Next Article in Journal
An Observation of the Vitamin D Status in Highly Trained Adolescent Swimmers during the UK Autumn and Winter Months
Previous Article in Journal
Rehabilitation Outcome Measures in Patients with Spinal Stenosis: A Literary Review
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Communication

Gene Expression of Monoterpene Synthases Is Affected Rhythmically during the Day in Lavandula angustifolia Flowers

by
Eleftheria Seira
1,
Stefania Poulaki
1,
Christos Hassiotis
2,
Stylianos Poulios
1 and
Konstantinos E. Vlachonasios
1,3,*
1
Department of Botany, School of Biology, Faculty of Science, Aristotle University of Thessaloniki, 54124 Thessaloniki, Greece
2
Etherio Research, Pure Essential Oils, 50003 Voio, Greece
3
Natural Products Research Centre of Excellence, Center of Interdisciplinary Research and Innovation, Aristotle University of Thessaloniki, 57001 Thessaloniki, Greece
*
Author to whom correspondence should be addressed.
Physiologia 2023, 3(3), 433-441; https://doi.org/10.3390/physiologia3030030
Submission received: 18 July 2023 / Revised: 23 August 2023 / Accepted: 24 August 2023 / Published: 30 August 2023

Abstract

Lavender essential oil (EO) is widely used for medicinal purposes. The significant monoterpenes’ abundance of linalool and linalool acetate accounts for more than 50% of lavender EO compounds. Monoterpenes synthesis differs throughout plant development as a result of the differential gene expression patterns in distinct cell types. Previously, we have reported that the chemical composition of Lavandula angustifolia cv. etherio EO was affected by diurnal harvest time. The aim of this was to evaluate if the gene expression of lavender monoterpenes synthases is altered during the day length and correlated with the accumulation of the major components of lavender EO. The relative expression of linalool synthase (LaLINS), limonene synthase (LaLIMS) and terpene synthase-like (LaTPS-l) was recorded in flowers at the 3rd to 5th stage every 3 h during two consecutive days using quantitative real-time PCR. The composition of the lavender EO was also monitored during the day length using GC-MS analysis. Our results indicate that the expression of genes involved in the synthesis of lavender EO, including linalool and limonene synthases, is accompanied by oscillations, picking at mid-day and leading to linalool acetate accumulation in the afternoon. In conclusion, the monoterpenes synthase expression in lavender flowers is rhythmically affected during the day, leading to a higher accumulation of EO compounds in the afternoon. These results will be helpful to monitor the biosynthesis of lavender EO to ensure a high-quality product. Furthermore, the outcome of this study will be useful for breeding programs in the lavender field to modulate the biosynthesis of linalool and linalool acetate during the flowering harvest period.

Graphical Abstract

1. Introduction

Lavandula angustifolia Mill. belongs to the Lamiaceae family, well known as true lavender. They are economically important plants because of the properties of the essential oil (EO) extracted from their flowers [1]. The Lavender EO has wide applications in perfumes, cosmetics, colognes, skin lotions and other cosmetics [2]. Furthermore, it is used in aromatherapy as a relaxant [3,4] and in food manufacturing [5]. Finally, the lavender EO therapeutic effects, such as antiviral and antibacterial activities, antioxidant, sedative, relaxant and several gastrointestinal nervous and rheumatic disorders, have been reported [6,7,8,9].
The EO of lavender is synthesized and accumulated in the secretory oil glands located in abundance on the surface of the calyx and, to a smaller amount, on the leaves [10]. The EO of most Lavandula species comprises 50–60 monoterpenes and sesquiterpenes. The abundance of two terpenes, linalool and linalool acetate, are the two primary compounds, followed by camphor and eucalyptol (1,8-cineole), which often reduce the oil quality. These terpenes occur widely in plant species, performing essential ecological functions, including deterring herbivores, repelling insects and repressing the growth of competing plants [11,12,13].
Monoterpenes are derived from geranyl diphosphate (GPP) by the activity of various terpene synthases [14]. Some monoterpenes, like camphor and linalool acetate, are further modified through acetylation, oxidation or reduction reactions. The product of linalool acetyltransferase enzymatic reaction is linalool acetate [15]. The monoterpene synthases initially form cationic intermediates, such as geranyl, linalyl diphosphate, linalyl cation and the α-terpinyl cation (Figure 1). Then, several cyclizations are formed in the intermediate products until a stable component is produced. For example, α-terpinyl cation forms all cyclic monoterpenes, such as limonene. Linalool, β-myrcene, geraniol and ocimene are derived from geranyl and linalyl cations [9,14].
Several genomic and transcriptomics resources for L. angustifolia were developed to investigate the regulation of EO production in leaves and flowers [16,17,18,19,20]. Finally, the first chromosome-level genome assembly of L. angustifolia was recently reported [21]. Environmental and developmental conditions affected Lavender oil production during the flowering period [22]. Linalool quantity, a primary compound of lavender oil, was influenced by temperature, flower development and linalool synthase gene expression [22]. As a result, the expression of LaLINS correlated with linalool concentration during flowering development, suggesting that linalool production in lavender flowers is regulated at the transcriptional level. Linalool production is also affected by diurnal harvest time [23].
In this study, we report that the expression of genes involved in lavender EO, including linalool and limonene synthases, is accompanied by oscillations, picking at mid-day and leading to linalool and linalool acetate accumulation in the afternoon.

