Next Article in Journal
Allium cepa L. Inoculation with a Consortium of Plant Growth-Promoting Bacteria: Effects on Plant Growth and Development and Soil Fertility Status and Microbial Community
Previous Article in Journal
The Role of Storage Systems in Industrial and Residential Environments
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Proceeding Paper

Identification and Characterization of Metabolic Potential of Different Strains from Genus Rhizobium †

Department of Agricultural Microbiology, Institute of Soil Science and Plant Cultivation State Research Institute, Czartoryskich 8, 24-100 Puławy, Poland
*
Author to whom correspondence should be addressed.
Presented at the 1st International Electronic Conference on Microbiology, 2–30 November 2020. Available online: https://ecm2020.sciforum.net/.
Proceedings 2020, 66(1), 19; https://doi.org/10.3390/proceedings2020066019
Published: 8 January 2021
(This article belongs to the Proceedings of The 1st International Electronic Conference on Microbiology)

Abstract

:
Bacteria of the Rhizobium genus form a group of microorganisms existing in the environment in two forms: symbiotic, in the root nodules of Fabaceae sp. plants and free-living, and saprophytic in the soil environment. The subject of this study was genetic identification and characterization of metabolic activity of different strains from Rhizobium genus bacteria. The study was conducted on the 16 bacteria strains from the collection of the Department of Agricultural Microbiology, Institute of Soil Science and Plant Cultivation in Puławy, Poland. Based on the sequencing of PCR products, we found that all strains belong to one species—Rhizobium leguminosarum. The study of metabolic activity was performed using the GEN III BIOLOG system method (Biolog Inc., Hayward, CA, USA). Metabolism analysis of all R. leguminosarum strains with the use of GEN III™ plates showed that carbohydrates (CH) were the most intensively utilised group of substrates. Between the Rhizobium leguminosarum strains, there are metabolic differences in terms of the studied features.

1. Introduction

Bacteria of the Rhizobium genus form a group of microorganisms existing in the environment in two forms: symbiotic, in the root nodules of Fabaceae sp. plants and free-living, and saprophytic in the soil environment [1]. Inside of the root, these bacteria differentiate into nitrogen-fixing bacteroids [2]. The basic function of Rhizobium sp. in a symbiosis is to reduce nitrogen to ammonia directly assimilated by the plant. Nitrogen reduction occurs with the participation of enzymatic nitrogenase complex [3]. The subject of study was genetic identification and characterization of metabolic activity of different strains from Rhizobium genus.

2. Material and Methods

2.1. Bacterial Strains

The study was conducted on the 16 bacteria strains from the collection of Department of Agricultural Microbiology, Institute of Soil Science and Plant Cultivation in Puławy, Poland. Bacteria strains were isolated from root nodules derived from plans of the genus Trifolium. The collection of bacterial strains was obtained from the roots of plants growing in many locations, mainly in Poland (Table 1).

2.2. PCR and Sequencing

For PCR, a small amount of material was taken from a single bacterial colony and transferred to a sterile eppendorf with 20 µL of MiliQ water. The samples were thoroughly mixed, and 1 µL was taken from the mixture for the PCR reaction. The 16S rDNA region was amplified using primers: 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT) [4]. The PCR products were sequenced in Genomed S.A (Warsaw, Poland) using the same primers as at the PCR step. The sequences from both primers were assembled in Unipro UGENE 1.25 software [5], and the Blast search was performed [6].

2.3. Biolog GEN III

The study of metabolic activity was performed using the GEN III BIOLOG system method (Biolog Inc., Hayward, CA, USA). The GEN III microplate contains 94 phenotypic tests: 71 carbon source utilization assays and 23 chemical sensitivity assays. Tetrazolium dyes from the wells of the microplate were used to indicate the use of carbon sources or resistance to inhibitory chemicals by microorganisms. The cell suspensions were inoculated into the 134 GEN III™ (100 μL per well) and incubated at 25 °C for 7 days. The intensity of colour development was recorded at λ = 590 nm at 24 h intervals for a period of 168 h. The results obtained at 168 h are presented because the most intensive substrate decomposition was observed after this incubation time.

