Next Article in Journal
Larval Dispersal of Gray Snapper (Lutjanus griseus) on the West Florida Shelf
Previous Article in Journal
Numerical Study of Barotropic Circulation in the Gulfs of Patras and Corinth System
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Preliminary Study on the Structure of Fungal Communities in Artificial Reef Areas in the Northern Yellow Sea

1
Center for Marine Ranching Engineering Science Research of Liaoning, Dalian Ocean University, Dalian 116023, China
2
College of Marine Science and Environment Engineering, Dalian Ocean University, Dalian 116023, China
3
College of Fisheries and Life Science, Dalian Ocean University, Dalian 116023, China
*
Authors to whom correspondence should be addressed.
Oceans 2025, 6(1), 11; https://doi.org/10.3390/oceans6010011
Submission received: 30 October 2024 / Revised: 20 January 2025 / Accepted: 5 February 2025 / Published: 11 February 2025

Abstract

The construction of artificial reefs is the primary ecological project of marine ranching and one of the most important methods of creating habitats for marine organisms. To date, studies on artificial reefs have taken a macroscopic perspective, with few studies having investigated the fungal communities in artificial reefs in the North Yellow Sea. Therefore, the aim of this study was to determine the distribution patterns of seawater quality, sediment properties, and fungal communities following the placement of artificial reefs of different materials in the North Yellow Sea. A sampling survey of marine ranching in the northern Yellow Sea was conducted in August 2023. Sediment and seawater samples were collected from the stone and concrete artificial reef areas as well as from the areas without constructed reefs as a control. Research shows that the total phosphorus (TP), total nitrogen (TN), and total organic carbon (TOC) concentrations were higher in the concrete reef than that in the other two regions. We obtained 735 fungal operational taxonomic units (OTUs) which were assigned to 11 phyla and 374 genera. Significant differences in the beta-diversity of the fungal communities were found among the three sampling regions, and the dominant species varied in seawater and sediment samples from different reef areas. Ascomycota was the most abundant phylum in the seawater and sediment samples, followed by Basidiomycota. pH and dissolved oxygen (DO) emerged as the most important factors affecting fungal communities in the seawater samples, whereas mean grain size, TN, and TOC had a significant effect on the communities in the sediments, with TP and TOC playing the most critical roles. Our study compared the characteristics of fungal communities in seawater and sediments in distinct types of artificial reefs and control areas, revealing the main environmental factors affecting fungal communities, which is of great significance for protecting biodiversity and evaluating the ecological effects of artificial reef placement.

1. Introduction

Artificial reefs are designed to improve the quality of marine habitats and realize the effective protection and proliferation of biological resources, representing the core ecological engineering technology for the construction of modernized marine pastures [1,2,3,4,5,6,7,8]. Artificial reefs are structures placed in targeted water environments determined through a scientific selection process. These structures can improve the quality of the water environment within the area. At the same time, they provide fish and other aquatic organisms with appropriate habitats for bait solicitation, reproduction, growth, and refuge [9]. Consequently, artificial reefs provide benefits by repairing the fish habitat to achieve the goals of fishery resource conservation and sustainable development [10]. The primary materials used to construct artificial reefs include wood, natural stone, concrete, used boats, and oyster reefs, with concrete artificial reefs being the dominant form of artificial reefs constructed at present [11,12,13,14]. In the design of artificial reefs, the design of interlaced hole diameter can significantly promote the flow field scope, especially the height of upwelling [14]. The reasonable construction of artificial reefs is conducive to adjusting the marine industrial structure, repairing and improving the marine ecological environment, increasing and optimizing fishery resources, and promoting the sustainable and healthy development of the marine economy [15].
To date, basic research on artificial reefs has mainly focused on the reef materials, structure, and hydrodynamic characteristics; evaluation of their ecological effects; and long-term monitoring and management [16,17,18]. However, few studies have focused on the structure of the microbial communities in artificial reef areas and their role in the established artificial reef community. Marine microorganisms are important components of marine ecosystems, playing a major role in the cycling of marine materials, energy flow, and the maintenance of marine ecosystem diversity and stability [19,20]. Most marine fungi are decomposers, although some are producers as well as indicator species of changes in the state of the marine environment. Therefore, marine fungi are an important part of the marine ecosystem and play an extremely important role in the energy flow and biogeochemical cycling of carbon, nitrogen, sulfur, and other elements to drive the evolution of life on Earth [21,22,23,24]. Consequently, gaining in-depth knowledge of the composition and dynamic patterns of fungal community structure in artificial reef areas will contribute to a better understanding of the interactions between microbial community structure and environmental factors in artificial reefs.
The sampling area is in the sea area of Xiao Changshan Island, Dalian. In recent years, driven by aquaculture, tourism development, decades of fishing, environmental pollution, and large-scale aquaculture, the marine ecological environment here has changed significantly, and marine resources have been severely depleted. In order to restore the marine environment and ensure the sustainable development of fisheries, Dalian has implemented a series of measures, such as the construction of marine pastures and restoration of island ecosystems, actively adopted artificial release ecological restoration and seabed modification, and carried out the construction of marine pastures such as artificial reefs and biological bottom seeding augmentation, covering an area of about 5800 km2 [25,26,27]. The construction of artificial reefs in the waters of Changshan Islands helps to improve the marine ecological environment and can promote the sustainable use of marine fishery resources [28]. Currently, resource assessment studies in artificial reef areas are mainly focused on macro aspects. There is a great lack of research on the fungal communities associated with artificial reefs, and in particular, there is a lack of in-depth knowledge of the fungal community composition and other characteristics of artificial reefs of different materials. There are no studies on the effects of artificial reef placement on the fungal communities in marine meadows in this area. Therefore, research on the structural composition of the fungal community in the artificial reef area and the influence of physicochemical factors on it is one of the essential and important contents of the construction and evaluation of the effects of artificial reefs. We conducted relevant studies on the community structure, species, diversity, and influencing physicochemical factors of fungi, with the aim of providing a scientific basis for the impact of marine ranch construction on the structure and function of microbial communities.