2. Results and Discussion

2.1. Gene Expression of Monoterpenes Synthases Displays a Circadian Rhythm Pattern

Monoterpenes and other volatile organic compounds (VOCs) synthesis differ throughout plant development as a result of the differential gene expression patterns in distinct cell types [24]. Most likely, genes involved in the synthesis of VOCs are transcriptionally activated, which coincides with the VOC emission [25]. We showed that linalool production is accumulated in the afternoon [26]. Therefore, we ask if lavender monoterpenes synthase gene expression is altered during the day.
Precisely, the relative expression of LaLINS, LaLIMS and LaTPS-l were monitored in the blooming heads of the inflorescence that contain flowers at the 3rd to 5th stage as determined by [26], every 3 h during two consecutive days using quantitative RT-PCR. The results showed that all three genes tested were expressed rhythmically. Remarkably, the highest gene expression was observed from mid-day until 15:00 (Figure 2). Specifically, the expression of LaLINS increased 3-fold at mid-day and continued at a high level for the next three hours, followed by a rapid decline in the evening (Figure 2a). The next day, the gene expression profile was similar. Likewise, the limonene synthase gene expression was increased significantly, from late morning to a maximum at 15:00 (Figure 2b). On the second day, the accumulation of LaLIMS transcripts showed a similar profile, albeit at a lower level (Figure 2b).
Similarly, the expression of LaTPS-l displayed a rhythmic pattern (Figure 2c). Although the biological role of LaTPS-l is unknown [27], its transcript was expressed in stages 2 and 3 of the lavender flowers [22]. In this study, the expression of LaTPS-l is increased during mid-day, reaching a maximum at 15:00. On the second day, the expression pattern was similar, albeit at a higher level with a maximum on mid-day (Figure 2c). These data indicate that the transcription of monoterpenes synthases in lavender flowers was affected by circadian rhythms.

2.2. The Lavender EO Composition Is Affected by Harvest Time

The chemical composition of Lavandula angustifolia cv Etherio EO was reported to be affected by diurnal harvest time [23]. We repeated the same analysis in this study to ensure that EO pattern in the current study follows a similar pattern. Thirty-six compounds were identified by GC-MS analysis (Table 1). Specifically, more than 70% of the EO compounds consisted of linalool and its acetate, followed by smaller amounts of borneol and camphor (Table 1). At 9:00 in the morning, more alcohols, hydrocarbons, ketones and ethers were observed (Table 1). In midday, afternoon and evening, higher esters were observed while alcohols were reduced. The amount of linalool acetate was higher in the 18:00 sample. Furthermore, the total amount of linalool and linalool acetate was also higher in the afternoon compared to the morning EO, 75.85 vs. 73.94. This effect is more pronounced by the accumulation of linalool acetate in the afternoon (Figure 3a). Several minor EO components, such as lavandulyl acetate and β-catryophyllene, are also accumulated in the afternoon (Figure 3b). In contrast, the amount of camphor and 1,8 cineole is decreased during the day (Figure 3b). These results suggest that specific lavender volatile compounds emission is increased in the afternoon.
Therefore, our results suggest that the transcripts of monoterpene synthases are accumulated earlier than the EO compounds. The lavender EO is regulated by the time of release, light and temperature variables, and developmental factors [1,22,28]. The release of floral scent at a specific time of the day attracts effective pollinators and avoids predators’ attraction, indicating an evolutionary benefit to maximize resource efficiency [29,30]. The emission of linalool from Lilium and orchid flowers also follows diurnal cycles [31,32]. The VOC biosynthetic genes can be temporally regulated by clock genes encoding transcription factors (TF) [33]. For example, the rhythmic emission of linalool in orchids is controlled by circadian clock genes like CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) through direct regulation of terpene synthases [34]. The morning component LATE ELONGATED HYPOCOTYL (LHY) controls the daily expression of many VOC biosynthetic genes and specific transcription factors, such as ODORANT1 in petunia, by restricting their expression in the evening [35]. Although several TF, including members of MYB and bZIP families, activate gene expression of monoterpene synthases in lavenders [36], our knowledge of the circadian clock regulation of TFs in lavender is limited.