2.4. Data Analysis and Visualisation

Heatmaps were generated using GenIII Omnilog values (data after 168 h of incubation) with R software (version 3.5.1, Northern Ave, Boston, MA, USA) and pheatmap package. Similarity trees were constructed using Bray–Curtis cluster analysis with the UPGMA method [7].
Statistical analyses were performed using the packet Statistica.PL ver. 10.0 (StatSoft. Inc., Tulsa, OK, USA). The dendrogram applied Ward’s method clustering and the squared Euclidean distance matrix calculation method [8].

3. Results

3.1. Bacterial Species

PCR products from all the isolates were compared with a size marker, and a product with an expected size of about 1500 bp was found (Figure 1). Based on the sequencing of PCR products, we found that all strains belong to one species—Rhizobium leguminosarum with a sequence identity of 97–100% (NCBI GenBank, Table 2) [6].

3.2. Metabolic Activity of Rhizobium Leguminosarum Bacteria

Based on results, the heat maps were made (Figure 2) and the cluster analysis according to Ward’s method conducted, thus illustrating the diversity of strains in terms of the intensity and pace of the consumption of the individual compounds (Figure 3).
Metabolism analysis of all R. leguminosarum strains with the use of GEN III™ plates showed that carbohydrates (CH) were the most intensively utilised group of substrates. Between the Rhizobium leguminosarum strains, there were metabolic differences in terms of the studied features (Figure 2). This may indicate the adaptive capacity of microorganisms to the environmental conditions in which they currently live. Based on the cluster analysis, 3 groups of microorganisms were isolated in terms of the intensity of decomposition of the tested compounds (Figure 3). The most active strains in terms of use of all types of carbon substrates were strains 209, K99/12, 325a and G4.

4. Conclusions

In conclusion, it can be stated that, between the Rhizobium leguminosarum strains, there are metabolic differences in terms of the studied features. This may indicate the adaptive capacity of microorganisms to the environmental conditions in which they currently live.

Author Contributions

K.G. and A.G. conceived and designed the experiments; K.G., K.F. and J.G. performed the experiments and analysed the data; K.G. and K.F. wrote the paper. All authors have read and agreed to the published version of the manuscript.

Funding

The research was partially funded by the Ministry of Science and Higher Education, research task: “Determination of the effect of co-inoculation of clover (Trifolium pretense L.) with Azospirillum spp. and Rhizobium spp. for the growth and nodulation of plants under conditions of contamination by polycyclic aromatic hydrocarbons”/2016 and the frames of Task 1.4. Multi—Annual Programme IUNG—PIB (2016–2020).

Conflicts of Interest

The authors declare no conflict of interest. The founding sponsors had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, and in the decision to publish the results.

