Limited Experimental Susceptibility of Post-Smolt Atlantic salmon (Salmo salar) to an Emergent Strain of Vibrio Anguillarum Serotype O3

Abstract

Preliminary evidence has showed an emergent serotype O3 (SO3) strain of Vibrio anguillarum to cause mortality in pre-smolt Atlantic salmon (Salmo salar) by injection with >10⁵ colony forming units (cfus). Here, we sought to identify the susceptibility of Atlantic salmon post-smolts to this emergent strain by both injection and cohabitation to better understand transmission risk within cultured salmon and possibly between salmon and Atlantic menhaden (Brevoortia tyrannus), where this strain was identified. We identified that although mortality could be induced with a high-dose (>10⁶ cfus) intraperitoneal injection of the emergent SO3 strain (cumulative mortality of 40%), post-smolt Atlantic salmon were highly refractory to a low dose (<10⁶ cfus; cumulative mortality of 3%) or cohabitation exposure (no mortality). A qPCR assay targeting this strain was developed and analytically validated, revealing the limited presence of bacterial DNA in the spleen of low-dose-injected fish (2/36) and no detections in sampled cohabitants (0/70) across three timepoints during the 27-day challenge. These results suggest that although Atlantic salmon can succumb to high-dose artificial infections with V. anguillarum SO3, the risk of natural transmissibility and susceptibility of Atlantic salmon to this emergent strain is anticipated to be low.

1. Introduction

Vibrio anguillarum is a Gram-negative bacterium of saltwater environments that is pathogenic to many economically important marine finfish, crustaceans and mollusks including Atlantic salmon (Salmo salar) [1,2,3]. In finfish, vibriosis is a potentially lethal disease that involves hemorrhagic septicemia, and outbreaks can lead to high mortality in both cultured and wild populations. In aquaculture, vibriosis has commonly been treated with antibiotics, although antimicrobial resistance is a pressing concern [1,4]. In some instances, it is also preventable through vaccination [5].

There are at least 23 serotypes of V. anguillarum based on the O-antigen repeat component of lipopolysaccharides [6,7]. Serotypes O1 and O2 are responsible for the majority of vibriosis in farmed Atlantic salmon, and there are six licensed vaccines that target these two serotypes globally—three of which are licensed in North America [5]. The other serotypes have been considered less pathogenic with limited reports of outbreaks in salmon apart from occasional pathogenicity reported from serotype O3 [8]. As a result, current licensed vaccination strategies have used inactivated O1 and O2 serotype antigens. The efficacy of these vaccines for mitigating or inhibiting vibriosis caused by other V. anguillarum serotypes, including serotype O3, has not been reported.

Recently, a V. anguillarum serotype O3 (SO3) was isolated during severe morality events in Atlantic menhaden (Brevoortia tyrannus) occurring off the coasts of New York and New Jersey during the winter and spring of 2020 to 2021 [9]. This new V. anguillarum SO3 strain was consistently and routinely recovered from menhaden mortalities at high loads, suggesting a causative or participatory role in the disease event [9]. Further, the emergent V. anguillarum SO3 was demonstrated to be virulent in pre-smolt Atlantic salmon via intraperitoneal injection (i.p.), where doses > 7 × 10⁵ colony forming units (cfus) caused significant morality [9].

Atlantic menhaden are a highly abundant schooling forage fish with a migratory range spanning from Florida, USA, to Nova Scotia, Canada [10]. This range includes the Gulf of Maine and the coastal areas of New Brunswick where there is a significant Atlantic salmon marine aquaculture presence. This creates a potential risk for transmission of the newly identified V. anguillarum SO3 strain from wild menhaden to cultured Atlantic salmon, and the possibility that disease and/or mortality could be incurred in cultured salmon based on current preliminary evidence.

In the present study, our aims were to (i) utilize the previously developed i.p. injection challenge model for this V. anguillarum S03 strain to investigate transmission and virulence potential in post-smolt Atlantic salmon representative of commercial net-pen aquaculture via both injection and cohabitation exposure routes to better define the potential transmission risk in smolted salmon and whether the infection can occur under natural conditions, and (ii) identify if mortality in post-smolt salmon could be induced through cohabitation exposure, and if so, define the current SO1 and SO2 vaccine’s cross-protective efficacy against this new SO3 strain to determine its potential for expanded efficacy.