3. Materials and Methods

3.1. Plant Material and EO Extraction

In this study, A 10-year-old cultivated field with Lavender plants (genotype, Lavandula angustifolia cv. Etherio) was used and analyzed. The genotype described by [37] is located at Kato Scholari, Greece and is owned by the company Etherio (Eratera, Kozani, Greece). The EO chemical composition was evaluated on 22 July 2021 when fully blooming plants were harvested. The samplings were made at 9:00, 12:00, 15:00 and 18:00, as described by [23]. Three random samples were taken per treatment. The ambient temperature during the day was 24 °C in the morning, 29 °C at noon, 35 °C at 15:00 and 32 °C at 18:00. A Clevenger water steam distillation apparatus was used to extract lavender EO. Approximately 500 g of freshly collected flowers without inflorescence stalks (only the blooming heads, approximately 4 cm long) were weighed and put into the top flask. The distillations protocol was: duration: 1.50 h, steam flow: 0.8 L min−1, distillatory pressure: free flow, steam temperature: 110 °C.

3.2. EO Analysis

GC-MS analyzed the composition of the volatile constituents by using a Shimadzu GC-2010–GCMS-QP2010 system operating in EI mode (70 eV) equipped with a split/splitless injector (230 °C), a split ratio 1/30, using a fused silica HP-5 MS capillary column (30 m × 0.25 mm (i.d.), film thickness: 0.25 μm). The temperature program ranged from 50 °C (5 min) to 290 °C at a rate of 4 °C min−1. Helium was used as a carrier gas at a flow rate of 1.0 mL min−1. The injection volume of each sample was 1 μL. N-alkanes were used as standards to determine retention indices for all compounds according to the [38]. The components were identified by comparing their mass spectra with those of NIST21 and NIST107 [39] and those described by [40], as well as by comparison of their retention indices with literature data [41,42]. Pure commercial oil components were acquired from the Sigma–Aldrich Co. (St. Louis, MO, USA).

3.3. RNA Isolation and Gene Expression Analysis

Lavender blooming heads of the inflorescences containing flowers of stages 3 to 5, according to [26], from five randomly chosen different plants (Figure 4) were collected every 3 h, starting from 6:00 on the first day and finishing at 18:00 on the second day. The tissues were immediately frozen with liquid N2 and stored at −80 °C. Total RNA was extracted using the NucleoSpin RNA Mini kit for RNA purification (Macherey Nagel, Nuren, Germany) and E.Z.N.A.® Plant RNA Kit (Omega Biotek, Norcross, GA, USA). The RNA was treated with 0.1 mg of Dnase I for reverse transcription assay using the PrimeScriptTM 1st strand cDNA Synthesis Kit (TaKaRa, Shiga, Japan) to a final volume of 20 μL. Each sample was then diluted two times. Real-time PCR analyses were conducted in 10 μL reaction volume using KAPATM SYBR® Green FAST qPCR Kit MasterMix (Kapa Biosystems, Cape Town, South Africa) and the ABI StepOneTM platform (Applied Biosystems, Foster City, CA, USA). In each reaction, 2 μL of cDNA was used. Gene-specific primers (Table 2) were used for the relative expression levels of the specific mRNAs. The Ct values from the genes were normalized to the reference gene Elongation factor 1-a (Ef1-a) values according to the delta–delta cycle threshold (ΔΔCt) method [43]. Statistical analyses were performed using one-way Analysis of Variance (ANOVA) and followed by Fishers Least Significant Difference (LSD) using GraphPad 8.0.1 (Software, San Diego, CA, USA, www.graphpad.com, accessed on 22 November 2022).

4. Conclusions

Our results indicate that the monoterpenes synthases expression in lavender flowers is rhythmically affected during the day leading to an accumulation of EO compound in the afternoon. These results will enhance other knowledge towards the optimum lavender harvest time to ensure high-quality lavender EO. This result will enhance the progress of lavender VOCs for biotechnological applications, including food, health, industrial products and the perfume industry. For instance, regulating VOC biosynthesis will result in various metabolic engineering implications. Transgenes could be turned on or off by specific transcription factors or chromatin modifiers to facilitate the optimum regulatory circuits to produce high-level specialized metabolites.

