Antioxidative Effects of Curcumin on Erastin-Induced Ferroptosis Through GPX4 Signalling
Abstract
1. Introduction
2. Results
2.1. Effect of Ferroptosis Inducers in PANC1 Cells
2.2. Erastin Induces Ferroptotic Cell Death in PANC1 Cells
2.3. Curcumin Decreased Iron Accumulation, Lipid Peroxidation and ROS
2.4. Curcumin Could Suppress GSH Depletion
3. Materials and Methods
3.1. Cell Culture
3.2. Cell Viability Assay
3.3. Cellular Iron Levels
3.4. Lipid Peroxidation Assay
3.5. Reactive Oxygen Species (ROS)
3.6. Glutathione Assay
3.7. Western Blot
3.8. RNA Extraction and Real-Time PCR
3.9. Statistical Analysis
4. Discussion and Conclusion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics. CA Cancer J. Clin. 2016, 66, 7–30. [Google Scholar] [CrossRef] [PubMed]
- Qin, C.; Yang, G.; Yang, J.; Ren, B.; Wang, H.; Chen, G. Metabolism of pancreatic cancer: Paving the way to better anticancer strategies. Mol. Cancer 2020, 19, 50. [Google Scholar] [CrossRef] [PubMed]
- Bruni, A.; Pepper, A.R.; Pawlick, R.L.; Gala-Lopez, B.; Gamble, A.F.; Kin, T. Ferroptosis-inducing agents compromise in vitro human islet viability and function article. Cell Death Dis. 2018, 9, 595. [Google Scholar] [CrossRef] [PubMed]
- Kang, R.; Tang, D. Autophagy and Ferroptosis—What is the Connection? Curr. Pathobiol. Rep. 2017, 5, 153–159. [Google Scholar] [CrossRef]
- Pietrangelo, A. Ferroportin disease: Pathogenesis, diagnosis and treatment. Haematologica 2017, 102, 1972–1984. [Google Scholar] [CrossRef]
- Yu, H.; Guo, P.; Xie, X.; Wang, Y.; Chen, G. Ferroptosis, a new form of cell death, and its relationships with tumourous diseases. J. Cell. Mol. Med. 2017, 21, 648–657. [Google Scholar] [CrossRef]
- Yang, W.S.; SriRamaratnam, R.; Welsch, M.E.; Shimada, K.; Skouta, R.; Viswanathan, V.S.; Cheah, J.H.; Clemons, P.A.; Shamji, A.F.; Clish, C.B.; et al. Regulation of ferroptotic cancer cell death by GPX4. Cell 2014, 156, 317–331. [Google Scholar] [CrossRef]
- Xie, Y.; Hou, W.; Song, X.; Yu, Y.; Huang, J.; Sun, X. Ferroptosis: Process and function. Cell Death Differ. 2016, 23, 369–379. [Google Scholar] [CrossRef]
- Li, J.; Cao, F.; Yin, H.L.; Huang, Z.J.; Lin, Z.T.; Mao, N. Ferroptosis: Past, present and future. Cell Death Dis. 2020, 11, 88. [Google Scholar] [CrossRef]
- Cao, J.Y.; Dixon, S.J. Mechanisms of ferroptosis. Cell. Mol. Life Sci. 2016, 73, 2195–2209. [Google Scholar] [CrossRef]
- Stockwell, B.R.; Friedmann Angeli, J.P.; Bayir, H.; Bush, A.I.; Conrad, M.; Dixon, S.J. Ferroptosis: A Regulated Cell Death Nexus Linking Metabolism, Redox Biology, and Disease. Cell 2017, 171, 273–285. [Google Scholar] [CrossRef] [PubMed]
- Neganova, M.E.; Aleksandrova, Y.R.; Sharova, E.V.; Smirnova, E.V.; Artyushin, O.I.; Nikolaeva, N.S. Conjugates of 3,5-Bis(arylidene)-4-piperidone and Sesquiterpene Lactones Have an Antitumor Effect via Resetting the Metabolic Phenotype of Cancer Cells. Molecules 2024, 29, 27–65. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.W.; Choi, J.H.; Seo, D.; Gavaachimed, L.; Choi, J.; Park, S. EGCG-induced selective death of cancer cells through autophagy-dependent regulation of the p62-mediated antioxidant survival pathway. Biochim. Biophys. Acta Mol. Cell Res. 2024, 1871, 119–659. [Google Scholar] [CrossRef] [PubMed]