2. Materials and Methods

2.1. Vibrio Anguillarum Inoculate Preparation

Cryopreserved V. anguillarum SO3 isolate Va-21-5-24b (also known as Va210524B) from menhaden collected from the Navesink River, New Jersey, USA, previously shown to have experimental high-dose pathogenicity in Atlantic salmon [9], was streaked onto tryptic soy agar with 5% sheep blood and 1.5% NaCl (BA; Northeast Laboratory Services) and allowed to grow at 22 ± 1 °C for 24 h. A single colony was transferred to 250 mL of trypticase soy broth + 1.5% NaCl (TSB, Becton Dickinson and Fisher Scientific) and cultured under aerobic conditions for 24 h at 22 ± 1 °C on a magnetic stir plate (Fisher Scientific). When the culture reached an optical density of 2.00 (600 nm wavelength) as determined using an Ultraspec 10 Cell Density Meter (Biochrom), a portion was Gram stained and re-cultured on BA to ensure purity. Ten serial tenfold dilutions were performed in 2.7 mL Dulbecco’s phosphate-buffered saline (PBS) and plated on BA in duplicate and cultured for 24 h at 22 ± 1 °C to determine a viable bacterial concentration. The remaining culture was stored on ice and used within 2–3 h to prepare challenge inoculate to initiate all challenge trials.

2.2. Atlantic Salmon and Rearing Conditions

North American Atlantic salmon (Saint John River strain) of mixed-family origin hatched in February 2022 as part of the U.S. Department of Agriculture Agriculture Research Service’s National Coldwater Marine Aquaculture Center Atlantic salmon breeding program [11] that had been individually tagged with a passive integrated transponder (PIT) were used in this study. These fish were of distinctly different origins than those previously challenged with this bacterial isolate, which came from Iceland [9]. Prior to and during the study period, salmon were fed 2–5 times daily with age-appropriate Bio-Oregon commercial diets in well water-sourced recirculating aquaculture systems between 10 and 13 °C. Six weeks prior to challenge, a portion of fish (n = 115) were anesthetized with tricaine mesylate (MS-222) in buffered freshwater, had their adipose fin clipped, and were vaccinated i.p. with an autogenous V. anguillarum S01/02 whole-cell formalin-killed proprietary vaccine (Kennebec River Biosciences) designed for use in commercial Atlantic salmon production in Maine, USA. Two weeks prior to challenge, all vaccinated (n = 115) and a portion of unvaccinated (n = 320) fish were transported to the University of Maine Cooperative Extension Diagnostic and Research Laboratory—a high-containment BSL-3 facility—and immediately smolted in reverse osmosis filtered well water with Instant Ocean Sea Salt (Instant Ocean Spectrum Brands) to 13 ppt. The study rearing systems consisted of recirculating aquaculture systems (RAS) with three independent identical three-tank systems (75 L per tank), each with a bio-filter and UV disinfection sterilization. Each tank was supplied with 2 L min⁻¹ oxygenated water to maintain 12 °C, oxygen at 10 mg/L and salinity at 13 ppt for the duration of the study. Water quality parameters including the temperature, dissolved oxygen, ammonia and nitrite were documented daily, as were feed observation, fish appearance and mortalities (Supplement 1). Tanks were siphoned daily to remove particulates, and lighting was kept to 12 h light and 12 h dark per 24 h period. At the start of the challenge, the fish’s weight ranged from 36 to 118 g with an average of 68 g per fish.

The animal study protocol for animal holding and vaccination was approved by the National Cold Water Marine Aquaculture Center Institutional Animal Care and Use Committee, January 2023, approval No: 2023-01. The animal study protocol for disease challenge was approved by the University of Maine Office of Research Compliance Institutional Animal Care and Use Committee, protocol number A2023-02-03.

2.3. Experimental Challenge

A cohabitation model using 1/3 i.p. injected shedder and 2/3 naïve cohabitated sentinel fish was used. Each of the three experimental RAS systems (three tanks each) were set up as follows: two challenge tanks housed 36 fish, 18 of which were vaccinated, and 18 of which were unvaccinated (

Table 1. Challenge design. Quantity of individuals within tanks and systems is listed by treatment. Number of fish sampled per timepoint in each instance is listed in parentheses where appropriate. * Unvaccinated fish administered high-dose i.p. injections of V. anguillarum SO3 (Unvax + HD) were stocked at 7 days post challenge (dpc). All other treatment groups were stocked at 0 dpc. RAS = recirculating UV-treated aquaculture system; Unvax = unvaccinated; Vax = vaccinated; LD = low-dose i.p. injected; PBS = phosphate-buffered saline carrier medium-injected; cohab = naïve cohabitant.