References

  1. Stasiak, G.; Mazur, A.; Koper, P.; Żebracki, K.; Skorupska, A. Symbiosis of rhizobia with legume plants (Fabaceae). Postep. Mikrobiol. 2016, 55, 289–299. [Google Scholar]
  2. Kereszt, A.; Mergaert, P.; Kondorosi, E. Bacteroid development in legume nodules: Evolution of mutual benefit or of sacrificial victims? Mol. Plant-Microbe Interact. 2011, 24, 1300–1309. [Google Scholar] [CrossRef]
  3. Oke, V.; Long, S.R. Bacteroid formation in the Rhizobium-legume symbiosis. Curr. Opin. Microbiol. 1999, 2, 641–646. [Google Scholar] [CrossRef] [PubMed]
  4. Weisburg, W.G.; Barns, S.M.; Pelletier, D.A.; Lane, D.J. 16S Ribosomal DNA Amplification for Phylogenetic Study. J. Bacteriol. 1991, 173, 697–703. [Google Scholar] [CrossRef] [PubMed]
  5. Okonechnikov, K.; Golosova, O.; Fursov, M. UGENE team Unipro UGENE: A unified bioinformatics toolkit. Bioinformatics 2012, 28, 1166–1167. [Google Scholar] [CrossRef] [PubMed]
  6. Blast NCBI. Available online: https://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 10 October 2019).
  7. McMurdie, P.J.; Holmes, S. phyloseq: An R Package for Reproducible Interactive Analysis and Graphics of Microbiome Census Data. PLoS ONE 2013, 8, e61217. [Google Scholar] [CrossRef] [PubMed]
  8. Ward, J.H. Hierarchical Grouping to Optimize an Objective Function. J. Am. Stat. Assoc. 1963, 58, 236–244. [Google Scholar] [CrossRef]
Figure 1. Picture of polyacrylamide gel electrophoresis.
Figure 1. Picture of polyacrylamide gel electrophoresis.
Proceedings 66 00019 g001
Figure 2. Heatmaps for the carbon utilization patterns of the substrates GEN III grouped into three biochemical groups: (a) carbohydrates, (b) amino acids, (c) fatty acids, by each strain of Rhizobium leguminosarum. Data are shown after 168 h of incubation. The gradient from light blue to red represents positive utilization.
Figure 2. Heatmaps for the carbon utilization patterns of the substrates GEN III grouped into three biochemical groups: (a) carbohydrates, (b) amino acids, (c) fatty acids, by each strain of Rhizobium leguminosarum. Data are shown after 168 h of incubation. The gradient from light blue to red represents positive utilization.
Proceedings 66 00019 g002
Figure 3. Dendrogram showing division of Rhizobium leguminosarum strains due to the use of carbohydrates, amino acids, and fatty acids as a carbon sources after 168 h incubation.
Figure 3. Dendrogram showing division of Rhizobium leguminosarum strains due to the use of carbohydrates, amino acids, and fatty acids as a carbon sources after 168 h incubation.
Proceedings 66 00019 g003
Table 1. Source of bacterial strains.
Table 1. Source of bacterial strains.
Strain SymbolLocationPlantYear
C37Poland, LublinTrifolium sp.1960
209USA, MadisonTrifolium sp.1960
325aUSSR, Leningrad
(now Russia, Petersburg)
Trifolium sp.1957
GPoland, GnojnoTrifolium sp.1994
G4Poland, GrabówWhite clover (T. repens L.)1995
KBPoland, GrabówWhite clover (T. repens L.)1995
KRPoland, PuławyRed clover (T. pratense L.), var. “Raba”1996
K1Poland, Stare PoleTrifolium sp.2000
K3Poland, ŁabunieTrifolium sp.2000
K10Poland, OpatówTrifolium sp.2000
K18Poland, Puławy White clover (T. repens L.)2004
K20Poland, PuławyWhite clover (T. repens L.)2004
K 99/4Poland, PuławyTrifolium sp. *1998
K 99/11Poland, WielichowoTrifolium sp.1999
K 99/12Poland, WielichowoTrifolium sp.1999
K 99/13Poland, WielichowoTrifolium sp.1999
* Strain was isolated from plants growing in soil contaminated with heavy metals.
Table 2. The identification of bacteria strains (NCBI GenBank).
Table 2. The identification of bacteria strains (NCBI GenBank).
Strain SymbolClosest SpeciesIdentity
209Rhizobium legiuminosarum100%
GRhizobium legiuminosarum100%
K10Rhizobium legiuminosarum100%
K99/12Rhizobium legiuminosarum100%
K99/4Rhizobium legiuminosarum100%
KRRhizobium legiuminosarum100%
C37Rhizobium legiuminosarum99%
325aRhizobium legiuminosarum99%
G4Rhizobium legiuminosarum99%
K3Rhizobium legiuminosarum99%
K99/11Rhizobium legiuminosarum99%
K99/13Rhizobium legiuminosarum99%
KBRhizobium legiuminosarum99%
K1Rhizobium legiuminosarum98%
K20Rhizobium legiuminosarum97%
K18Rhizobium legiuminosarum97%
All sequences are available at the NCBI database under accession number: SUB7603645.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Gawryjołek, K.; Furtak, K.; Grządziel, J.; Gałązka, A. Identification and Characterization of Metabolic Potential of Different Strains from Genus Rhizobium. Proceedings 2020, 66, 19. https://doi.org/10.3390/proceedings2020066019

AMA Style

Gawryjołek K, Furtak K, Grządziel J, Gałązka A. Identification and Characterization of Metabolic Potential of Different Strains from Genus Rhizobium. Proceedings. 2020; 66(1):19. https://doi.org/10.3390/proceedings2020066019

Chicago/Turabian Style

Gawryjołek, Karolina, Karolina Furtak, Jarosław Grządziel, and Anna Gałązka. 2020. "Identification and Characterization of Metabolic Potential of Different Strains from Genus Rhizobium" Proceedings 66, no. 1: 19. https://doi.org/10.3390/proceedings2020066019

Article Metrics

Back to TopTop