2. Materials and Methods

2.1. Sample Collection

Sampling was conducted on 30 August 2023 in the northeastern waters of Xiao Changshan Island, Dalian, China. In August 2020, there were stone reefs and concrete component reefs placed in the waters of Xiao Changshan Island. The stone reef is a natural, porous cubic frame ecological reef (2 m × 2 m × 2 m) with a single reef volume of 8 m3. An artificial reef area of 166 hectares was constructed and a schematic diagram of the reef is shown in Figure 1. The stations in the artificial reef areas with concrete components, stone reefs, and the natural control area were named Gn, Sn, and Cn, respectively. Three stations (Gn) were set up for concrete component artificial reefs, three stations (Sn) were set up for stone artificial reefs, and two stations (Cn) were set up in the control area. There are a total of 8 stations in the entire area, and the exact sampling locations are shown in Figure 1.
Bottom seawater and surface sediments (0–10 cm) were collected at each station. Seawater samples were collected with a 2 L seawater harvester for the determination of physicochemical factors and then transferred into a 2 L sterile bottle and stored in a cooler with ice packs for short term storage. After disembarkation, the samples were rapidly processed in the laboratory using triple extraction filtration, and the extracted samples were placed in 50 mL sterile centrifuge tubes and stored at −80 °C for high-throughput sequencing. A grab sampler was used to collect surface sediment samples, and approximately 1 kg of sediment was collected at each station. We transferred 2–3 g of each sediment sample into a 50 mL sterile centrifuge tube and placed the rest into a sterile bag until further processing. Sediments in sterile bags were placed in a −20 °C refrigerator for sediment physicochemical property determination, and samples in centrifuge tubes were placed in a −80 °C refrigerator to be used for high-throughput sequencing.

2.2. Measurements of Environmental Factors

In situ measurements of temperature (T), DO, pH, and salinity (Sal) of seawater samples were taken using a YSI PRO DSS multi-parameter water quality analyzer (YSI, Yellow Springs, OH, USA). All field experiments were permitted by “Measures for annual evaluation and reexamination of national marine ranching demonstration areas”, which was promulgated by the Ministry of agriculture and rural areas of China. According to Standard 17378-2007, TN was determined using Kjeldahl titration, TP was determined using the spectrophotometric method, and TOC concentration was determined using the potassium dichromate oxidation-reduction volumetric method. Sediment characteristics were measured using a Mastersizer 3000 (Malvern Panalytical, Malvern, UK) to measure median grain size.

2.3. DNA Extraction and PCR Amplification

DNA was extracted from eight seawater samples and eight sediment samples using the E.Z.N.ATM Mag-Bind Soil DNA Kit (Omega Bio-tek, Inc., Norcross, GA, USA), and the concentration and purity were checked by 1% agarose electrophoresis.
The ITS region of fungal 18S rRNA gene was amplified using the primers ITS1-F (CTTGGTCATTTAGAGGAAGTAA) and ITS2-R (GCTGCGTTCTTCATCGATGC). The first round of amplification reaction volume was 30 µL, including 15 µL of 2× Hieff Robust PCR Master Mix, 1 µL forward primer with barcode and 1 µL reverse primer, and 10~20 ng template DNA. The first round of cycling condition consisted of a pre-denaturation at 94 °C for 3 min, followed by 5 cycles of denaturation at 94 °C for 30 s, annealing at 45 °C for 20 s, and extension at 65 °C for 30 s, then immediately followed by additional 20 cycles of denaturation at 94 °C for 20 s, annealing at 55 °C for 20 s, and extension at 72 °C for 30 s, then the PCR products were stored at 72 °C for 5 min. The second round of amplification reaction volume was 30 µL, including 15 µL of 2× Hieff Robust PCR Master Mix, 1 µL forward primer and 1 µL reverse primer with index, and 20~30 ng PCR products from the first round of reaction. The second round of cycling condition consisted of a pre-denaturation at 95 °C for 3 min, followed by 5 cycles of denaturation at 94 °C for 20 s, annealing at 55 °C for 20 s, and extension at 72 °C for 30 s, then the PCR products were stored at 72 °C for 5 min. All PCR products were detected by 2% agarose electrophoresis. The concentration of the sequencing library was assessed by the Qubit 3.0 Fluorometer (Thermo Fisher Scientific, Waltham, MA, USA). Sequencing was performed on the Illumina MiSeq 2 × 300 bp platform (Illumina, San Diego, CA, USA).
The sequencing data obtained by the sequencing platform were paired-end reads which included barcode sequences, primers, and junction sequences added during sequencing. We used the Cutadapt software (V 1.18) to remove the primers at the 3’ end of each read and then merged the pairs of reads into one sequence according to the overlap region. Sequences were de-multiplexed to samples based on their unique barcode tags. Finally, we performed quality control filtering on the data of each sample to obtain the valid data. OTU clustering (ASV denoising) was performed. Mothur (V 1.43.0) was used to compare the OTU sequences with UNITE database to obtain species annotation information. Based on the results of OTU clustering (ASV denoising) analysis, multiple diversity index analyses of OTUs (ASV) and sequencing depth detection were performed using MUSCLE software (V 3.8.31). Based on taxonomic information, statistical analyses of community structure at different taxonomic levels were carried out.

2.4. Statistical Analysis

Alpha diversity indices, including Chao1, Shannon, ACE, Simpson, and sequencing depth (goods coverage), were calculated using QIIME software (v1.9.1). Differences in the alpha diversity indices of sediment fungal communities among the groups were analyzed using Tukey’s test. Venn diagrams were displayed by using the R package UpsetR (V 4.4.2). PCA analyses were performed using the WGCNA, stats, and ggplot2 packages of the R software (V 4.4.2), and ANOSIM analyses were calculated using the ANOSIM function of the vegan package. Histograms of relative abundance of fungal dominants at phylum level were plotted with the ggplot2 package. Distance-Based Redundancy Analysis (dbRDA) was performed to show the relationship between the fungal community and environmental factors. The Pearson correlation coefficient between fungal genus and environmental factors was calculated using the psych package in R, and the results are shown on the heatmap which was drawn with the pheatmap package in R.

