Next Article in Journal
Prevalence of Hepatitis B Virus Infection among Inmates at the Monrovia Central Prison, Liberia
Previous Article in Journal
Association between Meningococcal Meningitis and Santa Ana Winds in Children and Adolescents from Tijuana, Mexico: A Need for Vaccination
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
TropicalMed
Volume 8
Issue 3
10.3390/tropicalmed8030137
tropicalmed-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Brief Report

Pneumocystis jirovecii Colonization in Mexican Patients with Chronic Obstructive Pulmonary Disease

by
Marcela Plascencia-Cruz
1,2,
Arturo Plascencia-Hernández
2,3,
Yaxsier De Armas-Rodríguez
4,
Gabino Cervantes-Guevara
5,6,
Guillermo Alonso Cervantes-Cardona
2,
Sol Ramírez-Ochoa
1,
Alejandro González-Ojeda
7,
Clotilde Fuentes-Orozco
7,
Francisco Javier Hernández-Mora
8,
Carlos Miguel González-Valencia
9,
Andrea Pérez de Acha-Chávez
10 and
Enrique Cervantes-Pérez
1,2,*
1
Department of Internal Medicine, Hospital Civil de Guadalajara “Fray Antonio Alcalde”, Guadalajara 44280, Jalisco, Mexico
2
Health Sciences University Center, Universidad de Guadalajara, Guadalajara 44100, Jalisco, Mexico
3
Department of Pediatric Infectious Diseases, Hospital Civil de Guadalajara “Fray Antonio Alcalde”, Guadalajara 44280, Jalisco, Mexico
4
Molecular Biology Laboratory, Instituto de Medicina Tropical “Pedro Kourí”, La Habana 11400, Cuba
5
Department of Welfare and Sustainable Development, Centro Universitario del Norte, Universidad de Guadalajara, Colotlán 46200, Jalisco, Mexico
6
Department of Gastroenterology, Hospital Civil de Guadalajara “Fray Antonio Alcalde”, Guadalajara 44280, Jalisco, Mexico
7
Biomedical Research Unit 02, Specialties Hospital of the Western National Medical Center, Mexican Institute of Social Security, Guadalajara 44329, Jalisco, Mexico
8
Human Reproduction, Growth and Child Development Clinic, Health Sciences University Center, Universidad de Guadalajara, Guadalajara 44100, Jalisco, Mexico
9
Department of Research Ethics, Hospital Hispano, Guadalajara 44140, Jalisco, Mexico
10
Department of Geriatrics, Instituto Nacional de Ciencias Médicas y Nutrición Salvador Zubirán, Mexico City 14080, Mexico
*
Author to whom correspondence should be addressed.
Trop. Med. Infect. Dis. 2023, 8(3), 137; https://doi.org/10.3390/tropicalmed8030137
Submission received: 18 January 2023 / Revised: 20 February 2023 / Accepted: 21 February 2023 / Published: 24 February 2023
(This article belongs to the Section Infectious Diseases)
Review Reports Versions Notes

Abstract

:
The prevalence of colonization by Pneumocystis jirovecii (P. jirovecii) has not been studied in Mexico. We aimed to determine the prevalence of colonization by P. jirovecii using molecular detection in a population of Mexican patients with chronic obstructive pulmonary disease (COPD) and describe their clinical and sociodemographic profiles. We enrolled patients discharged from our hospital diagnosed with COPD and without pneumonia (n = 15). The primary outcome of this study was P. jirovecii colonization at the time of discharge, as detected by nested polymerase chain reaction (PCR) of oropharyngeal wash samples. The calculated prevalence of colonization for our study group was 26.66%. There were no statistically significant differences between COPD patients with and without colonization in our groups. Colonization of P. jirovecii in patients with COPD is frequent in the Mexican population; the clinical significance, if any, remains to be determined. Oropharyngeal wash and nested PCR are excellent cost-effective options to simplify sample collection and detection in developing countries and can be used for further studies.