Author Contributions

Conceptualization, K.E.V. and C.H.; methodology, E.S., S.P. (Stefania Poulaki) and S.P. (Stylianos Poulios); validation K.E.V. and C.H.; formal analysis, K.E.V. and E.S.; investigation, E.S., S.P. (Stefania Poulaki) and S.P. (Stylianos Poulios); resources, C.H.; data curation, E.S., S.P. (Stefania Poulaki) and S.P. (Stylianos Poulios); writing—original draft preparation K.E.V. and C.H.; writing—review and editing, K.E.V. and C.H.; visualization, K.E.V.; supervision, K.E.V. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding. The types of equipment used in this study were obtained by the project “Upgrading the plant capital” (MIS 5002803), which is implemented under the Action “Reinforcement of the Research and Innovation Infrastructure”, funded by the Operational Programme “Competitiveness, Entrepreneurship and Innovation” (NSRF 2014–2020) and co-financed by Greece and the European Union (European Regional Development Fund).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data supporting this study’s findings are available from the corresponding author upon reasonable request.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Jullien, F.; Fontez, M.; Bony, A.; Nicole, F.; Moja, S. Lavandula angustifolia Mill. a model of aromatic and medicinal plant to study volatile organic compounds synthesis, evolution and ecological functions. Bot. Let. 2023, 170, 65–76. [Google Scholar] [CrossRef]
  2. Paul, J.P.; Brophy, J.J.; Goldsack, R.J.; Fontaniella, B. Analysis of volatile components of Lavandula canariensis (L.) Mill., a Canary Islands endemic species, growing in Australia. Biochem. Syst. Ecol. 2004, 32, 55–62. [Google Scholar] [CrossRef]
  3. Lis-Balchin, M.; Hart, S. Studies on the mode of action of the essential oil of lavender (Lavandula angustifolia P. Miller). Phytother. Res. 1999, 13, 540–542. [Google Scholar] [CrossRef]
  4. Soltani, R.; Soheilipour, S.; Hajhashemi, V.; Asghari, G.; Bagheri, M.; Molavi, M. Evaluation of the effect of aromatherapy with lavender essential oil on post-tonsillectomy pain in pediatric patients: A randomized controlled trial. Inter. J. Pediatr. Otorhinolaryngol. 2013, 77, 1579–1581. [Google Scholar] [CrossRef] [PubMed]
  5. Kim, N.S.; Lee, D.S. Comparison of different extraction methods for the analysis of fragrances from Lavandula species by gas chromatography–mass spectrometry. J. Chromatogr. A 2002, 982, 31–47. [Google Scholar] [CrossRef] [PubMed]
  6. Cavanagh, H.M.; Wilkinson, J.M. Biological activities of lavender essential oil. Phytother. Res. 2002, 16, 301–308. [Google Scholar] [CrossRef] [PubMed]
  7. Kashani, M.S.; Tavirani, M.R.; Talaei, S.A.; Salami, M. Aqueous extract of lavender (Lavandula angustifolia) improves the spatial performance of a rat model of Alzheimer’s disease. Neurosci. Bull. 2011, 27, 99–106. [Google Scholar] [CrossRef]
  8. Sienkiewicz, M.; Lysakowska, M.; Ciecwierz, J.; Denys, P.; Kowalczyk, E. Antibacterial activity of thyme and lavender essential oils. Med. Chem. 2011, 7, 674–689. [Google Scholar] [CrossRef] [PubMed]
  9. Wells, R.; Truong, F.; Adal, A.M.; Sarker, L.S.; Mahmoud, S.S. Lavandula essential oils: A current review of applications in medicinal, food, and cosmetic industries of lavender. Nat. Prod. Commun. 2018, 13, 1934578x1801301. [Google Scholar] [CrossRef]
  10. Jullien, F.; Moja, S.; Bony, A.; Legrand, S.; Petit, C.; Benabdelkader, T.; Poirot, K.; Fiorucci, S.; Guitton, Y.; Nicolè, F.; et al. Isolation and functional characterization of a-cadinol synthase, a new sesquiterpene synthase from Lavandula angustifolia. Plant Mol. Biol. 2014, 84, 227–241. [Google Scholar] [CrossRef]