3. Results

3.1. Environmental Factor Analysis of Seawater and Sediments

We measured the T, DO, pH, and Sal of seawater samples and the TN, TP, and TOC concentrations, and the grain size of sediment samples. The results are shown in Table 1. Water temperature did not differ greatly among sampling stations. The highest water temperature, 25.0 °C, was recorded at the CW1 sample site in the control area. The highest DO level occurred at the SW2 sample site, reaching 7.18 mg/L, and the lowest level occurred at the SW1 sample site, only 6.69 mg/L. The DO concentrations at the other six seawater sampling stations were close, varying around 7.00 mg/L. The salinity of the eight seawater sampling stations varied between 27.30 and 28.47. The highest pH occurred at the GW3 sample site, reaching 8.03, and the lowest pH occurred at the GW1 sample site, only 7.80. Among all sediment sampling stations, the average concentrations of TP, TN, and TOC at the three sampling stations in the concrete component reef area were higher than those in the control area and the stone reef area. The results of the particle size analysis showed that the median grain size of the sediment samples from the concrete component reef area was the smallest, followed by the stone reef area, and the samples from the control area had the largest median grain size.

3.2. Alpha and Beta Diversity Analysis of Fungal Communities in Seawater and Sediments

A total of sixteen samples, including eight seawater samples and eight sediment samples, were taken from the stone reef areas, concrete component reef areas, and control areas. We obtained 735 fungal operational taxonomic units (OTUs) which were assigned to 11 phyla and 374 genera. In Figure 2a, the number of OTUs measured for the SW1 sample was the largest, while the number of OTUs measured for the CS1 sample was the smallest. At the sample level, 42 OTUs (accounting for 5.71% of all OTUs) were shared by all samples (Figure 2b). There were 162 OTUs that only appeared in the SW1 sample and were absent in the other samples. The number of unique OTUs specific to SW2, GW1, GS2, GW3, and SW3 were 40, 34, 29, 25, and 21, respectively.
The calculated alpha diversity metrics per sample are listed in Table 2. The Simpsons index and Shannon index of the three samples SW3, GW3, and SS2 were higher than those of other samples, indicating that the fungal diversity of these three samples was higher than that of the other samples. The Chao1 and ACE indices of the two samples of CS1 were significantly lower than those of other samples, indicating that the fungal diversity of these two samples was lower than that of the other samples. The Pielou’s evenness index of the three samples SW3, GW3, and CW1 was higher than that of other samples, indicating that the fungal community distribution in the control area of these samples was more uniform than that of the other samples. In addition, the coverage values of the 16 samples from the three sampling areas were all close to one, indicating that the sequencing depth covered essentially all species in the samples.
The 16 samples were divided into six groups according to the sample properties and sampling areas (Figure 3). The differences of four alpha diversity indices (ACE, Chao1, Shannon, and Pielou’s evenness) among the six groups are shown in Figure 3. The group of sediment samples collected from the stone reef area (SS) had the largest ACE, Chao1, and Shannon indices, while these three indices of the group of sediment samples collected from the control area (CS) were the smallest. In the concrete component artificial reef area, the four indices (ACE, Chao1, Shannon, and Pielou’s evenness) of the seawater sample groups (GW) were larger than those of the sediment sample groups (GS). The control area also showed the same pattern where the seawater sample groups (CW) had larger alpha diversity indices than the sediment sample groups (CS). However, the situation in the stone reef area was different from the above two sampling areas. The four alpha diversity indices of the sediment sample group (SS) were larger than the seawater sample group (SW).
Differences in community structure among the six groups can be observed through Principal Component Analysis (PCA). The PCA results (Figure 4) showed that the horizontal and vertical principal components contributed 70.933% and 27.596%, respectively, to explaining the group differences. The clustering results of seawater and sediment samples in each region showed that there was a high degree of similarity within the seawater and sediment samples. The high aggregation of concrete artificial reef areas and control areas samples suggested a high similarity in their community composition. Meanwhile, there are some differences in the composition of the seawater and sediment samples. A portion of the stone reef area’s samples is relatively dispersed from the other regions, suggesting a low similarity between the stone reef areas and the concrete artificial reef areas and control areas and some differences in sample composition.
The results of Analysis of Similarities (ANOSIM), a non-parametric statistical method, are shown in Table 3. The results suggested that the R value was negative in the four groups GS VS CS, GS VS SS, SS VS CS, and SW VS CW, indicating that the differences between these four groups were smaller than the differences within the groups. However, except for these four groups, the R value of the fungal community structure among the subgroups was positive, indicating that the differences between the groups were higher than the differences within the groups. And the differences between the fungal communities of each subgroup were not significant (p > 0.05).

3.3. Analysis of Fungal Community Composition and Structure

The fungal community composition at the phylum level in the artificial reef area and the control area is shown in Figure 5a. A total of 11 fungal phyla were detected in 16 samples. Ascomycota was the most abundant phylum in both seawater and sediment samples, with the relative abundance ranging from 29.72% to 95.01%, except for the SS3 sample. In the SS3 sample, Basidiomycota had the highest relative abundance, reaching 89.94%. The third dominant phylum was Mortierellomycota, with a relative abundance ranging from 1.18% to 43.10%. Based on the Circos plot analysis of community composition at the phylum level (Figure 5b), it was shown that the Ascomycota phylum accounted for the highest relative abundance in GW2, GW3, and SW2, with an abundance of 95.01%, 73.50%, and 72.11%, respectively. The relative abundance of Ascomycetes was greater in seawater samples than in sediment samples, and it was greater in reef area samples than in control area samples. The highest relative abundance of Basidiomycota was observed in SS3 (89.94%), followed by SW1 (51.20%) and SS1 (45.39%). Among the samples from the SR, the highest relative abundance of Basidiomycota was observed. The highest relative abundance of Mortierellomycota was 43.10% in CS1, 35.96% in GS2, and 25.73% in GS1, respectively. The relative abundance of Mortierellomycota in sediment samples was notably high.

