MAOA uVNTR Polymorphism in a Sample of Patients Diagnosed with Papillary Thyroid Cancer

Abstract

Thyroid gland carcinoma (TGC), though only 1% of all carcinomas, is the most common endocrine neoplasm with an increasing incidence since the 1990s. Of the TGC types, papillary thyroid carcinoma (PTC) is the most common and has the best overall prognosis. Although primarily studied in various neural spectrum disorders, monoamine oxidase A (MAOA) may also contribute to cancer occurrence. This case control study assessed the prevalence of MAOA uVNTR polymorphism in PTC patients, compared its frequency with a healthy control, and assessed the variant’s impact on clinical features. The research participants consisted of 30 PTC patients (20 female, 10 male) over 18 years old who underwent thyroidectomy and radioiodine therapy at a Federal District private clinic and 30 paired and unrelated healthy volunteers (18 female, 12 male). The most frequent MAOA uVNTR alleles were 3R and 4R. Although no significant difference was detected in the genotypic distribution nor the PTC patients’ thyroglobulin, thyroid-stimulating hormone, and antithyroglobulin levels; body mass indexes; administered radiopharmaceutical (131I) doses; or biological sex, the presence of at least one 3R allele was associated with a larger tumor size (T3 + T4 staging). Thus, the 3R allele seems to be associated with PTC pathogenesis severity.

1. Introduction

Thyroid gland carcinoma accounts for approximately 1% of all carcinomas; nonetheless, it is the most prevalent endocrine neoplasm worldwide, and its incidence has continued to increase since the 1990s [1]. According to projections for the United States of America (USA), by 2030, the cases of thyroid cancer will occupy the fourth position among the most common neoplasms—a trend also verified in other countries. The predicted leading cancer diagnoses in 2030 are prostate, lung, and melanoma for men and breast, thyroid, and uterus for women [2].

Most thyroid tumors originate from the thyroid follicular epithelial cells, whereas 3–5% of cancers originate from the parafollicular cells. Thyroid malignancy is divided into three main groups: well-differentiated cancer (papillary and follicular carcinomas), poorly differentiated cancer (medullary carcinoma), and dedifferentiated/undifferentiated cancer (anaplastic carcinoma) [3]. Of these types, papillary thyroid carcinoma (PTC) is the most common subtype and has the best overall prognosis. Metastases most commonly involve cervical lymph nodes and, less commonly, the lungs [4]. According to the National Cancer Institute (INCA), in Brazil in 2023, thyroid cancer was the fifth most prevalent in women, with 14,160 new cases, representing 5.8% of all neoplasms, except non-melanoma skin cancer [5].

In the USA, thyroid cancer incidence, particularly PTC, increased rapidly for several decades, starting in the early 1980s. Recognizing the urgent need to reverse these trends, between 2009 and 2017, the American College of Radiology (ACR), the American Thyroid Association (ATA), and the United States Preventive Services Task Force issued the first 2015 ATA management guidelines, where they discussed the use of molecular testing for cytology-indeterminate nodules to bypass diagnostic surgery [6].

For a good diagnosis, imaging exams should be complemented with biochemical tests, such as thyroid-stimulating hormone (TSH) measurements, to evaluate the thyroid function [7]. In the case of hyperfunction, iodine-131 scintigraphy is commonly used to assess thyroid nodules further. For instance, if the nodule is hyperfunctional (a “hot nodule”), it will have a greater radiopharmaceutical uptake than the normal thyroid (which rarely indicates malignancy); if it is isofunctional (a “warm nodule”), the uptake will be equal to the surrounding tissue; and if it is non-functional (a “cold nodule”), the uptake will be lower than the surrounding thyroid tissue (which typically indicates malignancy) [7].