RAS	Tank	V. anguillarum SO3 Challenged (Sampled)					Mock-Challenged (Sampled)				Sample Times (dpc)
		Unvax + HD *	Unvax + LD	Vax + LD	Unvax + cohab	Vax + cohab	Unvax + PBS	Vax + PBS	Unvax + cohab	Vax + cohab
1	1	12 (2)	6 (1)	5 (1)	12 (2)	12 (2)					5, 12, and 27
	2	12 (2)	6 (1)	6 (1)	12 (2)	12 (2)
	3						11 (1)		23 (2)
2	4	12 (2)	6 (1)	6 (1)	12 (2)	12 (2)					5, 12, and 27
	5	12 (2)	6 (1)	6 (1)	12 (2)	12 (2)
	6						11 (1)		22 (2)
3	7	12 (2)	6 (1)	6 (1)	12 (2)	12 (2)					5, 12, and 27
	8	12 (2)	6 (1)	6 (1)	12 (2)	12 (2)
	9						11 (1)		21 (2)

). The third tank provided experimental and system control with 32–34 unvaccinated fish. At the start of the challenge, 1/3 of the vaccinated (n = 6 per tank) and 1/3 of the unvaccinated group (n = 6 per tank) were netted and sedated with tricaine mesylate (MS-222) and i.p. challenged with 0.1 mL of 5 × 10⁶ cfus/mL V. anguillarum Va-21-5-24b suspension in PBS targeting 20–95% cumulative mortality based on previous challenge results of pre-smolt Icelandic Atlantic salmon [9]. In the control tanks, the same proportion of fish was injected with a PBS carrier medium. At 7 days post challenge (dpc), no clinical signs of disease were observed in any fish. Based on the results of a previous challenge in which >50% cumulative mortality was observed by day 5 post challenge at a similar inoculation dose [9], it was determined that a higher dose may be needed to initiate systemic infections and facilitate bacterial shedding in study populations. An additional 12 unvaccinated fish were therefore injected at 7 dpc as described above with 0.1 mL of 6 × 10⁷ cfus/mL and introduced to each challenge tank. At 5, 12, and 27 dpc, 3–8 fish per tank per timepoint were lethally sampled from each replicate system: two low-dose-injected fish, two high-dose-injected fish (when present), and four cohabitated fish in treatment tanks, and one mock-injected and two cohabited fish in control tanks (Table 1). Sampled fish were euthanized with a lethal dose of MS-222, and the spleen was aseptically dissected as a representative organ for indicating systemic vibrio infection [12] and frozen at −80° for V. anguillarum re-isolation and molecular screening. Additionally, at minimum, the spleen was collected for V. anguillarum re-isolation and molecular screening from 20% of daily mortalities using methods described below.

2.4. Bacterial Re-Isolation

Frozen spleens were thawed at 22 °C and homogenized in PBS at a ratio of 1:10 (weight/volume) using sterile 5 mm steel beads and TissueLyser II (Qiagen) for 2 min at 25 Hz. A homogenate of 100 μL in 3 serial tenfold dilutions was spread across BA plates and incubated at 22 °C for up to 96 h to obtain cfus.

2.5. Molecular V. anguillarum S03 Detection

Preliminary attempts at using previously designed qPCR assays to detect V. anguillarum SO1/SO2/SO3 by targeting 16sDNA and toxR genes [13] failed to amplify the current SO3 isolate without non-specific amplification, and thus a new qPCR assay was designed. Primers and a TaqMan probe targeting a 180 bp section of the GyrB gene specific to the emergent SO3 isolated [9] were designed using Primer3 software in Geneious Prime (version 2023.0): V03_GyrB_F: TCCTCAACGTGATGGTGGTG; V03_GyrB_R: AGGATCCGGCACTTTCACTG; V03_GyrB_P: FAM-GCTCGTGAAGGTTTAACCGC-IBFQ. An artificial positive control (APC) (Eurofins Genomics, Louisville, KY, USA) containing a 200 bp segment of the GyrB gene was used to perform copy number estimations and identify the analytical sensitivity and quantitative capacity of the assay (Supplementary Table S2). Specifically, a ten-step, two- to tenfold dilution series spanning a dynamic range of 1 to 10⁸ copies was run in eight replicates to establish an analytical limit of detection (LOD; defined here as ≥90% detection with replicates) and limit of quantification (LOQ; defined here as a ≤20% coefficient of variance in copy estimation between replicates).