3.4. The Relationship Between Fungal Communities and Environmental Factors

The relationship between fungal communities and environmental factors was investigated by means of a redundancy analysis (RDA) (Figure 6a). A further examination of the relationship between fungal communities and environmental factors revealed that RDA1 and RDA2 represented 26.27% and 17.38%, respectively, of the cumulative changes in the relationship between environmental factors and fungal communities in seawater. T was positively correlated with RDA1 but negatively correlated with RDA2. DO and Sal were found to be negatively correlated with RDA1 and RDA2. Similarly, pH was positively correlated with RDA1 and negatively correlated with RDA2. The most critical physicochemical factors for the fungal community in the eight seawater samples were DO and Sal, followed by T. As illustrated in Figure 6b, RDA1 and RDA2 account for 22.87% and 12.24%, respectively, of the cumulative changes in the relationship between sediment environmental factors and fungal communities. TP and TN were both positively correlated with RDA1 and RDA2. TOC demonstrated a positive correlation with RDA1 and a negative correlation with RDA2. Conversely, grain size exhibited a negative correlation with RDA1 and RDA2. The most critical physicochemical factor for fungal communities in the eight sediment samples was TP, followed by TOC and TN.
In order to investigate the correlation between environmental factors and fungal communities, a Pearson correlation analysis was conducted. The results are presented in Figure 7. A significant correlation was observed between the seawater environment parameters of T, pH, and DO and the fungal communities in seawater samples. The results showed that DO was significantly negatively correlated with the relative abundance of Alternaria, Pisolithus, Graddonia, and Inocybe. The T was significantly positively correlated with the relative abundance of Mrakia. The pH was significantly negatively correlated with the relative abundance of Knufia (Figure 7a). The results showed that grain size was significantly negatively correlated with the relative abundances of Dacrymyces, norank-Meruliaceae, and Phaeosphaeria. TOC was significantly positively correlated with the relative abundance of Phaeosphaeria, while TN was significantly negatively correlated with the relative abundance of Cryptodiscus (Figure 7b).

4. Discussion

4.1. Environmental Physical and Chemical Factors in Different Artificial Reef Areas

The maximum temperature of 25 °C occurs at the CW1 sample site. This might be related to the local environmental effects of artificial reefs; alternatively, it could reflect natural temperature differences between sea areas. The concentrations of TN, TP, and TOC indicators were the highest in the concrete artificial reef areas. This might be attributed to both the material and the three-dimensional structure of the reefs, which influenced the placement area. This is consistent with the conclusion that the range of variation in the dissolved oxygen index was greater in the reef area than in the control area, and that total nitrogen levels were high in both the reef and control areas [29]. The grain size: concrete artificial reef areas < stone reef areas < control areas, which is consistent with the reduction of substrate particle size by artificial reef placement in the study of microbial community structure characterization of a typical artificial reef area in Weihai [30]. Artificial reefs with framed structures can affect the formation of localized currents and the deposition of surface sediments when placed on the seafloor. Different shapes of artificial reefs will create different localized current fields after placement, and the current field is also one of the important environmental conditions for the development of microbial communities [31,32,33]. Opening holes is a prevalent option in artificial reef design and exerts a substantial impact on the flow field effect of artificial reefs. The nutrient transport from the sediment to the water column, as well as the quantity and quality of suspended and settled particles, is highly contingent upon the presence of reef structures and the hydrodynamic regime [34,35]. Biologically induced fluctuations are strongly reliant on abiotic factors. Marine biological communities are susceptible to the influence of the surrounding environment [36,37]. It should be noted that this study did not take into account the effect of the flow field on fungal community production. Therefore, future research should incorporate this aspect for a more comprehensive understanding. The effect of the flow field on fungal community production was not considered in this study and should be considered in future studies.

4.2. Characterization of Fungal Community Composition

Most studies conducted in the northern waters of the Yellow Sea have focused on the microbial community structure in the aquaculture area. In contrast, there has been a paucity of research on the structure and diversity of fungal communities in the artificial reef areas. Researchers compared seawater and sediment samples from the northern Yellow Sea and found that the composition of bacterial communities differed in samples from different habitats [38]. This finding is consistent with the differences in fungal community composition observed in this study. The number of species in the control area was found to be greater than that in the artificial reef area. In shallow waters, the number of operational taxonomic units (OTUs) was found to be higher in the artificial reef area than in the control area. This result is consistent with the findings of Yu Jiayue et al. (2021), who suggested that the artificial reef area has higher levels of bacterial abundance and diversity [39]. The abundance of bacterial communities was found to be highest in the control zone in deeper waters. Furthermore, in shallower waters, the abundance of bacterial communities was found to be significantly higher in the concrete component reefs than in the other two zones. Yao Jia examined two distinct reef types, one composed of concrete and the other of natural stone. The dissimilarities in the fungal community composition between these two reef types were observed to be minimal, a finding that aligns with the results of the present study. Additionally, it was proposed that the biofilm microbiomes of metal and cement materials exhibited minimal differences in community composition and function [40,41]. Some scholars have studied the bio-attachment of artificial reefs with different materials and found that the material type and the presence of porous structures significantly impact the bio-attachment process [42,43]. In their 2017 study, Hauke F. Kegler and colleagues examined the bacterial community composition of coral reef habitats along a transcontinental shelf environment and depth gradient. Their findings revealed significant differences in bacterial community composition in water and sediment samples collected from nearshore locations [44]. The factor of depth exerts a significant influence on the composition of the microbial community. In this study, we did not consider the effect of depth at each station. Instead, we only stated the average depth of the sea area.

4.3. Impacts of Environmental Factors on Fungal Community Dynamics in Marine Ranching Areas

Different seasons can affect the vertical distribution of specific microbial communities [45]. In this study, we did not conduct research on seasonal variations. However, in future studies, we will consider the impact of seasonal changes on fungi. The structural composition of fungal communities and the composition of dominant taxa change in response to environmental changes. Studies further suggested that the content of nutrient salts, temperature, tides, flow field, and salinity in the environment may affect their distribution and species composition [46,47]. Xiao Changshan Island is a prominent site for oyster farming and has a unique geographical location. The oyster is a significant marine fishery resource and aquaculture organism. These oysters perform vital ecological functions, including water purification, habitat creation, and carbon sequestration [48,49]. The structural composition of the main bacterial communities in concrete artificial reef areas, stone reef areas, and control areas was found to be similar when surveyed. However, the fungal diversity and abundance of the latter were found to be slightly lower than those of the control waters. This was presumed to be related to the impact of aquaculture activities on water quality. The sampling survey revealed that the sea area exhibited elevated levels of TP, TN, and TOC. This may be attributed to its proximity to the continental shelf and heightened exposure to anthropogenic activities, including aquaculture operations and sewage discharges. The placement of an artificial reef will result in the formation of a specific flow field effect, which may influence the sediment grain size in the vicinity of the reef. In this study, an analysis of the sediment grain sizes in the two sea areas revealed that the grain size of the concrete used for the artificial reef was smaller than that of the grain size in the stone reef area. The factors influencing alterations in microbial community structure are numerous and encompass a range of variables, including sedimentary textural attributes, physical and chemical properties (temperature, dissolved oxygen, salinity, pH, currents, nutrients, heavy metals, etc.), food web composition, and human activities, among others [50,51,52]. The present study examined eight environmental factor indicators. Through RDA analysis, it was found that the most crucial physicochemical factors for the fungal community in seawater samples were DO and Sal. For the fungal community in sediment samples, the most crucial physicochemical factor was TP, followed by TOC and TN. Through Pearson correlation analysis between taxonomy and the environment, it was found that DO, grain size, pH, TN, T, and TOC were the primary factors influencing the dynamics of the fungal community at the genus level. The sampling period spanned three years post reef creation. There is a paucity of investigation on community succession following reef casting. Furthermore, the effects of seasonal variation and flow field factors on colony structure remain unconsidered. In future research, considering factors like season, flow field, and succession will help us better understand how external environmental factors influence the planktonic community.

