Autophagy Activation in Mesenchymal Stem Cells with Lithium Chloride and Trehalose: Implications for Regenerative Medicine
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Animals
2.2. Isolation and Expansion of Rat-Adipose-Tissue MSCs
2.3. Phenotyping Analysis of Isolated Rat MSCs by Flow Cytometery
2.4. Pharmacological Induction of Autophagy by FDA-Approved Drugs
2.5. Immunohistochemistry of LC3 Protein Expression
2.6. Gene Expression Analysis Using qPCR
2.7. Transmission Electron Microscopy for Autophagosomes Detection
2.8. Enzyme-Linked Immunosorbent Assay
2.9. Statistical Analyses
3. Results
3.1. General Characterization of Isolated Rat MSCs
3.2. Confirmation of Autophagy Induction
3.2.1. LC3 Expression by IHC
3.2.2. Detection of Autophagosomes by Transmission Electron Microscope
3.2.3. Quantitatively Detecting LC3 Protein Expression by ELISA
3.2.4. Gene Expression of Autophagy-Related Genes and Pluripotent Markers
3.3. Detecting Apoptotic Activity
3.4. Detecting Antioxidant Marker Activity
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| MSCs | Mesenchymal Stem Cells |
| SCs | Stem Cells |
| HLA-DR | Human Leukocyte Antigen-DR |
| IMPase | inositol monophosphatase |
| IP3 | myo-inositol-1,4,5-triphosphate |
| LiCH | Lithium Chloride |
| PBS | Phosphate-Buffered Saline |
| DMEM | Dulbecco’s Modified Eagle Medium |
| FBS | Fetal Bovine Serum |
| PE | Phycoerythrin |
| BSA | Bovine Serum Albumin |
| PB | Phosphate Buffer |
| SE | Standard Error |
| IHC | Immunohistochemistry |
| AV | Autophagic Vacuoles |
| ELISA | Enzyme-Linked Immunosorbent Assay |
| PtdIns | Phosphatidylinositol |
| ROS | Reactive Oxygen Species |
References
- Friedenstein, A.; Chailakhjan, R.; Lalykina, K. The development of fibroblast colonies in monolayer cultures of guinea-pig bone marrow and spleen cells. Cell Prolif. 1970, 3, 393–403. [Google Scholar] [CrossRef]
- Dominici, M. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 2006, 8, 315–317. [Google Scholar] [CrossRef]
- Thi, V.; Pham, K.; Thi, H.; Pham, P. Mesenchymal stem cells and the angiogenic regulatory network with potential incorporation and modification for therapeutic development. Biocell 2024, 48, 173. [Google Scholar] [CrossRef]
- Pura, L.; Putri, R.D.; Prahmana, M.A.; Wijaya, M.P.; Bandiara, R.; Faried, A.; Supriyadi, R. Mesenchymal Stem Cells as Anti-Inflammatory Agents in Chronic Kidney Disease: A Systematic Review and Meta-Analysis. Cells 2025, 14, 1313. [Google Scholar] [CrossRef]
- Giacomini, C.; Granéli, C.; Hicks, R.; Dazzi, F. The critical role of apoptosis in mesenchymal stromal cell therapeutics and implications in homeostasis and normal tissue repair. Cell. Mol. Immunol. 2023, 20, 570–582. [Google Scholar] [CrossRef]
- Sajjad, U.; Ahmed, M.; Iqbal, M.Z.; Riaz, M.; Mustafa, M.; Biedermann, T.; Klar, A.S. Exploring mesenchymal stem cells homing mechanisms and improvement strategies. Stem Cells Transl. Med. 2024, 13, 1161–1177. [Google Scholar] [CrossRef] [PubMed]
- Yang, R.-l.; Chen, S.-y.; Fu, S.-p.; Zhao, D.-z.; Wan, W.-h.; Yang, K.; Lei, W.; Yang, Y.; Zhang, Q.; Zhang, T. Antioxidant mechanisms of mesenchymal stem cells and their therapeutic potential in vitiligo. Front. Cell Dev. Biol. 2023, 11, 1293101. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Wu, Z.; Zhao, L.; Liu, Y.; Su, Y.; Gong, X.; Liu, F.; Zhang, L. The heterogeneity of mesenchymal stem cells: An important issue to be addressed in cell therapy. Stem Cells Res. Ther. 2023, 14, 381. [Google Scholar] [CrossRef]