- He, Y.C.; He, L.; Khoshaba, R.; Lu, F.G.; Cai, C.; Zhou, F.L. Curcumin nicotinate selectively induces cancer cell apoptosis and cycle arrest through a P53-mediated mechanism. Molecules 2019, 24, 41–79. [Google Scholar] [CrossRef]
- Zhang, H.; Tsao, R. Dietary polyphenols, oxidative stress and antioxidant and anti-inflammatory effects. Curr. Opin. Food Sci. 2016, 8, 33–42. [Google Scholar] [CrossRef]
- Hu, J.X.; Lin, Y.Y.; Zhao, C.F.; Chen, W.B.; Liu, Q.C.; Li, Q.W. Pancreatic cancer: A review of epidemiology, trend, and risk factors. World J. Gastroenterol. 2021, 27, 4298–4321. [Google Scholar] [CrossRef]
- Bear, A.S.; Vonderheide, R.H.; O’Hara, M.H. Challenges and Opportunities for Pancreatic Cancer Immunotherapy. Cancer Cell 2020, 38, 788–802. [Google Scholar] [CrossRef]
- Mizrahi, J.D.; Surana, R.; Valle, J.W.; Shroff, R.T. Pancreatic cancer. Lancet 2020, 395, 2008–2020. [Google Scholar] [CrossRef]
- Banerji, B.K.; Batra, A.; Dwivedi, A.K. Morphological and Biochemical Characterization of Chrysanthemum. J. Hortic. Sci. 2012, 7, 51–55. [Google Scholar] [CrossRef]
- Dixon, S.J.; Patel, D.; Welsch, M.; Skouta, R.; Lee, E.; Hayano, M. Pharmacological inhibition of cystine-glutamate exchange induces endoplasmic reticulum stress and ferroptosis. Elife 2014, 3, e02523. [Google Scholar] [CrossRef]
- Siegel, R.L.; Miller, K.D.; Fuchs, H.E.; Jemal, A. Cancer Statistics. CA Cancer J. Clin. 2021, 71, 7–33. [Google Scholar] [CrossRef] [PubMed]
- Sun, W.; Shahrajabian, M.H. Potencial terapêutico de compostos fenólicos em plantas medicinais—Produtos naturais de saúde para a saúde humana. Molecules 2023, 28, 18–45. [Google Scholar]
- Xie, Y.; Song, X.; Sun, X.; Huang, J.; Zhong, M.; Lotze, M.T.; Zeh, H.J.; Kang, R.; Tang, D. Identification of baicalein as a ferroptosis inhibitor by natural product library screening. Biochem. Biophys. Res. Commun. 2016, 473, 775–780. [Google Scholar] [CrossRef] [PubMed]
- Anand, P.; Kunnumakkara, A.B.; Newman, R.A.; Aggarwal, B.B. Bioavailability of curcumin: Problems and promises. Mol. Pharm. 2007, 4, 807–818. [Google Scholar] [CrossRef]
- Akram, M.; Ahmed, A.; Usmanghani, K.; Hannan, A.; Mohiuddin, E.; Asif, M. Curcuma Longa and Curcumin: A Review Article. Rom. J. Biophys. 2010, 55, 65–70. [Google Scholar]
- Dai, W.; Ruan, C.; Zhang, Y.; Wang, J.; Han, J.; Shao, Z. Bioavailability enhancement of EGCG by structural modification and nano-delivery: A review. J. Funct. Foods 2020, 65, 103–732. [Google Scholar] [CrossRef]
- An, Z.; Qi, Y.; Huang, D.; Gu, X.; Tian, Y.; Li, P. EGCG inhibits Cd2+-induced apoptosis through scavenging ROS rather than chelating Cd2+ in HL-7702 cells. Toxicol. Mech. Methods 2014, 24, 259–267. [Google Scholar] [CrossRef]
- Hyung, S.J.; Detoma, A.S.; Brender, J.R.; Lee, S.; Vivekanandan, S.; Kochi, A. Insights into antiamyloidogenic properties of the green tea extract (−)-epigallocatechin-3-gallate toward metal-associated amyloid-β species. Proc. Natl. Acad. Sci. USA 2013, 110, 3743–3748. [Google Scholar] [CrossRef]