5. Conclusions

In conclusion, this study obtained metabarcoding datasets of fungal communities from two reef areas and one control area by using high-throughput sequencing techniques and evaluated the structure of fungal communities and their relationship with environmental factors. A total of sixteen samples, including eight seawater samples and eight sediment samples, were taken from the stone reef areas, concrete component reef areas, and control areas. We obtained 735 fungal operational taxonomic units (OTUs) which were assigned to 11 phyla and 374 genera. The placement of artificial reefs demonstrated that it could enhance the ecological environment of the surrounding waters. Through diversity analysis and community composition discovery, it was revealed that the deployment of artificial reefs led to the formation of specific fungal community structures within their deployment area. The present study examined environmental factor indicators. Through RDA analysis and Pearson correlation analysis between taxonomy and the environment, it was found that the structure of fungus communities and the composition of dominant taxa in different habitats exhibited variability according to environmental factors. This study revealed the differences in fungal communities between different artificial reef areas and the main environmental factors affecting the fungal communities, which is of great significance for protecting the biodiversity of reef areas.

Author Contributions

Conceptualization, J.Y.; Methodology, J.Y., X.W. and Z.W.; Software, J.Y.; Validation, J.Y.; Formal analysis, J.Y.; Investigation, H.G., Z.H., Q.L. and Z.W.; Resources, J.Y.; Data curation, J.Y., Y.Y., S.L. and Z.H.; Writing—original draft, J.Y.; Writing—review and editing, Q.L. and T.T.; Visualization, J.Y., Y.Y., S.L., H.G., T.T. and X.W.; Supervision, T.T.; Project administration, T.T.; Funding acquisition, T.T. All authors have read and agreed to the published version of the manuscript.