When assessing elevated TSH concentrations, the dosage of anti-thyroperoxidase (anti-TPO) antibodies may be requested to confirm autoimmune thyroiditis. Unlike anti-TPO antibodies, autoantibodies to thyroglobulin (antithyroglobulin—TgAb) do not appear pathogenic and may indicate thyroid disease (normal values ~ less than 4.00 IU/mL). The thyroglobulin (Tg) serum dosage is a relatively low sensitivity and specificity test for diagnosing thyroid malignancy; however, the levels of this marker are increased in the presence of thyroid cancer [8].

According to the consensus from the European Thyroid Association (ETA) and the Thyroid Department of the Brazilian Society of Endocrinology and Metabolism, the first phase of treatment begins with the total removal of the thyroid gland (thyroidectomy) or partial removal (lobectomy). Thyroidectomy is complemented, in most cases, by radioiodine therapy (RIT) using iodine-131 (131I). Due to the thyroid cells’ iodine absorption mechanism, a low iodine intake or even levothyroxine (LT4) suspension for 7 to 14 days allows higher radiopharmaceutical absorption [9,10]. The lack of the thyroid hormone in the blood causes the hypophysis (pituitary gland) to produce TSH, stimulating the thyroid cells to capture the iodine resulting from the treatment [9,10].

The etiology of thyroid cancer is still not well described, though the literature states that risk factors such as ionizing radiation, especially with exposure in childhood; obesity; smoking; and endocrine disruptors can be associated with thyroid cancer occurrence. DNA sequencing studies of individuals diagnosed with thyroid cancer revealed the possibility of an association between genetic alterations and this cancer occurrence. These facts demonstrate that thyroid cancer has a multifactorial etiology [11].

Neurotransmitter levels regulate the body or the tumor microenvironment [12]. Monoamine oxidase (MAO) catalyzes catecholamine neurotransmitter degradation and is located in the outer mitochondrial membrane of neuronal and glial cells and also the digestive tract, liver, and placenta cells [12,13]. It exists in two isoforms, MAO-A and MAO-B, encoded by the MAO-A and MAO-B genes. Both the MAO genes contain 15 exons and 14 introns and are located on the short arm of the X chromosome (Xp11.23). Although primarily studied in the context of a wide variety of neural spectrum disorders, MAOA may also contribute to cancer occurrence, as the deaminated products of MAOA activity promote cell proliferation and inhibit apoptosis [13].

Functional polymorphisms in the MAO-A gene provide a possible link between MAO-A deficiency and abnormal physiological behaviors. Among the studied MAO-A polymorphisms, the MAO-A upstream variable number tandem repeat (uVNTR) stands out, consisting of a 30 bp VNTR located in the gene’s promoter region at 1.2 kb from the transcription initiation site. The polymorphism analysis from gene amplification uncovered five fragment sizes (alleles) composed of 2 (2R), 3 (3R), 3.5 (3.5R), 4 (4R), 5 (5R), or 6 (6R) copies of the repeated sequence [14,15]. MAOA uVNTR polymorphism does not influence its mRNA abundance nor methylation [16], but the variants affect its transcriptional [16,17] and enzyme activity [16]. The 3.5R and 4R alleles are described as high-activity alleles for their more efficient transcriptional activity. In contrast, the 3 R allele, sometimes combined with the 2R and 5R alleles, are denoted as low-activity alleles for their lower transcriptional efficiency [16,18]. Nonetheless, there is still debate about the 2R and 5R influence on transcriptional efficiency, as some consider them low-activity alleles, while others high- [15]. This knowledge gap is probably due to their rarity [15].

This present study aims to determine the prevalence of MAOA uVNTR genetic polymorphism in patients with papillary thyroid cancer who underwent radiopharmaceutical sodium iodide (131I) treatment and to compare their genetic frequency with the healthy group. Furthermore, we analyzed the case group’s MAOA uVNTR genotypic and allelic frequencies regarding the patients’ clinical characteristics, biological sex, administered radiopharmaceutical dose, and Tumor, Node, and Metastasis (TNM) staging.

