Gene Expression of Monoterpene Synthases Is Affected Rhythmically during the Day in Lavandula angustifolia Flowers

Abstract

Lavender essential oil (EO) is widely used for medicinal purposes. The significant monoterpenes’ abundance of linalool and linalool acetate accounts for more than 50% of lavender EO compounds. Monoterpenes synthesis differs throughout plant development as a result of the differential gene expression patterns in distinct cell types. Previously, we have reported that the chemical composition of Lavandula angustifolia cv. etherio EO was affected by diurnal harvest time. The aim of this was to evaluate if the gene expression of lavender monoterpenes synthases is altered during the day length and correlated with the accumulation of the major components of lavender EO. The relative expression of linalool synthase (LaLINS), limonene synthase (LaLIMS) and terpene synthase-like (LaTPS-l) was recorded in flowers at the 3rd to 5th stage every 3 h during two consecutive days using quantitative real-time PCR. The composition of the lavender EO was also monitored during the day length using GC-MS analysis. Our results indicate that the expression of genes involved in the synthesis of lavender EO, including linalool and limonene synthases, is accompanied by oscillations, picking at mid-day and leading to linalool acetate accumulation in the afternoon. In conclusion, the monoterpenes synthase expression in lavender flowers is rhythmically affected during the day, leading to a higher accumulation of EO compounds in the afternoon. These results will be helpful to monitor the biosynthesis of lavender EO to ensure a high-quality product. Furthermore, the outcome of this study will be useful for breeding programs in the lavender field to modulate the biosynthesis of linalool and linalool acetate during the flowering harvest period.

1. Introduction

Lavandula angustifolia Mill. belongs to the Lamiaceae family, well known as true lavender. They are economically important plants because of the properties of the essential oil (EO) extracted from their flowers [1]. The Lavender EO has wide applications in perfumes, cosmetics, colognes, skin lotions and other cosmetics [2]. Furthermore, it is used in aromatherapy as a relaxant [3,4] and in food manufacturing [5]. Finally, the lavender EO therapeutic effects, such as antiviral and antibacterial activities, antioxidant, sedative, relaxant and several gastrointestinal nervous and rheumatic disorders, have been reported [6,7,8,9].

The EO of lavender is synthesized and accumulated in the secretory oil glands located in abundance on the surface of the calyx and, to a smaller amount, on the leaves [10]. The EO of most Lavandula species comprises 50–60 monoterpenes and sesquiterpenes. The abundance of two terpenes, linalool and linalool acetate, are the two primary compounds, followed by camphor and eucalyptol (1,8-cineole), which often reduce the oil quality. These terpenes occur widely in plant species, performing essential ecological functions, including deterring herbivores, repelling insects and repressing the growth of competing plants [11,12,13].

Monoterpenes are derived from geranyl diphosphate (GPP) by the activity of various terpene synthases [14]. Some monoterpenes, like camphor and linalool acetate, are further modified through acetylation, oxidation or reduction reactions. The product of linalool acetyltransferase enzymatic reaction is linalool acetate [15]. The monoterpene synthases initially form cationic intermediates, such as geranyl, linalyl diphosphate, linalyl cation and the α-terpinyl cation (Figure 1). Then, several cyclizations are formed in the intermediate products until a stable component is produced. For example, α-terpinyl cation forms all cyclic monoterpenes, such as limonene. Linalool, β-myrcene, geraniol and ocimene are derived from geranyl and linalyl cations [9,14].

Several genomic and transcriptomics resources for L. angustifolia were developed to investigate the regulation of EO production in leaves and flowers [16,17,18,19,20]. Finally, the first chromosome-level genome assembly of L. angustifolia was recently reported [21]. Environmental and developmental conditions affected Lavender oil production during the flowering period [22]. Linalool quantity, a primary compound of lavender oil, was influenced by temperature, flower development and linalool synthase gene expression [22]. As a result, the expression of LaLINS correlated with linalool concentration during flowering development, suggesting that linalool production in lavender flowers is regulated at the transcriptional level. Linalool production is also affected by diurnal harvest time [23].

In this study, we report that the expression of genes involved in lavender EO, including linalool and limonene synthases, is accompanied by oscillations, picking at mid-day and leading to linalool and linalool acetate accumulation in the afternoon.

2. Results and Discussion

2.1. Gene Expression of Monoterpenes Synthases Displays a Circadian Rhythm Pattern

Monoterpenes and other volatile organic compounds (VOCs) synthesis differ throughout plant development as a result of the differential gene expression patterns in distinct cell types [24]. Most likely, genes involved in the synthesis of VOCs are transcriptionally activated, which coincides with the VOC emission [25]. We showed that linalool production is accumulated in the afternoon [26]. Therefore, we ask if lavender monoterpenes synthase gene expression is altered during the day.