Funding

The National Key R&D Program of China, Dalian Science and Technology Innovation Fund Project: (2023YFD2401103), (2021JJ11CG001).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data are contained within the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Yang, H.S. Construction of marine ranching in China: Reviews and prospects. J. Fish. China 2016, 40, 1133–1140. [Google Scholar]
  2. Shuichi, K. Economic, ecological and genetic impacts of marine stock enhancement and sea ranching: A systematic review. Fish Fish. 2018, 19, 511–532. [Google Scholar]
  3. Yuan, H.; Chen, P. Current Situation, Problems and Countermeasures of Marine Ranching Development in Guangdong Province, China. Asian Agric. Res. 2022, 49, 141–154. [Google Scholar]
  4. Zhang, X.; Sun, D.; Zhang, X.; Yan, H. Regional ecological efficiency and future sustainable development of marine ranch in China: Anempirical research using DEA and system dynamics. Aquaculture 2021, 534, 736339. [Google Scholar] [CrossRef]
  5. Xu, S.; Gao, Y.; Li, F.; Cheng, H.; Liu, Q. Spatial distinction analysis on marine ranch development potential in coastal areas of China. IOP Conf. Ser. Earth Environ. Sci. 2021, 895, 64–73. [Google Scholar] [CrossRef]
  6. Qin, M.; Wang, X.; Du, Y.; Wan, X. Influencing factors of spatial variation of national marine ranching in China. Ocean. Coast. Manag. 2021, 199, 105407. [Google Scholar] [CrossRef]
  7. Liu, S.; Zhou, X.; Zeng, C.; Wan, X. Characterizing the development of Sea ranching in China. Rev. Fish Biol. Fish. 2022, 32, 783–803. [Google Scholar] [CrossRef]
  8. Rouse, S.; Porter, J.S.; Wilding, T.A. Artificial reef design affects benthic secondary productivity and provision of functional habitat. Ecol. Evol. 2020, 10, 2122–2130. [Google Scholar] [CrossRef]
  9. Zeng, L.; Tang, Z.Z.; Chen, P.M.; Yu, J.; Chen, G.B. Optimization of fishery resources assessment methods and ecological effects evaluation of artificial reefs. Mar. Biol. Res. 2021, 17, 72–85. [Google Scholar] [CrossRef]
  10. Pickering, H.; Whitmarsh, D.; Jensen, A. Artificial reefs as a tool to aid rehabilitation of coastal ecosystems: Investigating the potential. Mar. Pollut. Bull. 1999, 37, 505–514. [Google Scholar] [CrossRef]
  11. Higgins, E.; Metaxas, A.; Scheibling, R. A systematic review of artificial reefs as platforms for coral reef research and conservation. PLoS ONE 2022, 17, e0261964. [Google Scholar] [CrossRef]
  12. Lima, J.S.; Zalmon, I.R.; Love, M. Overview and trends of ecological and socioeconomic research on artificial reefs. Mar. Environ. Res. 2019, 145, 81–96. [Google Scholar] [CrossRef]
  13. Yoris-Nobile, A.I.; Slebi-Acevedo, C.J.; Lizasoain-Arteaga, E.; Indacoechea-Vega, I.; Blanco-Fernandez, E.; Castro-Fresno, D.; Alonso-Estebanez, A.; Alonso-Cañon, S.; Real-Gutierrez, C.; Boukhelf, F.; et al. Artificial reefs built by 3D printing: Systematisation in the design, material selection and fabrication. Constr. Build. Mater. 2023, 06, 129766. [Google Scholar] [CrossRef]
  14. Lemoine, H.R.; Paxton, A.B.; Anisfeld, S.C.; Rosemond, R.C.; Peterson, C.H. Selecting the optimal artificial reefs to achieve fish habitat enhancement goals. Biol. Conserv. 2019, 238, 108200. [Google Scholar] [CrossRef]
  15. Wang, G.; Wan, R.; Wang, X.; Zhao, F.; Lan, X.; Cheng, H.; Tang, W.; Guan, Q. Study on the influence of cut-opening ratio, cut-opening shape, and cut-opening number on the flow field of a cubic artificial reef. Ocean. Eng. 2018, 162, 341–352. [Google Scholar] [CrossRef]
  16. Lee, M.O.; Otake, S.; Kim, J.K. Transition of artificial reefs (ARs) research and its prospects. Ocean. Coast. Manag. 2018, 154, 55–65. [Google Scholar] [CrossRef]
  17. Li, D.; Tang, C.; Xia, C.; Zhang, H. Acoustic mapping and classification of benthic habitat using unsupervised learning in artificial reef water. Estuar. Coast. Shelf Sci. 2017, 185, 11–21. [Google Scholar] [CrossRef]
  18. Tamayo, J.; Anticevic, J.C.; Rizzo, P.A.; Arroyo, J.I.; Masotti, I.; Díez, B. Influence of Estuarine Water on the Microbial Community Structure of Patagonian Fjords. Front. Mar. Sci. 2021, 8, 611981. [Google Scholar]
  19. Qi, H.; Huang, D.; Wang, F.; Ye, M.; Jiang, X. Spatial dynamics of prokaryotic microbial communities in sediments of the Yellow Sea: Assembly process, co-occurrence relationships, and environmental implications. J. Environ. Manag. 2022, 319, 115645. [Google Scholar] [CrossRef] [PubMed]
  20. Dyhrman, S.N.T.; Ammerman, J.W.; Mooy, V. Microbes and the marine phosphorus cycle. Oceanography 2007, 20, 110–116. [Google Scholar] [CrossRef]
  21. Fan, Y.; Fu, Q.; Zhang, S.; Zhang, M.; Chang, S.; Zhao, S.; Wang, M. Spatiotemporal variation in nitrogen and phosphorus levels and microbial community in the upstream water transport channel to the Douhe Reservoir. Environ. Sci. Pollut. Res. 2022, 29, 50471–50487. [Google Scholar] [CrossRef] [PubMed]
  22. Easson, C.G.; Lopez, J.V. Depth-Dependent Environmental Drivers of Microbial Plankton Community Structure in the Northern Gulf of Mexico. Front. Microbiol. 2019, 9, 3175. [Google Scholar] [CrossRef] [PubMed]
  23. Zhang, F.; Jonas, L.; Lin, H.; Hill, R.T. Microbially mediated nutrient cycles in marine sponges. FEMS Microbiol. Ecol. 2019, 95, fiz155. [Google Scholar] [CrossRef] [PubMed]
  24. Xi, X.H.; You, G.G.; Zhao, D.Y.; Kong, C.R.; Liu, M. Research on the construction of marine ranch in Changhai County from the perspective of ecology. J. Fish. 2018, 31, 43–47. [Google Scholar]
  25. Ma, Y.Y.; Han, H.; Bian, Z.H.; Liu, S.X. Distribution characteristics of zooplankton communities in the waters around Changshan Island. Mar. Environ. Sci. 2012, 31, 364–369. [Google Scholar]
  26. Zhao, Y.Y.; Cai, H.J.; Wang, X.Z.; Liu, L.Q.; Shan, X.X.; Hu, S.Q. Environmental indicative significance of carbon and nitrogen contents and δ^ (15)N values of three macroalgae species in Xiaochangshan Island. J. Appl. Oceanogr. 2023, 42, 667–674. [Google Scholar]
  27. Wang, G.; Guan, X.; Shi, Y. Simulation study on the artificial ecosystem of marine ranching at Dalian Zhangzi Island. Appl. Ecol. Environ. Res. 2021, 19, 525–548. [Google Scholar] [CrossRef]