- Santoro, A.; Grimaldi, M.; Marino, C.; Napolitano, E.; Buonocore, M.; D’Ursi, A.M. Cell Surface Markers of Mesenchymal Stem Cells: Current Knowledge and Advances in Characterization Technologies. Life 2025, 16, 10. [Google Scholar] [CrossRef]
- Kuçi, Z.; Piede, N.; Vogelsang, K.; Pfeffermann, L.-M.; Wehner, S.; Salzmann-Manrique, E.; Stais, M.; Kreyenberg, H.; Bonig, H.; Bader, P. Expression of HLA-DR by mesenchymal stromal cells in the platelet lysate era: An obsolete release criterion for MSCs? J. Transl. Med. 2024, 22, 39. [Google Scholar] [CrossRef]
- Gómez-Virgilio, L.; Silva-Lucero, M.-d.-C.; Flores-Morelos, D.-S.; Gallardo-Nieto, J.; Lopez-Toledo, G.; Abarca-Fernandez, A.-M.; Zacapala-Gómez, A.-E.; Luna-Muñoz, J.; Montiel-Sosa, F.; Soto-Rojas, L.O. Autophagy: A key regulator of homeostasis and disease: An overview of molecular mechanisms and modulators. Cells 2022, 11, 2262. [Google Scholar] [CrossRef] [PubMed]
- Nakatogawa, H. Mechanisms governing autophagosome biogenesis. Nat. Rev. Mol. Cell Biol. 2020, 21, 439–458. [Google Scholar] [CrossRef]
- Belmaker, R.H. At 75 Years, Is Lithium the Gold Standard in Bipolar Disorder? Pharmaceuticals 2025, 18, 1850. [Google Scholar] [CrossRef]
- Wang, Z.; Chai, Z.; Xu, X.; Piao, Y.; Gong, L. Lithium chloride-treated human umbilical cord mesenchymal stem cells-derived exsomes promote hair growth by regulating miR-146a-5p-wnt pathway. Stem Cells Transl. Med. 2025, 14, szaf049. [Google Scholar] [CrossRef]
- Zanni, G.; Di Martino, E.; Omelyanenko, A.; Andäng, M.; Delle, U.; Elmroth, K.; Blomgren, K. Lithium increases proliferation of hippocampal neural stem/progenitor cells and rescues irradiation-induced cell cycle arrest in vitro. Oncotarget 2015, 6, 37083. [Google Scholar] [CrossRef]
- Sarkar, S.; Floto, R.A.; Berger, Z.; Imarisio, S.; Cordenier, A.; Pasco, M.; Cook, L.J.; Rubinsztein, D.C. Lithium induces autophagy by inhibiting inositol monophosphatase. J. Cell Biol. 2005, 170, 1101–1111. [Google Scholar] [CrossRef] [PubMed]
- Chen, Q.; Haddad, G.G. Role of trehalose phosphate synthase and trehalose during hypoxia: From flies to mammals. J. Exp. Biol. 2004, 207, 3125–3129. [Google Scholar] [CrossRef] [PubMed]
- Sarkar, S.; Davies, J.E.; Huang, Z.; Tunnacliffe, A.; Rubinsztein, D.C. Trehalose, a novel mTOR-independent autophagy enhancer, accelerates the clearance of mutant huntingtin and α-synuclein. J. Biol. Chem. 2007, 282, 5641–5652. [Google Scholar] [CrossRef]
- Luyckx, J.; Baudouin, C. Trehalose: An intriguing disaccharide with potential for medical application in ophthalmology. Clin. Ophthalmol. 2011, 5, 577–581. [Google Scholar] [CrossRef]
- Fujimaki, K.; Li, R.; Chen, H.; Della Croce, K.; Zhang, H.H.; Xing, J.; Bai, F.; Yao, G. Graded regulation of cellular quiescence depth between proliferation and senescence by a lysosomal dimmer switch. Proc. Natl. Acad. Sci. USA 2019, 116, 22624–22634. [Google Scholar] [CrossRef]
- Zhao, K.; Chan, I.T.; Tse, E.H.; Xie, Z.; Cheung, T.H.; Zeng, Y.A. Autophagy in adult stem cell homeostasis, aging, and disease therapy. Cell Regen. 2025, 14, 14. [Google Scholar] [CrossRef]
- Menshikov, M.; Zubkova, E.; Stafeev, I.; Parfyonova, Y. Autophagy, mesenchymal stem cell differentiation, and secretion. Biomedicines 2021, 9, 1178. [Google Scholar] [CrossRef]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
- Cheville, N.; Stasko, J. Techniques in electron microscopy of animal tissue. Vet. Pathol. 2014, 51, 28–41. [Google Scholar] [CrossRef]