  11. Franks, S.J.; Wheeler, G.S.; Goodnight, C. Genetic variation and evolution of secondary compounds in native and introduced populations of the invasive plant Melaleuca qunquenervia. Evolution 2012, 66, 1398–1412. [Google Scholar] [CrossRef] [PubMed]
  12. Gershenzone, J.; Croteau, R. Herbivores: Their interactions with secondary plant metabolites. In Terpenoids: The Chemical Participants; Rosenthal, G.A., Berenbaum, M., Eds.; Academic Press: San Diego, CA, USA, 1991; pp. 165–219. [Google Scholar]
  13. Southwell, I.A.; Russell, M.F.; Maddox, C.D.A.; Wheeler, G.S. Differential metabolism of 1,8-cineole in insects. J. Chem. Ecol. 2003, 29, 83–94. [Google Scholar] [CrossRef] [PubMed]
  14. Degenhardt, J.; Köllner, T.G.; Gershenzon, J. Monoterpene and sesquiterpene synthases and the origin of terpene skeletal diversity in plants. Phytochemistry 2009, 70, 1621–1637. [Google Scholar] [CrossRef] [PubMed]
  15. Zaks, A.; Davidovich-Rikanati, R.; Bar, E.; Inbar, M.; Lewinsohn, E. Biosynthesis of linalyl acetate and other terpenes in lemon mint (Mentha aquatica var. citrata, Lamiaceae) glandular trichomes. Israel J. Plant Sci. 2008, 56, 233–244. [Google Scholar] [CrossRef]
  16. Fopa Fomeju, B.; Brunel, D.; Bérard, A.; Rivoal, J.-B.; Gallois, P.; Le Paslier, M.-C.; Bouverat-Bernier, J.-P. Quick and effi-cient approach to develop genomic resources in orphan species: Application in Lavandula angustifolia. PLoS ONE 2020, 15, e0243853. [Google Scholar] [CrossRef] [PubMed]
  17. Guo, D.; Kang, K.; Wang, P.; Li, M.; Huang, X. Transcriptome profiling of spike provides expression features of genes related to terpene biosynthesis in lavender. Sci. Rep. 2020, 10, 6933. [Google Scholar] [CrossRef]
  18. Lane, A.; Boecklemann, A.; Woronuk, G.N.; Sarker, L.; Mahmoud, S.S. A genomics resource for investigating regulation of essential oil production in Lavandula angustifolia. Planta 2010, 231, 835–845. [Google Scholar] [CrossRef]
  19. Li, H.; Li, J.; Dong, Y.; Hao, H.; Ling, Z.; Bai, H.; Wang, H.; Cui, H.; Shi, L. Time-series transcriptome provides insights into the gene regulation network involved in the volatile terpenoid metabolism during the flower development of lavender. BMC Plant Biol. 2019, 19, 313. [Google Scholar] [CrossRef]
  20. Malli, R.P.N.; Adal, A.M.; Sarker, L.S.; Liang, P.; Mahmoud, S.S. De novo sequencing of the Lavandula angustifolia genome reveals highly duplicated and optimized features for essential oil production. Planta 2019, 249, 251–256. [Google Scholar] [CrossRef]
  21. Li, J.; Wang, Y.; Dong, Y.; Zhang, W.; Wang, D.; Bai, H.; Li, K.; Li, H.; Shi, L. The chromosome-based lavender genome provides new insights into Lamiaceae evolution and terpenoid biosynthesis. Hortic. Res. 2021, 8, 53. [Google Scholar] [CrossRef]
  22. Hassiotis, C.N.; Ntana, F.; Lazari, D.M.; Poulios, S.; Vlachonasios, K.E. Environmental and developmental factors affect essential oil production and quality of Lavandula angustifolia during flowering period. Ind. Crops Prod. 2014, 62, 359–366. [Google Scholar] [CrossRef]
  23. Hassiotis, C.N.; Lazari, D.M.; Vlachonasios, K.E. The effects of habitat type and diurnal harvest on essential oil yield and composition of Lavandula angustifolia mill. Fresen. Environ. Bull. 2010, 19, 1491–1498. [Google Scholar]
  24. Picazo-Aragonés, J.; Terrab, A.; Balao, F. Plant volatile organic compounds evolution: Transcriptional regulation, epigenetics and polyploidy. Inter. J. Mol. Sci. 2020, 21, 8956. [Google Scholar] [CrossRef] [PubMed]
  25. Colquhoun, T.A.; Verdonk, J.C.; Schimmel, B.C.; Tieman, D.M.; Underwood, B.A.; Clark, D.G. Petunia floral volatile benzenoid/phenylpropanoid genes are regulated in a similar manner. Phytochemistry 2010, 71, 158–167. [Google Scholar] [CrossRef] [PubMed]