2. Materials and Methods

2.1. Study Design and Research Participants

This research is a case control, comparative, analytical, prospective study with a quantitative and qualitative approach. The research participants were divided into two groups. The case group consisted of 30 patients (20 female, 10 male) over 18 years old (average age: 51 ± 9 years) diagnosed with papillary thyroid cancer (PTC) who underwent thyroidectomy and radioiodine therapy at a Federal District private clinic. The control group consisted of 30 healthy volunteers (18 female, 12 male) with a mean age of 56 ± 4 years, paired and unrelated to the case group. Further information on the participants’ exclusion criteria and sample size calculation are described in [19]. The Centro Universitário de Brasília (UniCEUB) Ethics Committee approved this study under CAAE no. 57382416.6.0000.0023. All participants signed the informed consent form (ICF).

2.2. Genotype Analysis

After signing the free and informed consent terms and the biological material guard terms, each participant had 10 mL of venous blood taken, and we considered information from their medical record. DNA was extracted and quantified for the genetic polymorphism evaluation as described in [19]. Next, the polymerase chain reaction (PCR) technique was performed to determine the MAOA uVNTR genotypes’ distribution. The primers used were 5′–ACAGCCTCGCCGTGGAGAAG−3′ (sense) and 5′–GAACGGACGCTCCATTCGGA−3′ (antisense) [20], and the thermocycling conditions and PCR product evaluation are described in [21]. The following allelic pattern was observed according to the number of repetitions in tandem: 2R—320 bp, 3R—350 bp, 5R—410 bp, and 4R—380 bp.

2.3. Statistical Analysis

For the statistical analysis, the allelic and genotypic frequencies were estimated using the SPSS software version 28.0 (SPSS Inc., Chicago, IL, USA), adopting a significance level of 5.0%. The chi-squared test, odds ratio (OR), Mann–Whitney test, and Fisher’s exact test were applied as described in [19].

3. Results

The MAOA uVNTR polymorphism’s genotypic distributions in the case and control groups are presented in

Table 1. MAOA uVNTR polymorphism’s genotypic distribution in the case (PTC) and control (healthy) groups.

	Group				Total
MAOA uVNTR	PTC		Control
	N	%	N	%	N	%
2R/2R or 2R* (2R@)	-	-	-	-	-	-
2R/3R	-	-	-	-	-	-
2R/4R	1	3.3%	4	13.3%	5	8.3%
2R/5R	-	-	-	-	-	-
3R/3R or 3R* (3R@)	5	16.7%	7	23.3%	12	20.0%
3R/4R	8	26.7%	8	26.7%	16	26.7%
3R/5R	1	3.3%	-	-	1	1.7%
4R/4R or 4R* (4R@)	14	46.7%	10	33.3%	24	40.0%
4R/5R	-	-	-	-	-	-
5R/5R or 5R* (5R@)	1	3.3%	1	3.3%	2	3.3%

Caption: * represents the male hemizygotes and ^@ represents the combined female homozygote and male hemizygotes. In bold letters are the most frequent genotypes.

. The genotypes found in the analyzed sample were 2R/4R, 3R^@ (female homozygote 3R/3R or male hemizygote 3R*), 3R/4R, 3R/5R, 4R^@ (female homozygote 4R/4R or male hemizygote 4R*), and 5R^@ (female homozygote 5R/5R or male hemizygote 5R*). The most frequent were 3R^@ (n = 12, 20%), 3R/4R (n = 16, 26.7%), and 4R^@ (n = 24, 40%). As there is still controversy regarding the activity/effect of the MAOA uVNTR’s 2R and 5R alleles on the MAOA function and transcription and their low frequency in the sample analyzed, all further analyzes were conducted considering the 3R^@, 3R/4R, and 4R^@ genotypes, leaving 27 PTC patients and 25 healthy controls from the original groups’ 30.

The MAOA uVNTR genotypic distribution in the case and control groups considering only the 3R and 4R alleles is presented in

Table 2. MAOA uVNTR polymorphism’s genotypic distribution according to the 3R and 4R alleles in the case (PTC) and control (healthy) groups.