- Kaviarasan, V.; Deka, D.; Balaji, D.; Pathak, S.; Banerjee, A. Signaling pathways in trans-differentiation of mesenchymal stem cells: Recent advances. In Stem Cells and Lineage Commitment: Methods and Protocols; Spring: Berlin/Heidelberg, Germany, 2023; pp. 207–223. [Google Scholar]
- Gabr, M.M.; Zakaria, M.M.; Refaie, A.F.; Khater, S.M.; Ashamallah, S.A.; Rashed, S.A.; Fouad, A.M.; Ismail, A.M.; Ghoneim, M.A. PRDX6 Promotes the Differentiation of Human Mesenchymal Stem (Stromal) Cells to Insulin-Producing Cells. BioMed Res. Int. 2020, 2020, 7103053. [Google Scholar] [CrossRef] [PubMed]
- Alvites, R.; Branquinho, M.; Sousa, A.C.; Lopes, B.; Sousa, P.; Maurício, A.C. Mesenchymal stem/stromal cells and their paracrine activity—Immunomodulation mechanisms and how to influence the therapeutic potential. Pharmaceutics 2022, 14, 381. [Google Scholar] [CrossRef]
- Fouad, A.M.; Gabr, M.M.; Abdelhady, E.K.; Zakaria, M.M.; Khater, S.M.; Ismail, A.M.; Refaie, A.F. In vitro differentiation of human multilineage differentiating stress-enduring (Muse) cells into insulin producing cells. J. Genet. Eng. Biotechnol. 2018, 16, 433–440. [Google Scholar] [CrossRef]
- Rashed, S.; Gabr, M.; Abdel-Aziz, A.-A.; Zakaria, M.; Khater, S.; Ismail, A.; Fouad, A.; Refaie, A. Differentiation potential of nestin (+) and nestin (-) cells derived from human bone marrow mesenchymal stem cells into functional insulin producing cells. Int. J. Mol. Cell. Med. 2019, 8, 1. [Google Scholar]
- Wei, Y.; Zheng, Z.; Zhang, Y.; Sun, J.; Xu, S.; Di, X.; Ding, X.; Ding, G. Regulation of mesenchymal stem cell differentiation by autophagy. Open Med. 2024, 19, 20240968. [Google Scholar] [CrossRef] [PubMed]
- Fang, D.; Xie, H.; Hu, T.; Shan, H.; Li, M. Binding features and functions of ATG3. Front. Cell Dev. Biol. 2021, 9, 685625. [Google Scholar] [CrossRef] [PubMed]
- Bhattacharya, A.; Torggler, R.; Reiter, W.; Romanov, N.; Licheva, M.; Ciftci, A.; Mari, M.; Kolb, L.; Kaiser, D.; Reggiori, F. Decoding the function of Atg13 phosphorylation reveals a role of Atg11 in bulk autophagy initiation. EMBO Rep. 2024, 25, 813–831. [Google Scholar] [CrossRef]
- Rong, Z.; Zheng, K.; Chen, J.; Jin, X. Function and regulation of ULK1: From physiology to pathology. Gene 2022, 840, 146772. [Google Scholar] [CrossRef]
- Popli, P.; Oestreich, A.K.; Maurya, V.K.; Rowen, M.N.; Zhang, Y.; Holtzman, M.J.; Masand, R.; Lydon, J.P.; Akira, S.; Moley, K. The autophagy protein ATG14 safeguards against unscheduled pyroptosis activation to enable embryo transport during early pregnancy. eLife 2025, 13, RP97325. [Google Scholar] [CrossRef]
- Huang, T.; Zhang, C.; Shang, Z.; Shuai, Q.; Nie, L.; Ren, J.; Hou, S.; Xie, J. Bone mesenchymal stem cells improve cholestatic liver fibrosis by targeting ULK1 to regulate autophagy through PI3K/AKT/mTOR pathway. Stem Cells Transl. Med. 2024, 13, 648–660. [Google Scholar] [CrossRef]
- Nazio, F.; Carinci, M.; Valacca, C.; Bielli, P.; Strappazzon, F.; Antonioli, M.; Ciccosanti, F.; Rodolfo, C.; Campello, S.; Fimia, G.M. Fine-tuning of ULK1 mRNA and protein levels is required for autophagy oscillation. J. Cell Biol. 2016, 215, 841–856. [Google Scholar] [CrossRef] [PubMed]
- Kumar, A.V.; Mills, J.; Lapierre, L.R. Selective autophagy receptor p62/SQSTM1, a pivotal player in stress and aging. Fron. Cell Develop. Biol. 2022, 10, 793328. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y. Research progress on morphology and mechanism of programmed cell death. Cell Death Dis. 2024, 15, 327. [Google Scholar] [CrossRef]
- Denton, D.; Kumar, S. Autophagy-dependent cell death. Cell Death Differ. 2019, 26, 605–616. [Google Scholar] [CrossRef]