For detecting V. anguillarum SO3 in fish tissues, DNA was extracted from 30 μL spleen homogenate using MagMAX Pathogen RNA/DNA kit and Kingfisher Apex (Thermo Fisher Scientific, Waltham, MA, USA). qPCR was performed in 10 μL reactions containing 1.5 μL of DNA template, 0.6 μL F and R primers (10 uM), 0.4 μL of the probe (10 uM), 5 μL TaqMan universal PCR master mix (Applied Biosystems), and 1.9 μL water. Cycling conditions involved an initial polymerase activation at 95 °C for 10 min followed by 40 cycles of 95 °C for 15 s, and 60 °C for 1 min on a CFX Opus 96 real-time PCR detection system (Bio-Rad). All samples were run in duplicate and considered negative if both replicates failed to amplify beyond 25 relative fluorescence units (RFUs) in 40 PCR cycles. Samples that produced a quantification cycle (Cq) value in one of the replicates were rerun and considered positive only if both replicates yielded a Cq value in the second run.

2.6. V. anquillarum S-O3-Specific Antibody Detection

At 27 days post challenge, blood was drawn from caudal vein using a 21-gauge needle and 1 mL syringe from a subset of unvaccinated control (n = 13), vaccinated cohabitant (n = 9), and vaccinated low dose challenged fish (n = 5). Blood was allowed to clot for 24 h at 4 °C and centrifuged at 3000× g for 10 min at 4 °C to separate serum which was stored at −80 °C until use. ELISA plates (Greiner high binding) were coated with 100 μL of 1 × 10⁸ cfus/mL of the formalin-killed V. anguillarum Va-21-5-24b in carbonate coating buffer (Thermo Fisher Scientific, CB01100) and incubated at 4 °C overnight. Plates were washed (3×) in PBS supplemented with 0.05% Tween 20, blocked with 3% casein overnight at 4 °C, washed again (3×), and exposed to 100 μL/well fish serum diluted 1/160 with PBS overnight at 4 °C. Plates were washed (3×), then incubated with 100 μL anti-Atlantic salmon IgM monoclonal antibody (Aquatic Diagnostics, Oban, SCT) diluted 1/33 at room temperature for one hour, washed (3×), and incubated with 100 μL of goat anti-mouse IgG HRP (Cayman Chemical, Ann Arbor, MI, USA) diluted 1/2000 in PBS for one hour at room temperature. Plates were washed again (3×), and 100 μL TMB substrate (Thermo Fisher Scientific 34021) was added to each well. Absorption was measured at 652 nm every minute for 1 h using BioTek Synergy H1 plate reader. Serum from each fish was tested in duplicate and the mean absorbance observed without oversaturation in any treatment group (recorded at seven minutes) was used to compare treatment groups by one-way analysis of variance followed by Tukey’s post hoc multiple comparison tests in GraphPad Prism 10.

3. Results

3.1. V. anguillarum SO3 Challenge

Fish challenged i.p. with 0.1 mL of 5 × 10⁶ cfus/mL V. anguillarum Va-21-5-24b (low-dose i.p.) proved highly refractory to disease and systemic infection. The only mortality (an unvaccinated fish) was observed 6 dpc resulting in 3% (1/34) cumulative mortality by the end of the 27-day challenge (Figure 1). Morbidity was not observed during the challenge, nor was gross pathology observed in the internal organs of sampled fish. Bacteria were not re-isolated from the spleen of the single mortality or from any of the lethally sampled fish (n = 35) in this treatment group. However, qPCR detected V. anquillarum DNA within the spleen of the mortality (100 copies/mg;

Table 2. Vibrio anguillarum SO3 DNA detection in spleen of challenge mortalities.

Treatment Group	Cumulative Mortalities	qPCR-Screened	Number Positive	Copies/mg (Mean ± s.d.)
i.p. low	1	1	1	100
i.p. high	29	17	12	2.97 × 105 ± 3.22 × 105

) and in the spleen of one of twelve fish sampled at 5 dpc (18 copies/mg;

Table 3. V. anguillarum SO3 DNA detection in spleen of timepoint-sampled fish. ND = not detected.