- Jiang, X.; Stockwell, B.R.; Conrad, M. Ferroptosis: Mechanisms, biology and role in disease. Nat. Rev. Mol. Cell Biol. 2021, 22, 266–282. [Google Scholar] [CrossRef]
- Zhou, Y.; Jia, Z.; Wang, J.; Huang, S.; Yang, S.; Xiao, S. Curcumin reverses erastin-induced chondrocyte ferroptosis by upregulating Nrf2. Heliyon 2023, 9, 201–263. [Google Scholar] [CrossRef]
- Chang, C.H.; Pauklin, S. Extracellular vesicles in pancreatic cancer progression and therapies. Cell Death Dis. 2021, 12, 973–985. [Google Scholar] [CrossRef] [PubMed]
- Ursini, F.; Maiorino, M. Lipid peroxidation and ferroptosis: The role of GSH and GPx4. Free Radic. Biol. Med. 2020, 152, 175–185. [Google Scholar] [CrossRef] [PubMed]
- Samarghandian, S.; Azimi-Nezhad, M.; Farkhondeh, T.; Samini, F. Anti-oxidative effects of curcumin on immobilization-induced oxidative stress in rat brain, liver and kidney. Biomed. Pharmacother. 2017, 87, 223–229. [Google Scholar] [CrossRef] [PubMed]
- Lambert, J.D.; Elias, R.J. The antioxidant and pro-oxidant activities of green tea polyphenols: A role in cancer prevention. Arch. Biochem. Biophys. 2010, 501, 65–72. [Google Scholar] [CrossRef] [PubMed]
- Sandur, S.K.; Ichikawa, H.; Pandey, M.K.; Kunnumakkara, A.B.; Sung, B.; Sethi, G. Role of pro-oxidants and antioxidants in the anti-inflammatory and apoptotic effects of curcumin (diferuloylmethane). Free Radic. Biol. Med. 2007, 43, 568–580. [Google Scholar] [CrossRef]
- Holczer, M.; Besze, B.; Zámbó, V.; Csala, M.; Bánhegyi, G.; Kapuy, O. Epigallocatechin-3-Gallate (EGCG) promotes autophagy-dependent survival via influencing the balance of mTOR-AMPK pathways upon endoplasmic reticulum stress. Oxid. Med. Cell. Longev. 2018, 2018, 215–230. [Google Scholar] [CrossRef]
Gene Name | Forward Primer Sequence (5′-3′) | Reverse Primer Sequence (5′-3′) |
---|---|---|
GPX4 (NM_002085.5) | GAGGCAAGACCGAAGTAAACTAC | CCGAACTGGTTACACGGGAA |
FTH1 (NM_002032.3) | TTCAACAGTGCTTGGACGGA | ATCACTGTCTCCCAGGGTGT |
GAPDH (NM_002046.3) | GGAGCGAGATCCCTCCAAAAT | GGCTGTTGTCATACTTCTCATGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kose, T.; Sharp, P.A.; Latunde-Dada, G.O. Antioxidative Effects of Curcumin on Erastin-Induced Ferroptosis Through GPX4 Signalling. Gastrointest. Disord. 2025, 7, 4. https://doi.org/10.3390/gidisord7010004
Kose T, Sharp PA, Latunde-Dada GO. Antioxidative Effects of Curcumin on Erastin-Induced Ferroptosis Through GPX4 Signalling. Gastrointestinal Disorders. 2025; 7(1):4. https://doi.org/10.3390/gidisord7010004
Chicago/Turabian StyleKose, Tugba, Paul A. Sharp, and Gladys O. Latunde-Dada. 2025. "Antioxidative Effects of Curcumin on Erastin-Induced Ferroptosis Through GPX4 Signalling" Gastrointestinal Disorders 7, no. 1: 4. https://doi.org/10.3390/gidisord7010004
APA StyleKose, T., Sharp, P. A., & Latunde-Dada, G. O. (2025). Antioxidative Effects of Curcumin on Erastin-Induced Ferroptosis Through GPX4 Signalling. Gastrointestinal Disorders, 7(1), 4. https://doi.org/10.3390/gidisord7010004