  26. Guitton, Y.; Nicolè, F.; Moja, S.; Valot, N.; Legrand, S.; Jullien, F.; Legendre, L. Differential accumulation of volatile terpene and terpene synthase mRNAs during lavender (Lavandula angustifolia and L. × intermedia) inflorescence development. Physiol. Plant. 2010, 138, 150–163. [Google Scholar] [CrossRef] [PubMed]
  27. Demissie, Z.A.; Sarker, L.S.; Mahmoud, S.S. Cloning and functional characterization of β-phellandrene synthase from Lavandula angustifolia. Planta 2011, 233, 685–696. [Google Scholar] [CrossRef]
  28. Mostafa, S.; Wang, Y.; Zeng, W.; Jin, B. Floral Scents and Fruit Aromas: Functions, Compositions, Biosynthesis, and Regulation. Front. Plant Sci. 2022, 13, 860157. [Google Scholar] [CrossRef]
  29. Fenske, M.P.; Imaizumi, T. Circadian rhythms in floral scent emission. Front. Plant Sci. 2016, 7, 462. [Google Scholar] [CrossRef]
  30. Zeng, L.; Wang, X.; Kang, M.; Dong, F.; Yang, Z. Regulation of the rhythmic emission of plant volatiles by the circadian clock. Inter. J. Mol. Sci. 2017, 18, 2408. [Google Scholar] [CrossRef]
  31. Chuang, Y.C.; Lee, M.C.; Chang, Y.L.; Chen, W.H.; Chen, H.H. Diurnal regulation of the floral scent emission by light and circadian rhythm in the Phalaenopsis orchids. Bot. Stud. 2017, 58, 50. [Google Scholar] [CrossRef]
  32. Abbas, F.; Ke, Y.; Yu, R.; Fan, Y. Functional characterization and expression analysis of two terpene synthases involved in foral scent formation in Lilium ‘Siberia’. Planta 2019, 249, 71–93. [Google Scholar] [CrossRef] [PubMed]
  33. Dudareva, N.; Klempien, A.; Muhlemann, J.K.; Kaplan, I. Biosynthesis, function and metabolic engineering of plant volatile organic compounds. New Phytol. 2013, 198, 16–32. [Google Scholar] [CrossRef]
  34. Yeh, C.-W.; Zhong, H.-Q.; Ho, Y.-F.; Tian, Z.-H.; Yeh, K.-W. The diurnal emission of foral scent in Oncidium hybrid orchid is controlled by CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) through the direct regulation on terpene synthase. BMC Plant Biol. 2022, 22, 472. [Google Scholar] [CrossRef] [PubMed]
  35. Fenske, M.P.; Hazelton, K.D.H.; Hempton, A.K.; Shim, J.S.; Yamamoto, B.M.; Riffell, J.A.; Imaizumi, T. Circadian clock gene LATE ELONGATED HYPOCOTYL directly regulates the timing of floral scent emission in Petunia. Proc. Natl. Acad. Sci. USA 2015, 112, 9775–9780. [Google Scholar] [CrossRef] [PubMed]
  36. Sarker, L.S.; Adal, A.M.; Mahmoud, S.S. Diverse transcription factors control monoterpene synthase expression in lavender (Lavandula). Planta 2020, 251, 5. [Google Scholar] [CrossRef] [PubMed]
  37. Hassiotis, C.N.; Tarantilis, P.A.; Daferera, D.; Polissiou, M.G. Etherio, a new variety of Lavandula angustifolia with improved essential oil production and composition from natural selected genotypes growing in Greece. Ind. Crops Prod. 2010, 32, 77–82. [Google Scholar] [CrossRef]
  38. Van den Dool, H.; Kratz, P.D. A generalization of the retention index system including linear temperature programmed gas-liquid partition chromatography. J. Chromatogr. 1963, 11, 463–471. [Google Scholar] [CrossRef]
  39. Massada, Y. Analysis of Essential Oil by Gas Chromatography and Spectrometry; John Wiley & Sons: New York, NY, USA, 1976. [Google Scholar]
  40. Adams, R.P. Identification of Essential Oils Components by Gas Chromatography/Quadrupole Mass Spectroscopy; Allured Publishing Corporation: Carol Stream, IL, USA, 2007. [Google Scholar]
  41. Bisio, A.; Ciarallo, G.; Romussi, G.; Fontana, N.; Mascolo, N.; Capasso, R.; Biscardi, D. Chemical composition of essential oils from some Salvia species. Phytother. Res. 1998, 12, 117–120. [Google Scholar] [CrossRef]
