Identification and Characterization of Metabolic Potential of Different Strains from Genus Rhizobium ^†

Abstract

Bacteria of the Rhizobium genus form a group of microorganisms existing in the environment in two forms: symbiotic, in the root nodules of Fabaceae sp. plants and free-living, and saprophytic in the soil environment. The subject of this study was genetic identification and characterization of metabolic activity of different strains from Rhizobium genus bacteria. The study was conducted on the 16 bacteria strains from the collection of the Department of Agricultural Microbiology, Institute of Soil Science and Plant Cultivation in Puławy, Poland. Based on the sequencing of PCR products, we found that all strains belong to one species—Rhizobium leguminosarum. The study of metabolic activity was performed using the GEN III BIOLOG system method (Biolog Inc., Hayward, CA, USA). Metabolism analysis of all R. leguminosarum strains with the use of GEN III™ plates showed that carbohydrates (CH) were the most intensively utilised group of substrates. Between the Rhizobium leguminosarum strains, there are metabolic differences in terms of the studied features.

1. Introduction

Bacteria of the Rhizobium genus form a group of microorganisms existing in the environment in two forms: symbiotic, in the root nodules of Fabaceae sp. plants and free-living, and saprophytic in the soil environment [1]. Inside of the root, these bacteria differentiate into nitrogen-fixing bacteroids [2]. The basic function of Rhizobium sp. in a symbiosis is to reduce nitrogen to ammonia directly assimilated by the plant. Nitrogen reduction occurs with the participation of enzymatic nitrogenase complex [3]. The subject of study was genetic identification and characterization of metabolic activity of different strains from Rhizobium genus.

2. Material and Methods

2.1. Bacterial Strains

The study was conducted on the 16 bacteria strains from the collection of Department of Agricultural Microbiology, Institute of Soil Science and Plant Cultivation in Puławy, Poland. Bacteria strains were isolated from root nodules derived from plans of the genus Trifolium. The collection of bacterial strains was obtained from the roots of plants growing in many locations, mainly in Poland (

Table 1. Source of bacterial strains.

Strain Symbol	Location	Plant	Year
C37	Poland, Lublin	Trifolium sp.	1960
209	USA, Madison	Trifolium sp.	1960
325a	USSR, Leningrad (now Russia, Petersburg)	Trifolium sp.	1957
G	Poland, Gnojno	Trifolium sp.	1994
G4	Poland, Grabów	White clover (T. repens L.)	1995
KB	Poland, Grabów	White clover (T. repens L.)	1995
KR	Poland, Puławy	Red clover (T. pratense L.), var. “Raba”	1996
K1	Poland, Stare Pole	Trifolium sp.	2000
K3	Poland, Łabunie	Trifolium sp.	2000
K10	Poland, Opatów	Trifolium sp.	2000
K18	Poland, Puławy	White clover (T. repens L.)	2004
K20	Poland, Puławy	White clover (T. repens L.)	2004
K 99/4	Poland, Puławy	Trifolium sp. *	1998
K 99/11	Poland, Wielichowo	Trifolium sp.	1999
K 99/12	Poland, Wielichowo	Trifolium sp.	1999
K 99/13	Poland, Wielichowo	Trifolium sp.	1999

* Strain was isolated from plants growing in soil contaminated with heavy metals.

).

2.2. PCR and Sequencing

For PCR, a small amount of material was taken from a single bacterial colony and transferred to a sterile eppendorf with 20 µL of MiliQ water. The samples were thoroughly mixed, and 1 µL was taken from the mixture for the PCR reaction. The 16S rDNA region was amplified using primers: 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT) [4]. The PCR products were sequenced in Genomed S.A (Warsaw, Poland) using the same primers as at the PCR step. The sequences from both primers were assembled in Unipro UGENE 1.25 software [5], and the Blast search was performed [6].

2.3. Biolog GEN III

The study of metabolic activity was performed using the GEN III BIOLOG system method (Biolog Inc., Hayward, CA, USA). The GEN III microplate contains 94 phenotypic tests: 71 carbon source utilization assays and 23 chemical sensitivity assays. Tetrazolium dyes from the wells of the microplate were used to indicate the use of carbon sources or resistance to inhibitory chemicals by microorganisms. The cell suspensions were inoculated into the 134 GEN III™ (100 μL per well) and incubated at 25 °C for 7 days. The intensity of colour development was recorded at λ = 590 nm at 24 h intervals for a period of 168 h. The results obtained at 168 h are presented because the most intensive substrate decomposition was observed after this incubation time.

2.4. Data Analysis and Visualisation

Heatmaps were generated using GenIII Omnilog values (data after 168 h of incubation) with R software (version 3.5.1, Northern Ave, Boston, MA, USA) and pheatmap package. Similarity trees were constructed using Bray–Curtis cluster analysis with the UPGMA method [7].

Statistical analyses were performed using the packet Statistica.PL ver. 10.0 (StatSoft. Inc., Tulsa, OK, USA). The dendrogram applied Ward’s method clustering and the squared Euclidean distance matrix calculation method [8].

3. Results

3.1. Bacterial Species

PCR products from all the isolates were compared with a size marker, and a product with an expected size of about 1500 bp was found (Figure 1). Based on the sequencing of PCR products, we found that all strains belong to one species—Rhizobium leguminosarum with a sequence identity of 97–100% (NCBI GenBank,

Table 2. The identification of bacteria strains (NCBI GenBank).

Strain Symbol	Closest Species	Identity
209	Rhizobium legiuminosarum	100%
G	Rhizobium legiuminosarum	100%
K10	Rhizobium legiuminosarum	100%
K99/12	Rhizobium legiuminosarum	100%
K99/4	Rhizobium legiuminosarum	100%
KR	Rhizobium legiuminosarum	100%
C37	Rhizobium legiuminosarum	99%
325a	Rhizobium legiuminosarum	99%
G4	Rhizobium legiuminosarum	99%
K3	Rhizobium legiuminosarum	99%
K99/11	Rhizobium legiuminosarum	99%
K99/13	Rhizobium legiuminosarum	99%
KB	Rhizobium legiuminosarum	99%
K1	Rhizobium legiuminosarum	98%
K20	Rhizobium legiuminosarum	97%
K18	Rhizobium legiuminosarum	97%

All sequences are available at the NCBI database under accession number: SUB7603645.

) [6].

3.2. Metabolic Activity of Rhizobium Leguminosarum Bacteria

Based on results, the heat maps were made (Figure 2) and the cluster analysis according to Ward’s method conducted, thus illustrating the diversity of strains in terms of the intensity and pace of the consumption of the individual compounds (Figure 3).

Metabolism analysis of all R. leguminosarum strains with the use of GEN III™ plates showed that carbohydrates (CH) were the most intensively utilised group of substrates. Between the Rhizobium leguminosarum strains, there were metabolic differences in terms of the studied features (Figure 2). This may indicate the adaptive capacity of microorganisms to the environmental conditions in which they currently live. Based on the cluster analysis, 3 groups of microorganisms were isolated in terms of the intensity of decomposition of the tested compounds (Figure 3). The most active strains in terms of use of all types of carbon substrates were strains 209, K99/12, 325a and G4.

4. Conclusions

In conclusion, it can be stated that, between the Rhizobium leguminosarum strains, there are metabolic differences in terms of the studied features. This may indicate the adaptive capacity of microorganisms to the environmental conditions in which they currently live.