- Marquez, R.T.; Xu, L. Bcl-2: Beclin 1 complex: Multiple, mechanisms regulating autophagy/apoptosis toggle switch. Am. J. Cancer Res. 2012, 2, 214. [Google Scholar]
- Sorice, M. Crosstalk of autophagy and apoptosis. Cells 2022, 11, 1479. [Google Scholar] [CrossRef] [PubMed]
- Fouad, A.M. Down-regulation of pluripotency and expression of SSEA-3 surface marker for mesenchymal Muse cells by in vitro expansion passaging. Egypt. J. Basic Appl. Sci. 2019, 6, 68–72. [Google Scholar] [CrossRef]
- Liu, R.; Ratajczak, M.Z. Enumeration of very small embryonic-like stem cells in peripheral blood. In Stem Cell Mobilization: Methods and Protocols; Spring: Berlin/Heidelberg, Germany, 2012; pp. 207–219. [Google Scholar]
- Sharif, T. Autophagic homeostasis is required for the pluripotency of cancer stem cells. Autophagy 2017, 13, 264–284. [Google Scholar] [CrossRef]
- Wang, S. Transient activation of autophagy via Sox2-mediated suppression of mTOR is an important early step in reprogramming to pluripotency. Cell Stem Cell 2013, 13, 617–625. [Google Scholar] [CrossRef]
- Li, L.; Chen, Y.; Gibson, S.B. Starvation-induced autophagy is regulated by mitochondrial reactive oxygen species leading to AMPK activation. Cell. Signal. 2013, 25, 50–65. [Google Scholar] [CrossRef]
- Meng, Q. GPx1 is involved in the induction of protective autophagy in pancreatic cancer cells in response to glucose deprivation. Cell Death Dis. 2018, 9, 1187. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Azad, M.; Gibson, S. Superoxide is the major reactive oxygen species regulating autophagy. Cell Death Differ. 2009, 16, 1040–1052. [Google Scholar] [CrossRef] [PubMed]





| Gene | Forward Primer | Reverse Primer | Accession Number |
|---|---|---|---|
| ATG3 | GGCTATGATGAGCAACGGCA | TGCAGGGGTGAACTGAACAC | NM_134394.2 |
| ATG13 | GGCTTCCAGACAGTTCGTGT | CCTCTCAAATTGCCTGGTGGA | NM_001271212.1 |
| ATG14 | GCGACCGGGAGAGGTTTATT | CCGTTTTCCTTCCATGGCCT | NM_001107258.1 |
| ULK1 | CATCCGAAGGTCAGGTAGCA | TCTGGGATGGTTCCCACTTG | NM_001108341.1 |
| P62 | AGCTTCTCTCATAGCCGCTGG | CTGATGGAGCAGAAGCCGAC | NM_175843.4 |
| BcL-2 | GACTGAGTACCTGAACCGGC | AGTTCCACAAAGGCATCCCAG | NM_016993.1 |
| Bax | ATCCACCAAGAAGCTGAGCG | TCCACATCAGCAATCATCCTCTG | NM_017059.2 |
| Nanog | AGCAACGGCCTGACTCAGAAGG | GACGCGTTCATCAGATAGCCCT | NM_001100781.1 |
| Sox2 | TCAAGTCCGAGGCCAGTTCC | GCTGATCATGTCCCGGAGGT | NM_001109181.1 |
| OCT-4 | ACCGTGTGAGGTGGAACCTG | CCACACTCGAACCACATCCCT | NM_001009178.2 |
| GAPDH | TGCCACTCAGAAGACTGTGG | TGGTACATGACAAGGTGCGG | NM_017008.4 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Fouad, A.; ElSherbini, Y.; Abdelhady, E.; Abdraboh, M. Autophagy Activation in Mesenchymal Stem Cells with Lithium Chloride and Trehalose: Implications for Regenerative Medicine. BioMed 2026, 6, 4. https://doi.org/10.3390/biomed6010004
Fouad A, ElSherbini Y, Abdelhady E, Abdraboh M. Autophagy Activation in Mesenchymal Stem Cells with Lithium Chloride and Trehalose: Implications for Regenerative Medicine. BioMed. 2026; 6(1):4. https://doi.org/10.3390/biomed6010004
Chicago/Turabian StyleFouad, Ali, Yasser ElSherbini, Elsayed Abdelhady, and Mohamed Abdraboh. 2026. "Autophagy Activation in Mesenchymal Stem Cells with Lithium Chloride and Trehalose: Implications for Regenerative Medicine" BioMed 6, no. 1: 4. https://doi.org/10.3390/biomed6010004
APA StyleFouad, A., ElSherbini, Y., Abdelhady, E., & Abdraboh, M. (2026). Autophagy Activation in Mesenchymal Stem Cells with Lithium Chloride and Trehalose: Implications for Regenerative Medicine. BioMed, 6(1), 4. https://doi.org/10.3390/biomed6010004