  42. Davies, N.N. Gas chromatographic retention indices of monoterpenes and sesquiterpenes on methyl silicone and Carbowax 20 M phases. J. Chromatogr. 1990, 503, 1–24. [Google Scholar] [CrossRef]
  43. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Figure 1. Monoterpenes biosynthesis in lavender. The reaction mechanisms of monoterpene synthases initiate with the geranyl diphosphate substrate ionization and terminate by deprotonation or water capture. Limonene synthase catalyzes a-terpinyl to limonene using deprotonation, while linalool synthase, capturing a water molecule, catalyzes geranyl or linalyl cation to linalool.
Figure 1. Monoterpenes biosynthesis in lavender. The reaction mechanisms of monoterpene synthases initiate with the geranyl diphosphate substrate ionization and terminate by deprotonation or water capture. Limonene synthase catalyzes a-terpinyl to limonene using deprotonation, while linalool synthase, capturing a water molecule, catalyzes geranyl or linalyl cation to linalool.
Physiologia 03 00030 g001
Figure 2. Gene expression of (a) Lilanool synthase (LaLINS), (b) Limonene synthase (LaLIMS) and (c) Terpene synthase-like (LaTPS-l) in Lavandula angustifolia flowers during the day length. Error bars are presented as SEM of three replications. The values that are significantly different from the first day’s 6:00 sample are indicated with asterisks (* p < 0.05, *** p < 0.001, **** p < 0.0001).
Figure 2. Gene expression of (a) Lilanool synthase (LaLINS), (b) Limonene synthase (LaLIMS) and (c) Terpene synthase-like (LaTPS-l) in Lavandula angustifolia flowers during the day length. Error bars are presented as SEM of three replications. The values that are significantly different from the first day’s 6:00 sample are indicated with asterisks (* p < 0.05, *** p < 0.001, **** p < 0.0001).
Physiologia 03 00030 g002
Figure 3. The percentage of (a) Linalool and linalool acetate, (b) 1,8 Cineol, Camphor, Borneol, Lavandulyl acetate and β-Caryophyllene in Lavender EO during the day length. Error bars are presented as SEM of three replications. The values that are significantly different from the first day’s 9:00 sample are indicated with asterisks (* p < 0.05, ** p < 0.01, *** p < 0.001).
Figure 3. The percentage of (a) Linalool and linalool acetate, (b) 1,8 Cineol, Camphor, Borneol, Lavandulyl acetate and β-Caryophyllene in Lavender EO during the day length. Error bars are presented as SEM of three replications. The values that are significantly different from the first day’s 9:00 sample are indicated with asterisks (* p < 0.05, ** p < 0.01, *** p < 0.001).
Physiologia 03 00030 g003
Figure 4. L. angustifolia cv. Etherio flower stage for RNA extraction.
Figure 4. L. angustifolia cv. Etherio flower stage for RNA extraction.
Physiologia 03 00030 g004
Table 1. Chemical composition of Lavandula angustifolia cv. Etherio EO according to time samplings.
Table 1. Chemical composition of Lavandula angustifolia cv. Etherio EO according to time samplings.
Compounds 1RI.Compound Concentration (Percentage in Total EO.)Identification 2
9:0012:0015:0018:00
3-Octanone9880.48±0.010.47±0.040.41±0.040.10±0.00I, MS
β-Myrcene9910.94±0.001.13±0.121.21±0.021.13±0.05I, MS
Hexyl acetate10160.79±0.080.64±0.070.58±0.010.25±0.01I, MS
Limonene10280.53±0.010.74±0.010.53±0.020.30±0.01I, MS
1,8-Cineol10291.94±0.031.75±0.001.18±0.130.46±0.02I, MS
cis-Ocimene10391.18±0.040.99±0.100.96±0.020.44±0.04I, MS
trans-Ocimene10491.84±0.161.50±0.031.35±0.050.73±0.08I, MS
Terpinolene10870.15±0.000.15±0.000.13±0.000.07±0.01I, MS
Linalool110033.02±1.3832.48±1.3632.51±0.6729.05±0.58I, MS
