn, E.J.; Robert, S.; Sánchez-Serrano, J.J.; Surpin, M.A.; Raikhel, N.V.; Rojo, E. Divergent functions of VTI12 and VTI11 in trafficking to storage and lytic vacuoles in Arabidopsis. Proc. Natl. Acad. Sci. USA 2007, 104, 3645–3650. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Surpin, M.; Zheng, H.; Morita, M.T.; Saito, C.; Avila, E.; Blakeslee, J.J.; Bandyopadhyay, A.; Kovaleva, V.; Carter, D.; Murphy, A.; et al. The VTI Family of SNARE Proteins Is Necessary for Plant Viability and Mediates Different Protein Transport Pathways. Plant Cell 2003, 15, 2885–2899. [Google Scholar] [CrossRef] [Scilit]
- Han, S.; Yu, B.; Wang, Y.; Liu, Y. Role of plant autophagy in stress response. Protein Cell 2011, 2, 784–791. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Eisenach, C.; Chen, Z.H.; Grefen, C.; Blatt, M.R. The trafficking protein SYP121 of Arabidopsis connects programmed stomatal closure and K+ channel activity with vegetative growth. Plant J. 2012, 69, 241–251. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Besserer, A.; Burnotte, E.; Bienert, G.P.; Chevalier, A.S.; Errachid, A.; Grefen, C.; Blatt, M.R.; Chaumont, F. Selective regulation of maize plasma membrane aquaporin trafficking and activity by the SNARE SYP121. Plant Cell 2012, 24, 3463–3481. [Google Scholar] [CrossRef] [Scilit]
- Žárský, V.; Sekereš, J.; Kubátová, Z.; Pečenková, T.; Cvrčková, F. Three subfamilies of exocyst EXO70 family subunits in land plants: Early divergence and ongoing functional specialization. J. Exp. Bot. 2020, 71, 49–62. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pečenková, T.; Potocká, A.; Potocký, M.; Ortmannová, J.; Drs, M.; Janková Drdová, E.; Pejchar, P.; Synek, L.; Soukupová, H.; Žárský, V.; et al. Redundant and Diversified Roles Among Selected Arabidopsis thaliana EXO70 Paralogs During Biotic Stress Responses. Front. Plant Sci. 2020, 11, 1–14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gu, X.; Brennan, A.; Wei, W.; Guo, G.; Lindsey, K. Vesicle Transport in Plants: A Revised Phylogeny of SNARE Proteins. Evol. Bioinform. 2020, 16, 1176934320956575. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shirakawa, M.; Ueda, H.; Shimada, T.; Koumoto, Y.; Shimada, T.L.; Kondo, M.; Takahashi, T.; Okuyama, Y.; Nishimura, M.; Hara-Nishimura, I. Arabidopsis Qa-SNARE SYP2 proteins localized to different subcellular regions function redundantly in vacuolar protein sorting and plant development. Plant J. 2010, 64, 924–935. [Google Scholar] [CrossRef] [Scilit] [PubMed]


| Gene | Primer Forward | Primer Reverse |
|---|---|---|
| At1g11910 | GGCATTGAGTCGGTGGTGGACA | TCTCACATGCAGAACACGCAGCA |
| At1g62290 | GGGGATTGAATCGGTGGTGGA | ACATGCAGGACAACCCGCGTCT |
| At4g04460 | TGCAAGGCCGTGGTGGATCA | GCGCAGACTCCAATTTGTGAGCA |
| AtSYP 23 | GCAGCGTGCCCTTCTTGTGG | TCCTTGGGCAGTTGCAGCGTA |
| AtSYP 121 | TCCTCCGATCGAACCAGGACCTC | TTCTCGCCGGTGACGGTGAA |
| AtVAMP723 | CCCGTGGTGTGATATGTGAG | CCACAAACCGAGAGGATGAT |
| AtVTI 12 | GCAATGTCCGTGGAGAGGCTTGA | TGCGCATGAAGGAGGGTTTGG |
| AtBP-80 | GGGAGCGGCGCAGATTCTTG | GCCGGTTTCATTCGCCACCTT |
| AtRMR1 | GCGAGGGAGGCACACCAGGA | TTTCCCCGGCCTTGTGGTGA |
| AtEXO-70 | TCCCCGATGAAACAGGCTCGTC | GCCTCCATGAAAGGGGCGTGT |
| UBC9 | TCACAATTTCCAAGGTGCTGC | TCATCTGGGTTTGGATCCGT |
| SAND-1 | AACTCTATGCAGCATTTGATCCACT | TGATTGCATATCTTTATCGCCATC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Neves, J.; Séneca, A.; Pereira, S.; Pissarra, J.; Pereira, C. Abiotic Stress Upregulates the Expression of Genes Involved in PSV and Autophagy Routes. Biol. Life Sci. Forum 2021, 4, 40. https://doi.org/10.3390/IECPS2020-08695
Neves J, Séneca A, Pereira S, Pissarra J, Pereira C. Abiotic Stress Upregulates the Expression of Genes Involved in PSV and Autophagy Routes. Biology and Life Sciences Forum. 2021; 4(1):40. https://doi.org/10.3390/IECPS2020-08695
Chicago/Turabian StyleNeves, João, Ana Séneca, Susana Pereira, José Pissarra, and Cláudia Pereira. 2021. "Abiotic Stress Upregulates the Expression of Genes Involved in PSV and Autophagy Routes" Biology and Life Sciences Forum 4, no. 1: 40. https://doi.org/10.3390/IECPS2020-08695
APA StyleNeves, J., Séneca, A., Pereira, S., Pissarra, J., & Pereira, C. (2021). Abiotic Stress Upregulates the Expression of Genes Involved in PSV and Autophagy Routes. Biology and Life Sciences Forum, 4(1), 40. https://doi.org/10.3390/IECPS2020-08695