Precisely, the relative expression of LaLINS, LaLIMS and LaTPS-l were monitored in the blooming heads of the inflorescence that contain flowers at the 3rd to 5th stage as determined by [26], every 3 h during two consecutive days using quantitative RT-PCR. The results showed that all three genes tested were expressed rhythmically. Remarkably, the highest gene expression was observed from mid-day until 15:00 (Figure 2). Specifically, the expression of LaLINS increased 3-fold at mid-day and continued at a high level for the next three hours, followed by a rapid decline in the evening (Figure 2a). The next day, the gene expression profile was similar. Likewise, the limonene synthase gene expression was increased significantly, from late morning to a maximum at 15:00 (Figure 2b). On the second day, the accumulation of LaLIMS transcripts showed a similar profile, albeit at a lower level (Figure 2b).

Similarly, the expression of LaTPS-l displayed a rhythmic pattern (Figure 2c). Although the biological role of LaTPS-l is unknown [27], its transcript was expressed in stages 2 and 3 of the lavender flowers [22]. In this study, the expression of LaTPS-l is increased during mid-day, reaching a maximum at 15:00. On the second day, the expression pattern was similar, albeit at a higher level with a maximum on mid-day (Figure 2c). These data indicate that the transcription of monoterpenes synthases in lavender flowers was affected by circadian rhythms.

2.2. The Lavender EO Composition Is Affected by Harvest Time

The chemical composition of Lavandula angustifolia cv Etherio EO was reported to be affected by diurnal harvest time [23]. We repeated the same analysis in this study to ensure that EO pattern in the current study follows a similar pattern. Thirty-six compounds were identified by GC-MS analysis (

Table 1. Chemical composition of Lavandula angustifolia cv. Etherio EO according to time samplings.

Compounds 1	RI.	Compound Concentration (Percentage in Total EO.)								Identification 2
		9:00		12:00		15:00		18:00
3-Octanone	988	0.48	±0.01	0.47	±0.04	0.41	±0.04	0.10	±0.00	I, MS
β-Myrcene	991	0.94	±0.00	1.13	±0.12	1.21	±0.02	1.13	±0.05	I, MS
Hexyl acetate	1016	0.79	±0.08	0.64	±0.07	0.58	±0.01	0.25	±0.01	I, MS
Limonene	1028	0.53	±0.01	0.74	±0.01	0.53	±0.02	0.30	±0.01	I, MS
1,8-Cineol	1029	1.94	±0.03	1.75	±0.00	1.18	±0.13	0.46	±0.02	I, MS
cis-Ocimene	1039	1.18	±0.04	0.99	±0.10	0.96	±0.02	0.44	±0.04	I, MS
trans-Ocimene	1049	1.84	±0.16	1.50	±0.03	1.35	±0.05	0.73	±0.08	I, MS
Terpinolene	1087	0.15	±0.00	0.15	±0.00	0.13	±0.00	0.07	±0.01	I, MS
Linalool	1100	33.02	±1.38	32.48	±1.36	32.51	±0.67	29.05	±0.58	I, MS
1-Octen-3-ol acetate	1114	0.30	±0.03	0.23	±0.02	0.22	±0.01	0.13	±0.01	I, MS
3-Octanol acetate	1126	0.17	±0.01	0.11	±0.01	0.12	±0.00	0.07	±0.01	I, MS
Camphor	1143	3.79	±0.35	3.30	±0.07	3.31	±0.06	2.65	±0.05	I, MS
Hexyl isobutanoate	1151	0.22	±0.02	0.16	±0.00	0.16	±0.02	0.14	±0.00	I, MS
Borneol	1165	2.75	±0.30	2.80	±0.31	2.87	±0.35	2.73	±0.28	I, MS
Menthol	1172	0.19	±0.01	0.25	±0.01	0.32	±0.03	0.28	±0.01	I, MS
Terpinen-4-ol	1176	tr		tr		tr		tr		I, MS
Cryptone	1187	0.14	±0.01	0.13	±0.01	0.08	±0.00	0.07	±0.00	I, MS
α-Terpineol	1190	0.77	±0.08	1.02	±0.04	0.64	±0.01	0.70	±0.03	I, MS
Hexyl butanoate	1193	0.92	±0.04	0.94	±0.04	1.04	±0.04	1.05	±0.04	I, MS
Dodecane	1200	0.09	±0.01	0.12	±0.01	0.14	±0.01	0.11	±0.00	I, MS
Octyl acetate	1213	tr		tr		tr		tr		I, MS
Hexyl 2-methyl butanoate	1238	0.15	±0.01	0.12	±0.01	0.15	±0.01	0.14	±0.01	I, MS
Hexyl isovalerate	1243	0.11	±0.01	0.14	±0.00	0.14	±0.01	0.15	±0.02	I, MS
Linalyl acetate	1257	40.92	±3.93	41.50	±0.00	43.00	±0.83	46.80	±0.95	I, MS
Bornyl acetate	1288	0.08	±0.01	0.09	±0.01	0.10	±0.01	0.10	±0.00	I, MS
Lavandulyl acetate	1292	1.59	±0.07	1.80	±0.19	2.04	±0.19	2.37	±0.00	I, MS
Tridecane	1300	-		tr		0.11	±0.01	tr		I, MS
Hexyl tiglate	1332	0.33	±0.03	0.32	±0.01	0.34	±0.03	0.39	±0.01	I, MS
Neryl acetate	1366	0.43	±0.08	0.38	±0.03	0.39	±0.02	0.48	±0.01	I, MS
Geranyl acetate	1385	0.95	±0.10	0.96	±0.10	0.91	±0.09	1.13	±0.05	I, MS
7-epi-Sesquithujene	1391	0.06	±0.00	0.09	±0.01	0.08	±0.01	0.11	±0.01	I, MS
β-Caryophyllene	1421	1.12	±0.12	1.32	±0.03	1.48	±0.14	1.95	±0.04	I, MS, Co-GC
trans-β-Farnesene	1458	0.64	±0.05	0.66	±0.00	0.68	±0.07	1.14	±0.11	I, MS
Germacrene D	1483	0.30	±0.03	0.34	±0.04	0.37	±0.03	0.56	±0.01	I, MS
Lavandulyl isovalerate	1511	0.21	±0.01	0.24	±0.00	0.29	±0.03	0.42	±0.01	I, MS
α-Bisabolol	1687	0.52	±0.05	0.74	±0.01	0.74	±0.02	0.92	±0.03	I, MS
Total		97.62		97.72		98.57		97.20
Alcohols		37.30		37.30		37.08		33.67
Esters		47.20		47.63		49.48		53.62
Ethers		1.94		1.75		1.18		0.46
Hydrocarbons		6.85		7.14		7.03		6.63
Ketones		4.42		3.90		3.80		2.83