MAOA uVNTR	Groups
	PTC		Control
	N	%	N	%	p#	OR	CI
3R/3R or 3R* (3R@)	5	18.5%	7	28.0%
3R/4R	8	29.6%	8	32.0%	0.629	NA	NA
4R/4R or 4R* (4R@)	14	51.9%	10	40.0%
4R/4R or 4R* (4R@)	14	51.9	10	40.0%	0.392	1.62	0.54–4.85
3R@ + 3R/4R	13	48.1	15	60.0%

Caption: * represents the male hemizygotes; ^@ represents the combined female homozygote and male hemizygotes; ^# represents the chi-squared test; N/A = not applicable; OR = Odds Ratio; and CI = confidence interval.

. Although 14 (51.9%) of the individuals in the case group had the 4R^@ genotype against 10 (40.0%) in the control group, no significant difference was detected between the research groups’ genotypic distributions (p = 0.629). Even when evaluating the genotypes in a dichotomized way, with the dominant model being the 4R^@ vs. 3R^@ + 3R/4R genotypes, no statistically significant difference was observed between the groups (p = 0.392).

Table 3. Median, 25th percentile, 75th percentile, and p-values of thyroglobulin (Tg), thyroid-stimulating hormone (TSH), and body mass index (BMI) variables in patients diagnosed with papillary thyroid cancer (PTC), according to their MAOA uVNTR genotype.

MAOA uVNTR	[Tg] ng/mL			[TSH] uUI/mL			BMI
	P25	Median	P75	P25	Median	P75	P25	Median	P75
3R@ + 3R/4R	0.47	4.40	31.99	38.30	76.65	117.23	23.65	25.73	32.46
4R@	0.77	2.88	5.58	7.46	77.90	136.13	24.34	25.44	30.47
p-value #		0.478			0.824			0.999

Caption: ^@ represents the combined female homozygote and male hemizygotes and ^# the Mann–Whitney U test.

presents the PTC patients’ MAOA uVNTR genetic polymorphism relationships with different clinical characteristics. None of the clinical characteristics analyzed, including thyroglobulin (Tg ng/mL), thyroid-stimulating hormone (TSH µUI/mL), and the body mass index (BMI), presented a statistical difference between the PTC patients’ genotypes (p = 0.478; p = 0.824; and p = 0.999, respectively).

The analysis of antithyroglobulin, biological sex, and the PTC-administered 131I dose as per the MAOA uVNTR genotypic distribution is shown in

Table 4. Association analysis between patients diagnosed with papillary thyroid cancer (PTC)’s MAOA uVNTR genotype and their antithyroglobulin level (IU/mL), biological sex, and administered radiopharmaceutical dose (mCi).

		MAOA uVNTR
		3R@ + 3R/4R		4R@		p #
		N	%	N	%
Antithyroglobulin (UI/mL)	<20	7	70.0%	8	88.9%	0.313
	>20	3	30.0%	1	11.1%
Biological sex	F	10	76.9%	7	50.0%	0.148
	M	3	23.1%	7	50.0%
Administered dose (mCI)	≤150	6	46.2%	7	50.0%	0.573
	>150	7	53.8%	7	50.0%

Caption: ^@ represents the combined female homozygote and male hemizygotes; ^# Fisher’s exact test; and ^# = p < 0.05.

. No significant difference was found in the antithyroglobulin levels (p = 0.313) and the administered radiopharmaceutical (131I) dose (p = 0.842) in the PTC patients according to their MAOA uVNTR genotype. Even though no significant difference was identified regarding the PTC patients’ biological sex (p = 0.148), there were more female patients with at least one 3R allele (n = 10; 76.9%) than male patients (n = 3; 23.1%).

Table 5. Association analysis between patients diagnosed with papillary thyroid cancer (PTC)’s MAOA uVNTR genotype and their TNM staging.