1. Introduction

The risks and prevalence of colonization by Pneumocystis jirovecii (P. jirovecii) in patients with chronic obstructive pulmonary disease (COPD) have been studied in the past; however, there is no consensus regarding the risk of colonization, and the prevalence in different populations is widely variable (ranging from 16 to 55%) [1,2,3]. Nested polymerase chain reaction (PCR) is a cost-effective modification of the standard PCR that serves to increase the sensitivity and specificity of the test even when the level of DNA in a sample is low, making this technique a good method for detection that has been used in previous studies [2,3,4,5,6].
Only a few reports have described a possible association with colonization by P. jirovecii and a rise in disease severity and/or inflammatory response in patients with COPD without human immunodeficiency virus (HIV) infection [5,6,7,8,9]. The relationship between COPD exacerbations and the presence of P. jirovecii has been suggested in some studies; however, it has not been fully elucidated [7]. Some hypotheses have been proposed regarding the possible association of P. jirovecii with an increase in the inflammatory response and how it may influence the pathophysiology of COPD [8]. Obtaining the prevalence in different populations is a first step toward understanding this phenomenon and investigating its clinical relevance.
To our knowledge, there is no published evidence of the prevalence of colonization by P. jirovecii in Mexican patients with COPD.
In this exploratory study, we aimed to determine the prevalence of colonization by P. jirovecii in a small population of Mexican patients with COPD and describe their clinical and sociodemographic profiles with the goal of identifying possible associations for future studies.

2. Materials and Methods

For this analytical cross-sectional exploratory study, we enrolled individuals discharged from the Unit of Internal Medicine of the Hospital Civil de Guadalajara Fray Antonio Alcalde (HCG), located in Guadalajara, Mexico, between April and December 2019. Patients who were diagnosed with COPD in accordance with Global Initiative for Chronic Obstructive Lung Disease Guidelines [10] without clinical and/or radiological signs of active pneumonia and who were able and willing to give an oropharyngeal wash (OPW) sample were selected for the study. All patients showed HIV rapid test negativity before OPW sample collection and were without HIV infection or acquired immunodeficiency syndrome (AIDS) diagnosis. Patient demographics, clinical, imaging, and laboratory data and outcomes were extracted from medical records.
The primary objective of this study was to use nested PCR to determine the prevalence of colonization by P. jirovecii in COPD patients in our study group. To address this objective, oropharyngeal washes were obtained using a well-established protocol [11]. The genetic material of P. jirovecii was purified from the OPW sample using the QIAamp DNA reagent kit (Qiagen, Barcelona, Spain) according to the manufacturer’s instructions. The DNA was stored at −20 °C until use. For the amplification of the genetic material of P. jirovecii, a 347 base pair (bp) fragment (sequence 5′-3′: GATGGCTGTTTCCAAGCCCAGTGTACGTTGCAAAGTACTC) in the first reaction and a 260 bp fragment (sequence 5′-3′: GTGAAATACAAATCGGACTAGGTCACTTAATATTAATTGGGGAGC) in the second reaction of the gene that codes for the mitochondria large subunit ribosomal ribonucleic acid gene (mt LSU rRNA) were the target sequences [12]. Briefly, 50 μL of reaction mixture was prepared for the first and second rounds of amplification of the P. jirovecii DNA, obtained from the OPW sample of the patients. The reaction mixture contained 10 mM Tris/HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 200 μM deoxyribonucleotides (dNTPs), 0.5 μM primers, 2 units of Taq DNA polymerase, and 5 μL of template DNA (Bioline, London, UK). The amplification profile was the same for the first and second rounds: 94 °C for 4 min, 40 cycles of 1 min at 94 °C, 1 min at 55 °C, and 1.5 min at 72 °C, with a final extension of 7 min at 72 °C. The primers used were synthesized by Invitrogen (Life Technologies S.A., Madrid, Spain). The amplification reaction was carried out using a Biometra TGradient thermal cycler (Whatman Biometra, Minden, Germany). A negative control was used for each assay, whereby the reaction mixture contained sterile distilled water instead of template DNA. A positive control (DNA from an OPW sample of an HIV-positive patient with Pneumocystis jirovecii pneumonia (PcP), as verified by microscopic staining and PCR methods), was also included in each amplification reaction.
To prevent contamination, pipettes with filters were used for all manipulations. DNA extraction and preparation of the reaction mixture were performed in two different rooms using separate laminar-flow hoods. The PCR procedure and analysis of PCR products were performed in another room. Control samples were performed simultaneously with the OPW samples.
A positive result in the first and second rounds of amplification, with clinical signs and symptoms and/or radiological signs compatible with pneumonia, was considered PcP. A positive result only in the second round, without clinical or radiological signs of PcP, was considered colonization [13].
For the data and statistical analysis, absolute and relative frequencies were calculated for all qualitative variables and are presented as percentages and proportions. Proportions were compared through Fisher’s test, and confidence intervals (CI) were calculated. Quantitative variables were analyzed with measures of central tendency and dispersion (median and standard deviation), and differences between groups were analyzed with Student’s t-test. All statistical analyses were performed with GraphPad Prism version 9.3.1.471 (Dotmatics, Boston, MA, USA). All p values < 0.05 within a confidence interval of 95% were considered statistically significant.