¹ Compounds listed in order of elution from an HP-5MS column. ² Identification method: I = retention index, MS = mass spectrum, Co-GC = co-injection with authentic compound. Concentrations below 0.01% are marked as -; those between 0.01 and 0.05 as tr (traces).

). Specifically, more than 70% of the EO compounds consisted of linalool and its acetate, followed by smaller amounts of borneol and camphor (Table 1). At 9:00 in the morning, more alcohols, hydrocarbons, ketones and ethers were observed (Table 1). In midday, afternoon and evening, higher esters were observed while alcohols were reduced. The amount of linalool acetate was higher in the 18:00 sample. Furthermore, the total amount of linalool and linalool acetate was also higher in the afternoon compared to the morning EO, 75.85 vs. 73.94. This effect is more pronounced by the accumulation of linalool acetate in the afternoon (Figure 3a). Several minor EO components, such as lavandulyl acetate and β-catryophyllene, are also accumulated in the afternoon (Figure 3b). In contrast, the amount of camphor and 1,8 cineole is decreased during the day (Figure 3b). These results suggest that specific lavender volatile compounds emission is increased in the afternoon.

Therefore, our results suggest that the transcripts of monoterpene synthases are accumulated earlier than the EO compounds. The lavender EO is regulated by the time of release, light and temperature variables, and developmental factors [1,22,28]. The release of floral scent at a specific time of the day attracts effective pollinators and avoids predators’ attraction, indicating an evolutionary benefit to maximize resource efficiency [29,30]. The emission of linalool from Lilium and orchid flowers also follows diurnal cycles [31,32]. The VOC biosynthetic genes can be temporally regulated by clock genes encoding transcription factors (TF) [33]. For example, the rhythmic emission of linalool in orchids is controlled by circadian clock genes like CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) through direct regulation of terpene synthases [34]. The morning component LATE ELONGATED HYPOCOTYL (LHY) controls the daily expression of many VOC biosynthetic genes and specific transcription factors, such as ODORANT1 in petunia, by restricting their expression in the evening [35]. Although several TF, including members of MYB and bZIP families, activate gene expression of monoterpene synthases in lavenders [36], our knowledge of the circadian clock regulation of TFs in lavender is limited.