		MAOA uVNTR
		3R@ + 3R/4R		4R@		p#
		N	%	N	%
T status	T1 + T2	0	0.0%	7	77.8%	0.018 *
	T3 + T4	3	100.0%	2	22.2%
N status	N0	0	0.0%	1	16.7%	0.659
	N1	1	100.0%	5	83.3%
M status	M0	0	0.0%	0	0.0%	NA
	M1	0	0.0%	2	100.0%

Caption: ^@ represents the combined female homozygote and male hemizygotes; ^# Fisher’s exact test; and * = p < 0.05.

displays the association analysis between the TNM staging and the PTC patients’ MAOA uVNTR genotype. Notably, all patients with the T1 + T2 staging (n = 7, 77.8%) had the 4R^@ (female homozygote 4R/4R or male hemizygote 4R*) genotype (p = 0.018), and none had the 3R^@ (female homozygote 3R/3R or male hemizygote 3R*) + 3R/4R genotype (n = 0.0%).

4. Discussion

MAOA’s monoamine catabolism contributes to oxidative stress, playing a crucial role in developing cancers such as prostate cancer [13]. MAOA uVNTR polymorphism influences gene expression and activity, which may affect susceptibility to prostate cancer. White et al. (2012) [13] in a case control study evaluated this polymorphism in Caucasian and African–American residents of King County, Washington, United States of America. The two most common alleles were the 3 and 4 repeats, which together represented approximately 90.7% of the control genotypes and 92% of the case group genotypes [13].

The MAOA uVNTR allelic variants in this present study were 2R, 3R, 4R, and 5R, and the genotypes found were 2R/4R, 3R^@ (female homozygote 3R/3R or male hemizygote 3R*), 3R/4R, 3R/5R, 4R^@ (female homozygote 4R/4R or male hemizygote 4R*), and 5R^@ (female homozygote 5R/5R or male hemizygote 5R*) (Table 1). Like the case control study of White et al. (2012) [13], 3R and 4R were the most common genotypes in both the control and case groups, and their genotype frequency was 20% for the 3R^@ (n = 12), 26.7% for the 3R/4R (n = 16), and 40% for the 4R^@ (n = 24) genotypes. Due to the controversies around the 2R and 5R alleles’ activity/effect on MAOA function and transcription [15,16] and their low frequency in this study’s sample, all further analyzes were performed considering the 3R^@, 3R/4R, and 4R^@ genotypes (Table 2, Table 3, Table 4 and Table 5). No significant difference was detected between the research groups’ genotypic distribution (p = 0.629) nor when evaluating the dichotomized (4R^@ vs. 3R^@ + 3R/4R) genotypes (p = 0.392).

The retrospective study of Gonçalves et al. (2012) [17] analyzed the medical records of the patients who underwent thyroidectomy from an oncology reference public hospital in the state of São Paulo from 2009 to 2010. They observed, among other factors, an increase in the percentage of patients with well-differentiated thyroid cancer according to the increase in their body mass index (BMI = a person’s weight divided by their height squared), albeit without any statistical difference [17]. Likewise, in this present study, the BMI variable median was not statistically significant (p = 0.999; Table 3).

Tumor markers are molecules present in tumors that facilitate identifying the type of tumor and characterizing its severity and staging. An ideal biological marker should be specific and sensitive. The pituitary gland produces the thyroid-stimulating hormone (TSH) that stimulates the thyroid gland to produce triiodothyronine (T3) and thyroxine (T4) [19].

Fighera et al. (2015) [20] retrospectively reviewed the medical records of 622 patients with uni- and multinodular goiters and noted that TSH levels greater than 1.64 mU/L persist as a risk factor for malignancy, regardless of other variables. The patients with follicular lesions had higher TSH levels compared to patients with a benign cytological diagnosis. Thus, elevated serum TSH levels correlated with a higher risk of malignant thyroid nodules and more aggressive thyroid cancer.