Treatment Group	Day Post Challenge	Day Post Injection	qPCR-Screened	Number Positive	Copies/mg (Mean ± s.d.)
i.p. low	5	5	12	1	18
	12	12	11	0	ND
	27	27	12	0	ND
i.p. high	12	5	11	2	1.87 × 104 ± 2.62 × 104
	27	20	12	0	ND
cohabitant	5	5	22	0	ND
	12	12	24	0	ND
	27	27	24	0	ND
control	5	5	9	0	ND
	12	12	9	0	ND
	27	27	18	0	ND

). V. anquillarum DNA was not detected from sampled fish in this group at 12 dpc (n = 11) or at 27 dpc (n = 12) (Table 3).

Fish challenged i.p. with 0.1 mL of 6 × 10⁷ cfus/mL (high-dose i.p.) were highly susceptible to disease and mortality. Mortalities were first observed 2 days post injection (9 dpc). By 7 dpi (14 dpc), the cumulative percent mortality had reached 54%, with cumulative mortality reaching 60% by the end of the challenge (Figure 1). Exophthalmia and eye-associated hemorrhage were common in morbidities/mortalities (15/29), as was yellow ascites and/or internal organ-associated hemorrhaging (8/29). Viable V. anquillarum was definitively cultured from only one of 19 frozen spleens for which re-isolation was attempted; however, V. anguillarum DNA was detected by qPCR in 12 of the 17 spleens screened with a mean detection of 2.7 × 10⁵ copies/mg (range of 9 copies to 3.2 × 10⁶ copies/mg; Table 3).

Fish exposed to V. anguillarum by cohabitation with infected fish appeared completely refractory to disease or systemic infection. No morbidity or mortality was observed in the naïve cohabitants irrespective of vaccination status. Bacteria were also not isolated nor was DNA detected from the spleens of any sampled fish (n = 70) in this treatment group between 5 and 27 dpc.

3.2. V. anquillarum qPCR Detection Assay

The qPCR assay developed in this study readily amplified V. anguillarum Va-21-5-24b from pure culture or in tissues of Atlantic salmon without cross reactivity to Atlantic salmon DNA with or without the presence of the targeted template. The assay had a typical amplification efficiency of 89–90% (slope of −3.60) using either a serial-diluted V. anquillarum culture or an APC with an LOD of 1–5 copies for >90% detection within APC replicates and an LOQ between 100 and 1000 copies at a coefficient of variance < 20% (Figure 2). The assay was attempted using SYRB green chemistry without the TaqMan probe; however, this resulted in non-target amplification under the described conditions as evidenced by melt curve analysis and was not pursued further.

3.3. V. anguillarum SO3-Specific Antibody Detection

An indirect ELISA targeting salmon Ig specific to formalin-killed V.anguillarum SO3 identified that vaccination with an autogenous vaccine of V. anguillarum SO1/O2 antigen followed by cohabitation exposure to V anguillarum SO3 at 27 dpc (~580 degree days post vaccination) had similar SO3-specific antibody absorbance to that of unvaccinated unchallenged control fish (Figure 3). However, fish challenged with 0.1 mL of 5 × 10⁶ cfus/mL V. anguillarum SO3 (low-dose i.p.) had a higher (mean 95% ± 81% CI, p = 0.02) V. anguillarum SO3-specific Ig antibody response than unvaccinated unchallenged control fish and a similarly higher (mean 71% ± 73% CI, p = 0.06) antibody response relative to vaccinated cohabitant fish (Figure 3).

4. Discussion

This study confirmed that high-dose i.p. exposure of the Va-21-5-24b representative isolate for the emergent V. anguillarum SO3 strain obtained from Atlantic menhaden can cause disease and mortality in juvenile Atlantic salmon. Lovy et al. [9] demonstrated that this strain induces high mortality in young pre-smolt salmon with greater than 95% cumulative mortality at 7.2 × 10⁶ cfus by i.p. injection. Comparatively, we observed less virulence in larger post-smolt Atlantic salmon, with only 60% cumulative mortality using an analogous i.p. exposure, possibly indicating a reduced susceptibility to this pathogen with age, although additional factors including host genetics or environmental factors could have also played a role.

Cohabitation exposure resulted in no sign of disease nor evidence of infection in this study. Previous immersion studies have shown that high loads and prolonged environmental exposure to V. anguillarum is often required for inducing disease and mortality in an experimental setting. One challenge in Atlantic salmon using an SO1 and SO2 of V. anguillarum showed that an exposure of 2.5 × 10⁵ cells/mL for 60 min bath resulted in 100% mortality in 72 h, while exposure to the same dose for 30 min resulted in no mortality [14]. Another immersion challenge with V. anguillarum SO1 in young Rainbow trout (Oncorhynchus mykiss L.) showed that the LD₅₀ for this species was 6.9 × 10⁶ cfus/mL via a 30 min immersion exposure [15]. Although we did not measure the V. anguillarum environmental loads shed into the water in this study, U.V. disinfection units in the recirculating systems and/or low shedding by infected fish clearly prevented loading from reaching concentrations that would lead to infection. However, the continuous cohabitation with infected fish indicates that at least 1/3 of the Atlantic salmon population could be infected with the new V. anguillarum SO3 experiencing high morbidity without effective transmission occurring sufficient to generate disease in naïve fish in these culture environments.