3. Materials and Methods

3.1. Plant Material and EO Extraction

In this study, A 10-year-old cultivated field with Lavender plants (genotype, Lavandula angustifolia cv. Etherio) was used and analyzed. The genotype described by [37] is located at Kato Scholari, Greece and is owned by the company Etherio (Eratera, Kozani, Greece). The EO chemical composition was evaluated on 22 July 2021 when fully blooming plants were harvested. The samplings were made at 9:00, 12:00, 15:00 and 18:00, as described by [23]. Three random samples were taken per treatment. The ambient temperature during the day was 24 °C in the morning, 29 °C at noon, 35 °C at 15:00 and 32 °C at 18:00. A Clevenger water steam distillation apparatus was used to extract lavender EO. Approximately 500 g of freshly collected flowers without inflorescence stalks (only the blooming heads, approximately 4 cm long) were weighed and put into the top flask. The distillations protocol was: duration: 1.50 h, steam flow: 0.8 L min⁻¹, distillatory pressure: free flow, steam temperature: 110 °C.

3.2. EO Analysis

GC-MS analyzed the composition of the volatile constituents by using a Shimadzu GC-2010–GCMS-QP2010 system operating in EI mode (70 eV) equipped with a split/splitless injector (230 °C), a split ratio 1/30, using a fused silica HP-5 MS capillary column (30 m × 0.25 mm (i.d.), film thickness: 0.25 μm). The temperature program ranged from 50 °C (5 min) to 290 °C at a rate of 4 °C min⁻¹. Helium was used as a carrier gas at a flow rate of 1.0 mL min⁻¹. The injection volume of each sample was 1 μL. N-alkanes were used as standards to determine retention indices for all compounds according to the [38]. The components were identified by comparing their mass spectra with those of NIST21 and NIST107 [39] and those described by [40], as well as by comparison of their retention indices with literature data [41,42]. Pure commercial oil components were acquired from the Sigma–Aldrich Co. (St. Louis, MO, USA).

3.3. RNA Isolation and Gene Expression Analysis

Lavender blooming heads of the inflorescences containing flowers of stages 3 to 5, according to [26], from five randomly chosen different plants (Figure 4) were collected every 3 h, starting from 6:00 on the first day and finishing at 18:00 on the second day. The tissues were immediately frozen with liquid N₂ and stored at −80 °C. Total RNA was extracted using the NucleoSpin RNA Mini kit for RNA purification (Macherey Nagel, Nuren, Germany) and E.Z.N.A.^® Plant RNA Kit (Omega Biotek, Norcross, GA, USA). The RNA was treated with 0.1 mg of Dnase I for reverse transcription assay using the PrimeScript^TM 1st strand cDNA Synthesis Kit (TaKaRa, Shiga, Japan) to a final volume of 20 μL. Each sample was then diluted two times. Real-time PCR analyses were conducted in 10 μL reaction volume using KAPA^TM SYBR^® Green FAST qPCR Kit MasterMix (Kapa Biosystems, Cape Town, South Africa) and the ABI StepOne^TM platform (Applied Biosystems, Foster City, CA, USA). In each reaction, 2 μL of cDNA was used. Gene-specific primers (

Table 2. Gene-specific oligonucleotide sequences used for gene expression analysis.

KB494	F: CCCTTCTTGAGGCTCTTGAC	EF1-a [26]
KB495	R: GCACAGTTCCAATACCACC
KB479	F: ACACGCACGACAATTTGCCA	LINS [27]
KB480	R: AGCCCTCCAATGAAGTGGGAT
KB481	F: GCGCCACACAACTAGAAATTAAGT	LIMS [26]
KB482	R: TTGCACAGTCAGCTCAGCG
KB477	F: ACTACACTGGAGGGTGCAAAGA	TPS-1 [27]
KB478	R: AATCTGGAACTCGCATTTGGCG

) were used for the relative expression levels of the specific mRNAs. The Ct values from the genes were normalized to the reference gene Elongation factor 1-a (Ef1-a) values according to the delta–delta cycle threshold (ΔΔCt) method [43]. Statistical analyses were performed using one-way Analysis of Variance (ANOVA) and followed by Fishers Least Significant Difference (LSD) using GraphPad 8.0.1 (Software, San Diego, CA, USA, www.graphpad.com, accessed on 22 November 2022).

4. Conclusions

Our results indicate that the monoterpenes synthases expression in lavender flowers is rhythmically affected during the day leading to an accumulation of EO compound in the afternoon. These results will enhance other knowledge towards the optimum lavender harvest time to ensure high-quality lavender EO. This result will enhance the progress of lavender VOCs for biotechnological applications, including food, health, industrial products and the perfume industry. For instance, regulating VOC biosynthesis will result in various metabolic engineering implications. Transgenes could be turned on or off by specific transcription factors or chromatin modifiers to facilitate the optimum regulatory circuits to produce high-level specialized metabolites.