  28. Gao, X.; Yu, Z.; Xia, Y.; Li, Y.; Li, Y. Current situation, problems and sustainable development countermeas ures of fishery in Changhai County. Fish. Inf. Strategy 2020, 35, 257–261. [Google Scholar] [CrossRef]
  29. Ren, H.J.; Tian, T.; Fu, W.T.; Liu, Y.H.; Yang, J. Study on the Characteristics of Summer Water Quality Change in Artificial Reef Area of Dachangshan Sea. Mod. Agric. Sci. Technol. 2017, 7, 192–196. [Google Scholar]
  30. Guo, Z.S. Characteristics of Microbial Community Structure in Typical Artificial Reef Area of Weihai. Basic Agricultural Science and Technology. Doctoral Thesis, Shandong University, Weihai, China, 2022. [Google Scholar] [CrossRef]
  31. Jiang, Z.; Liang, Z.; Zhu, L.; Guo, Z.; Tang, Y. Effect of hole diameter of rotary-shaped artificial reef on flow field. Ocean Eng. 2020, 197, 106917. [Google Scholar] [CrossRef]
  32. Guo, Z.; Wang, L.; Song, M. The effects of flow field on the succession of the microbial community on artificial reefs. Mar. Pollut. Bull. 2023, 191, 114920.1–114920.12. [Google Scholar] [CrossRef]
  33. Xue, D.; Wang, C.; Huang, T.; Pan, Y.; Zhang, N.; Zhang, L. Flow field effects and physical stability of pyramidal artificial reef with different slope angles. Ocean. Eng. 2023, 283, 115059. [Google Scholar] [CrossRef]
  34. Bai, J.; Li, H.Y.; Zhao, Y.G. Distribution characteristics of marine bacterial communities at different stations in the northern Yellow Sea. Acta Microbiol. Sin. 2009, 49, 343–350. [Google Scholar]
  35. Falcao, M.; Santos, M.N.; Drago, T.; Serpa, D.; Monteiro, C. Effect of artificial reefs (southern Portugal) on sediment–water transport of nutrients: Importance of the hydrodynamic regime. Estuar. Coast. Shelf Sci. 2009, 83, 451–459. [Google Scholar] [CrossRef]
  36. Nie, Z.; Zhu, L.; Xie, W.; Zhang, J.; Wang, J.; Jiang, Z.; Liang, Z. Research on the influence of cut-opening factors on flow field effect of artificial reef. Ocean. Eng. 2022, 249, 110890. [Google Scholar] [CrossRef]
  37. Noisette, F.; Pansch, C.; Wall, M.; Wahl, M.; Hurd, C. Role of hydrodynamics in shaping chemical habitats and modulating the responses of coastal benthic systems to ocean global change. Ocean. Eng. 2022, 28, 3812–3829. [Google Scholar] [CrossRef]
  38. Falkenberg, L.J.; Scanes, E.; Ducker, J.; Ross, P.M. Biotic habitats as refugia under ocean acidification. Conserv. Physiol. 2021, 9, 1. [Google Scholar] [CrossRef]
  39. Yu, J.Y.; Jiang, Y.Z.; Sun, P.; Zhang, H.; Ling, J.Z. Bacterial community structure and diversity in different habitats in Xiangshan Port. J. Ecol. 2021, 40, 2842–2849. [Google Scholar]
  40. Yao, J.; Zhu, T.; Liu, H.; Zhang, Y.; Ding, G.; Xin, M.L.; Nie, M. Response of artificial reef microbiome of different materials to oil pollution. Fudan J. Nat. Sci. Ed. 2021, 60, 73–83. [Google Scholar] [CrossRef]
  41. Inagaki, F. Sulfurovum lithotrophicum gen. nov. sp. nov. a novel sulfur-oxidizing chemolithoautotroph within the-Proteobacteria isolated from Okinawa Trough hydrothermal sediments. Int. J. Syst. Evol. Microbiol. 2004, 54, 1477–1482. [Google Scholar] [CrossRef] [PubMed]
  42. Mohamed, H.F.; Abdelgawad, A.; Cai, R.; Luo, Z.; Pie, L.; Xu, C. Author Correction: Microbial community shift on artificial biological reef structures (ABRs) deployed in the South China Sea. Sci. Rep. 2023, 13, 3456. [Google Scholar] [CrossRef]
  43. Kong, J.; Cong, G.; Ni, S.; Sun, J.; Guo, C.; Chen, M.; Quan, H. Recycling of waste oyster shell and recycled aggregate in the porous ecological concrete used for artificial reefs. Constr. Build. Mater. 2022, 323, 126447. [Google Scholar] [CrossRef]
  44. Kegler, H.F.; Muhammad, L.; Mirta, T.; Jeremiah, P.J.; Hassenrück, C.; Christian, W.; Astrid, G. Bacterial Community Composition and Potential Driving Factors in Different Reef Habitats of the Spermonde Archipelago, Indonesia. Front. Microbiol. 2017, 8, 662. [Google Scholar] [CrossRef]
  45. Li, W.; Yang, C.Y.; Zheng, T.L. Survival patterns of bacteria and their community characteristics in the natural environment. Chin. J. Appl. Environ. Biol. 2013, 19, 553–5602. [Google Scholar] [CrossRef]
  46. Evans, K.A.; Peoples, L.M.; Ranieri, J.R.; Wear, E.K.; Church, M.J. Mixing-driven changes in distributions and abundances of planktonic microorganisms in a large, oligotrophic lake. Limnol. Oceanogr. 2024, 69, 604–620. [Google Scholar] [CrossRef]
  47. Takai, K.; Suzuki, M.; Nakagawa, S.; Miyazaki, M.; Suzuki, Y.; Inagaki, F.; Horikoshi, K. Sulfurimonas paralvinellae sp. nov., a novel mesophilic, hydrogen-and sulfur-oxidizing chemolithoautotroph within the Epsilonproteobacteria isolated from a deep sea hydrothermal vent polychaete nest, reclassification of Thiomicrospira denitrificans as Sulfurimonas denitrificans comb.nov. and emended description of the genus Sulfurimonas. Int. J. Syst. Evol. Microbiol. 2006, 56, 1725–1733. [Google Scholar]
  48. Fodrie, F.J.; Rodriguez, A.B.; Gittman, R.K.; Grabowski, J.H.; Lindquist, N.L.; Peterson, C.H.; Piehler, M.F.; Ridge, J.T. Oyster reefs as carbon sources and sinks. Proc. R. Soc. B-Biol. Sci. 2017, 284, 20170891. [Google Scholar] [CrossRef] [PubMed]
  49. Lee, H.Z.L.; Davies, I.M.; Baxter, J.M.; Diele KSanderson, W.G. A blue carbon model for the European flat oyster (Ostrea edulis) and its application in environmental restoration. Aquat. Conserv. Mar. Freshw. Ecosyst. 2023, 34, e4030. [Google Scholar] [CrossRef]
  50. LeClair, L.L.; Eveningsong, O.; Schultz, J.M. Seasonal changes in abundance and compelling evidence of migration for 2 rockfish species (Sebastes auriculatus and S. caurinus) inhabiting a nearshore, temperate-water artificial reef. Fish. Bull. 2016, 114, 302–316. [Google Scholar] [CrossRef]
  51. Jorgensen, B.B.; Findlay, A.J.; Pellerin, A. The Biogeochemical Sulfur Cycle of Marine Sediments. Front. Microbiol. 2019, 10, 849. [Google Scholar] [CrossRef] [PubMed]
  52. Ma, J.X.; Zhang, P.Y.; Wang, Z.X.; Zheng, M.G.; Gao, P.; Qu, L.Y.; Zheng, F.R. Diversity of bacterial community structure and its response to environmental factors in the coastal shellfish culture area of Huangdao. J. Fish. 2022, 46, 984–994. [Google Scholar]