This present study evaluated the TSH levels regarding MAOA uVNTR polymorphism and found no significant difference between the genotypes and TSH levels (p = 0.824; Table 3). The elevated TSH concentration in this study can be explained due to the suspension of levothyroxine prior to the patients’ 131I therapy and not necessarily a worse prognosis.

Antithyroglobulin antibodies are produced by immune cells, mainly by the lymphocytes that react against thyroid autoantigens and progressively infiltrate the thyroid gland. The incidence of antithyroglobulin antibodies is approximately twice as high in the patients with differentiated thyroid carcinoma, especially with papillary thyroid carcinoma (PTC), when compared to the general population, suggesting an association between autoimmune thyroid disease and differentiated thyroid carcinoma [21]. This present study showed no association between the MAOA uVNTR’s different genotypes and PTC patients’ antithyroglobulin levels (p = 0.478; Table 3).

Liu et al. (2018) [22] analyzed the genetic polymorphism’s contribution to 131I-induced toxicity in the patients with differentiated thyroid cancer and found that TNFα (rs1800629), ATM (rs11212570), NF-kβ (rs230493), and TGF-β (rs1800469 and rs2241716) polymorphisms were significantly associated with a radiation-induced sore throat after 131I treatment. By contrast, this present study found no significant association between the different 131I doses (≤150 mCi and >150 mCi) analyzed and MAOA uVNTR genotypes (p = 0.488).

The retrospective observational study of Kelly et al. (2019) [23] included 1093 patients treated with differentiated thyroid carcinoma who underwent thyroidectomy between 1995 and 2010 and observed that women (78%) were predominant, similar to this present study. Our study found that biological sex was uncorrelated with MAOA uVNTR polymorphism (p = 0.148; Table 4), even with more female PTC patients with at least one 3R allele (n = 10; 76.9%) than male (n = 3; 23.1%). PTC was their study’s most frequent (88%), and T1 staging was present in 55.8%, T2 in 19.4%, T3 in 22.1%, and T4 in 2.4% of cases evaluated. The presence of distant metastases was observed in 3.1% of the research participants.

The presence of the 3R allele seems to be associated with PTC severity. When studying the MAOA uVNTR polymorphism’s influence on TNM staging in PTC patients, the presence of at least one 3R allele was associated with a larger tumor (T3 + T4 staging) (p = 0.018). On the other hand, 77.8% (n = 7) of the PTC patients with the 4R^@ genotype were at T1 + T2 staging (Table 5).

Difficulties and limitations were encountered during this research due to a participant’s request to leave, the absence of socio-demographic data, and the absence of some test results for some participants.

5. Conclusions

This study is a pioneer in analyzing the MAOA uVNTR polymorphism’s impact on PTC in a sample from the Federal District, Brazil. The alleles found were 2R, 3R, 4R, and 5R, and the most frequent genotypes were 3R^@ (female homozygote 3R/3R or male hemizygote 3R*; n = 12, 20%), 3R/4R (n = 16, 26.7%), and 4R^@ (female homozygote 4R/4R or male hemizygote 4R*; n = 24, 40%) (Table 1). No significant difference was found between the case and control groups’ genotypic nor 4R^@ vs. 3R^@ + 3R/4R frequency distributions (Table 2). Furthermore, MAOA uVNTR polymorphism did not influence thyroglobulin, thyroid-stimulating hormone, and antithyroglobulin levels or the patients’ body mass index and administered radiopharmaceutical (131I) dose (Table 3 and Table 4). Nevertheless, the analysis of the variant effect on the PTC’s TNM staging indicates that the PTC pathogenesis severity is associated with the 3R allele. The presence of at least one 3R allele was related to a larger tumor size (T3 + T4 staging), while 77.8% (n = 7) of the 4R^@ genotype PTC patients were categorized at T1 + T2 staging (Table 5).

Evaluating the genetic associations with the clinical characteristics of the patients diagnosed with PTC can help as a promising method to differentiate benign from malignant thyroid conditions, as well as being an important tool to evaluate the PTC patients’ diagnosis and prognosis.