1-Octen-3-ol acetate11140.30±0.030.23±0.020.22±0.010.13±0.01I, MS
3-Octanol acetate11260.17±0.010.11±0.010.12±0.000.07±0.01I, MS
Camphor11433.79±0.353.30±0.073.31±0.062.65±0.05I, MS
Hexyl isobutanoate11510.22±0.020.16±0.000.16±0.020.14±0.00I, MS
Borneol11652.75±0.302.80±0.312.87±0.352.73±0.28I, MS
Menthol11720.19±0.010.25±0.010.32±0.030.28±0.01I, MS
Terpinen-4-ol1176tr tr tr tr I, MS
Cryptone11870.14±0.010.13±0.010.08±0.000.07±0.00I, MS
α-Terpineol11900.77±0.081.02±0.040.64±0.010.70±0.03I, MS
Hexyl butanoate11930.92±0.040.94±0.041.04±0.041.05±0.04I, MS
Dodecane12000.09±0.010.12±0.010.14±0.010.11±0.00I, MS
Octyl acetate1213tr tr tr tr I, MS
Hexyl 2-methyl butanoate12380.15±0.010.12±0.010.15±0.010.14±0.01I, MS
Hexyl isovalerate12430.11±0.010.14±0.000.14±0.010.15±0.02I, MS
Linalyl acetate125740.92±3.9341.50±0.0043.00±0.8346.80±0.95I, MS
Bornyl acetate12880.08±0.010.09±0.010.10±0.010.10±0.00I, MS
Lavandulyl acetate12921.59±0.071.80±0.192.04±0.192.37±0.00I, MS
Tridecane1300- tr 0.11±0.01tr I, MS
Hexyl tiglate13320.33±0.030.32±0.010.34±0.030.39±0.01I, MS
Neryl acetate13660.43±0.080.38±0.030.39±0.020.48±0.01I, MS
Geranyl acetate13850.95±0.100.96±0.100.91±0.091.13±0.05I, MS
7-epi-Sesquithujene13910.06±0.000.09±0.010.08±0.010.11±0.01I, MS
β-Caryophyllene14211.12±0.121.32±0.031.48±0.141.95±0.04I, MS, Co-GC
trans-β-Farnesene14580.64±0.050.66±0.000.68±0.071.14±0.11I, MS
Germacrene D14830.30±0.030.34±0.040.37±0.030.56±0.01I, MS
Lavandulyl isovalerate15110.21±0.010.24±0.000.29±0.030.42±0.01I, MS
α-Bisabolol16870.52±0.050.74±0.010.74±0.020.92±0.03I, MS
Total 97.62 97.72 98.57 97.20
Alcohols 37.30 37.30 37.08 33.67
Esters 47.20 47.63 49.48 53.62
Ethers 1.94 1.75 1.18 0.46
Hydrocarbons 6.85 7.14 7.03 6.63
Ketones 4.42 3.90 3.80 2.83
1 Compounds listed in order of elution from an HP-5MS column. 2 Identification method: I = retention index, MS = mass spectrum, Co-GC = co-injection with authentic compound. Concentrations below 0.01% are marked as -; those between 0.01 and 0.05 as tr (traces).
Table 2. Gene-specific oligonucleotide sequences used for gene expression analysis.
Table 2. Gene-specific oligonucleotide sequences used for gene expression analysis.
KB494F: CCCTTCTTGAGGCTCTTGACEF1-a [26]
KB495R: GCACAGTTCCAATACCACC
KB479F: ACACGCACGACAATTTGCCALINS [27]
KB480R: AGCCCTCCAATGAAGTGGGAT
KB481F: GCGCCACACAACTAGAAATTAAGTLIMS [26]
KB482R: TTGCACAGTCAGCTCAGCG
KB477F: ACTACACTGGAGGGTGCAAAGATPS-1 [27]
KB478R: AATCTGGAACTCGCATTTGGCG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Seira, E.; Poulaki, S.; Hassiotis, C.; Poulios, S.; Vlachonasios, K.E. Gene Expression of Monoterpene Synthases Is Affected Rhythmically during the Day in Lavandula angustifolia Flowers. Physiologia 2023, 3, 433-441. https://doi.org/10.3390/physiologia3030030

AMA Style

Seira E, Poulaki S, Hassiotis C, Poulios S, Vlachonasios KE. Gene Expression of Monoterpene Synthases Is Affected Rhythmically during the Day in Lavandula angustifolia Flowers. Physiologia. 2023; 3(3):433-441. https://doi.org/10.3390/physiologia3030030

Chicago/Turabian Style

Seira, Eleftheria, Stefania Poulaki, Christos Hassiotis, Stylianos Poulios, and Konstantinos E. Vlachonasios. 2023. "Gene Expression of Monoterpene Synthases Is Affected Rhythmically during the Day in Lavandula angustifolia Flowers" Physiologia 3, no. 3: 433-441. https://doi.org/10.3390/physiologia3030030

APA Style

Seira, E., Poulaki, S., Hassiotis, C., Poulios, S., & Vlachonasios, K. E. (2023). Gene Expression of Monoterpene Synthases Is Affected Rhythmically during the Day in Lavandula angustifolia Flowers. Physiologia, 3(3), 433-441. https://doi.org/10.3390/physiologia3030030

Article Metrics

Back to TopTop