Figure 1. Sampling station map (Cn: control area; Sn: stone reefs; Gn: concrete component reefs).
Figure 1. Sampling station map (Cn: control area; Sn: stone reefs; Gn: concrete component reefs).
Oceans 06 00011 g001
Figure 2. (a) The number of OTUs among samples; (b) the number of fungal OTUs specific to sample intersections. The blue bars on the left panel show the number of OTUs in each sample, sorted by decreasing number of OTUs. The samples which have shared OTUs are connected by dots and lines in the red dot matrix area. The green bars on the top panel show the number of shared OTUs in the intersection denoted by the connected dots.
Figure 2. (a) The number of OTUs among samples; (b) the number of fungal OTUs specific to sample intersections. The blue bars on the left panel show the number of OTUs in each sample, sorted by decreasing number of OTUs. The samples which have shared OTUs are connected by dots and lines in the red dot matrix area. The green bars on the top panel show the number of shared OTUs in the intersection denoted by the connected dots.
Oceans 06 00011 g002
Figure 3. Four alpha diversity indices (ACE, Chao1, Shannon, and Pielou’s evenness) among the six groups.
Figure 3. Four alpha diversity indices (ACE, Chao1, Shannon, and Pielou’s evenness) among the six groups.
Oceans 06 00011 g003
Figure 4. Principal Component Analysis based on the six groups.
Figure 4. Principal Component Analysis based on the six groups.
Oceans 06 00011 g004
Figure 5. (a) Relative abundance of fungal communities at the phylum level; (b) Circos plot of community composition of fungal communities at the phylum level.
Figure 5. (a) Relative abundance of fungal communities at the phylum level; (b) Circos plot of community composition of fungal communities at the phylum level.
Oceans 06 00011 g005
Figure 6. (a) Redundancy analysis (RDA) ordination plot of seawater samples constrained by four environmental factors. (b) Redundancy analysis (RDA) ordination plot of sediment samples constrained by four environmental factors. Environmental variables are represented by arrows, with their directions indicating the gradients of variation in the ordination space.
Figure 6. (a) Redundancy analysis (RDA) ordination plot of seawater samples constrained by four environmental factors. (b) Redundancy analysis (RDA) ordination plot of sediment samples constrained by four environmental factors. Environmental variables are represented by arrows, with their directions indicating the gradients of variation in the ordination space.
Oceans 06 00011 g006
Figure 7. Heatmaps showing the Pearson correlation coefficients between fungal genus and seawater environmental factors (a) and sediment environmental factors (b).
Figure 7. Heatmaps showing the Pearson correlation coefficients between fungal genus and seawater environmental factors (a) and sediment environmental factors (b).
Oceans 06 00011 g007
Table 1. Environmental factor data.
Table 1. Environmental factor data.
GroupsT (°C)DO (mg/L)SalpHGroupsTOC (10−2)TP (mg/g)TN (mg/g)Grain Size
GW124.67.0127.777.80GS11.030.380.45885.86
GW224.47.0528.478.02GS21.410.530.47868.98
GW324.37.0228.158.03GS31.280.450.45677.88
SW124.76.6927.30 7.96SS10.830.380.41279.55
SW224.37.1828.40 8.01SS20.810.280.41983.47
SW324.57.0328.217.87SS30.970.290.41783.06
CW125.06.9527.377.91CS11.020.430.41985.46
CW224.37.0228.168.01CS20.840.20 0.41784.62
(GW: concrete component reef seawater samples; GS: concrete component reef sediment samples; SW: stone reef seawater samples; SS: stone reef sediment samples; CW: control area seawater samples; CS: control area sediment samples).
Table 2. Alpha diversity indices of fungal communities in sediment and water samples.
Table 2. Alpha diversity indices of fungal communities in sediment and water samples.
SampleSimpsonACEChao1ShannonPielouCoverage
GW10.895 105.774 102.071 3.110 0.702 0.981
GW20.914 150.100 158.214 3.348 0.715 0.969
GW30.951 151.679 164.077 3.661 0.779 0.969
GS10.739 152.338 144.882 2.550 0.555 0.968
GS20.916 138.353 137.300 3.509 0.737 0.977
GS30.634 109.550 103.550 2.166 0.486 0.978
SW10.869 230.919 215.000 3.095 0.619 0.946
SW20.663 96.086 101.500 2.034 0.484 0.981
SW30.960 128.388 118.261 3.664 0.790 0.978
SS10.918 216.481 224.773 3.601 0.722 0.952
SS20.827 159.399 170.250 3.099 0.648 0.967
SS30.931 249.261 249.615 3.698 0.727 0.945
CW10.940 101.080 102.250 3.455 0.772 0.985
CS10.732 39.169 40.000 2.257 0.625 0.997
CW20.877 125.541 124.000 3.009 0.664 0.975
CS20.739 128.246 135.000 2.489 0.557 0.973
Table 3. ANOSIM analysis.
Table 3. ANOSIM analysis.
GroupsSampleRpNumber
CS vs. CW41.00 0.3323
GS vs. CS5−0.33 0.9119
GS vs. CW51.00 0.1119
GS vs. GW60.78 0.1719
GS vs. SS6−0.07 0.8719
GS vs. SW60.44 0.1719
GW vs. CS50.67 0.2119
GW vs. CW50.50 0.2119
GW vs. SS60.56 0.1719
SS vs. CS5−0.08 0.8119
SS vs. CW50.17 0.3119
SW vs. CS50.17 0.3119
SW vs. CW5−0.08 0.7119
SW vs. GW60.37 0.2719
SW vs. SS60.26 0.1719
Between160.27 0.01999
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yan, J.; Yue, Y.; Lin, S.; Gu, H.; Han, Z.; Li, Q.; Tian, T.; Wei, X.; Wu, Z. Preliminary Study on the Structure of Fungal Communities in Artificial Reef Areas in the Northern Yellow Sea. Oceans 2025, 6, 11. https://doi.org/10.3390/oceans6010011

AMA Style

Yan J, Yue Y, Lin S, Gu H, Han Z, Li Q, Tian T, Wei X, Wu Z. Preliminary Study on the Structure of Fungal Communities in Artificial Reef Areas in the Northern Yellow Sea. Oceans. 2025; 6(1):11. https://doi.org/10.3390/oceans6010011

Chicago/Turabian Style

Yan, Jiamin, Yue Yue, Shengkai Lin, Hanshitong Gu, Ziyi Han, Qingxia Li, Tao Tian, Xu Wei, and Zhongxin Wu. 2025. "Preliminary Study on the Structure of Fungal Communities in Artificial Reef Areas in the Northern Yellow Sea" Oceans 6, no. 1: 11. https://doi.org/10.3390/oceans6010011

APA Style

Yan, J., Yue, Y., Lin, S., Gu, H., Han, Z., Li, Q., Tian, T., Wei, X., & Wu, Z. (2025). Preliminary Study on the Structure of Fungal Communities in Artificial Reef Areas in the Northern Yellow Sea. Oceans, 6(1), 11. https://doi.org/10.3390/oceans6010011

Article Metrics

Back to TopTop