Antibody production specific to V. anguillarum S03 was only moderately stimulated in i.p. injected Atlantic salmon and not in cohabitant fish vaccinated with an SO1/O2 antigen prior to exposure. The lack of antibody generation in cohabitant fish further suggests a limited systemic presence of V. anguillarum in these fish or that lymphoid tissues were significantly stimulated to produce antibodies in response to this bacterial insult. The moderate increase in some (but not all) vaccinated fish i.p. injected with the bacteria also suggests that prior vaccination against SO1 and SO2 was not very cross-protective in this instance. Rainbow trout vaccinated with SO1 and boosted at 500 degree days showed significantly higher (fourfold) serum SO1-specific antibodies [15], yet fish in this study “boosted” with 5 × 10⁵ cfus of SO3 were only moderately stimulated (approximately twofold) on average, with some individuals appearing non-responsive. Live attenuations of an SO1 strain have shown strong protection against a diversity of Vibrio bacteria species in other marine fish [16]; however, our study indicates that perhaps the use of this SO3 variant would not be as efficacious, at least at dosages that would not also incur disease.

Spleen tissue was exclusively sampled and screened for V. anguillarum in this study as it has been shown to be one of the first organs to sequester the bacteria in Rainbow trout after i.p. or immersion exposure [12] and can be considered a representative for identifying systemic infection due to its high blood content. Yet surprisingly, live bacteria could only be isolated from 1 out of 23 mortalities tested, despite DNA detection in 13 of 19 mortalities using qPCR. We speculate that the freeze–thaw or homogenization techniques used in this study may have rendered bacteria unviable. Alternatively, the rapid inactivation or killing of bacteria by the spleen may also have contributed to a low detection prevalence in this organ.

While classical culturing methods are most often used for the detection of live cells, culture-independent qPCR offers higher specificity, sensitivity and faster results. There are several published qPCR assays that target V. anguillarum, and before designing a strain-specific assay for this study, we tested two assays published by Crisafi et al. [13] designed to detect SO1, SO2 and SO3. Unfortunately, both performed poorly in this study. Specifically, we consistently observed multiple peaks and/or inconsistency in the melt curve analysis and occasional amplification in the absence of the target template suggestive of cross reactivity with the host. Although the assay previously performed well with sea bass (Dicentrarchus labrax) [13], we identified here that it did not perform well with Atlantic salmon. However, the new assay developed for this study showed no indication for cross reactivity with host Atlantic salmon DNA, had a consistent efficiency of ~90%, high sensitivity (LOD = 1–5 copies), and generally acceptable quantitative accuracy (LOQ = 10²–10³ copies), demonstrating its utility for detecting this pathogen in salmon and possibly other fish species in future. Nevertheless, this assay was designed specifically using the published sequence of this target SO3 isolate [9], and its ability to detect other SO3 or SO1/SO2 isolates is currently unknown. We advise caution and further validation be used in implementing this screening technique to identify other non-target V. anguillarum strains or in screening non-salmonid tissues.

5. Conclusions

The results of this study indicate that in stable experimental recirculating aquaculture environments, the emergent V. anguillarum SO3 isolated from wild diseased menhaden had limited virulence in Atlantic salmon post-smolts by an i.p. injection of <10⁶ cfus or by cohabitation exposure. Although direct menhaden to Atlantic salmon transmission was not assessed in this study, these data suggest that if cultured Atlantic salmon were to become infected from menhaden, the risk of transmission and disease would be low, and they would be unlikely to readily spread infections within the cultured population assuming fish were generally healthy and not otherwise compromised. A limited or undetectable antibody response in injected or cohabitant Atlantic salmon in this study further suggests limited utility for using this strain in vaccine development targeting more virulent O1 or O2 V. anguillarum strains. However, the development of a qPCR assay for the specific detection of the emergent SO3 strain may prove useful in confirming future outbreaks or for identifying its presence within environmental samples pending further validation.