3. Results

Of the 50 patients with a COPD diagnosis in the period of our study, only 15 (30%) were included in accordance with the inclusion criteria. Other COPD patients (n = 35, 70%) were excluded due to the inability to obtain an OPW sample for analysis.
For the first reaction of the one-round PCR, none of the patient samples were positive using the primary reaction primers; however, 4 of the 15 samples were positive in the nested PCR with the second round of primers. The calculated prevalence of colonization by P. jirovecii in this group of patients was 26.7%.
Table 1 shows the sociodemographic characteristics together with clinical and biochemical data for the study groups.
All OPW samples were sent to microbiological culture for the isolation of bacteria. Pseudomonas aeruginosa was isolated in one (25%) patient with colonization by P. jirovecii vs. eight (72.7%) patients without colonization by P. jirovecii. In two patients with colonization by P. jirovecii, Streptococcus viridians and Neisseria spp. were also isolated, and Acinetobacter baumannii was isolated in two different patients of the same group; none of these bacteria were isolated in patients who were not colonized by P. jirovecii.

4. Discussion

The prevalence rate of colonization by P. jirovecii in COPD patients in this study group was 26.7%. To our knowledge, this is the first study to describe this parameter and the clinical profile of COPD patients colonized with P. jirovecii in a Mexican population (albeit a small study group), and further studies with a larger study group and scope are needed. Additionally, the method used for sample collection for nested PCR was OPW, which is a cost-effective and noninvasive method for sample collection and diagnosis [14].
The issue of the colonization of P. jirovecii and other fungi has been addressed more frequently in recent years [3], with the advent of molecular techniques that favor more accurate detection; however, as mentioned, the clinical relevance is not yet clear or well understood [15,16,17]. Although the clinical manifestations of P. jirovecii infection have so far been associated with severe immunosuppression (especially that associated with AIDS) [11], moderate immunosuppression, which can be caused by multiple factors, including the proinflammatory state secondary to COPD [18], has been associated with predisposition for colonization [18,19]. Colonization plays an important role in the mechanism of P. jirovecii transmission [20]. Patients with colonization can be the source of infection in a susceptible population, and they themselves can develop PcP if they have immunosuppression [21,22,23,24]. Studies on animals and humans [12,20] have documented a possible role in the local and systemic inflammatory response accompanied by structural changes and impaired lung function that can be caused by Pneumocystis colonization [2,20]. There is still no conclusive evidence of causation or clinical significance [3].
In this study, all samples were obtained through OPW, a noninvasive procedure that can be used to study the prevalence and effects of colonization by P. jirovecii in various clinical settings [14]. There are a variety of new molecular techniques that can increase sensitivity and specificity to detect microorganisms, and they can be applied to samples obtained from less-invasive procedures, such as OPW [14,25]. In developing countries, access to various molecular techniques is difficult, and there are often not enough specialized personnel for sampling with invasive procedures, such as bronchoalveolar lavage (BAL). Although BAL is a sensitive technique for the isolation of P. jirovecii [21,22,23], especially in the case of colonization due to the low fungal load, noninvasive tests have shown good sensitivity for detection [14], and have the advantage of being able to be performed with greater ease than more invasive tests such as BAL in certain clinical scenarios when the patient’s state of health could prevent sample collection. One of the ways to increase the sensitivity of noninvasive tests is to use two paired tests (such as OPW and, for example, nasal swab), thus minimizing underestimation of P. jirovecii colonization [14].
The prevalence of colonization in COPD is quite variable (from 10 to 65%) [3]; this may be due to the techniques used to assess the prevalence, since molecular techniques are much more sensitive than staining [4]. With the extensive use of these molecular techniques, such as nested PCR, we could gain a better idea of the real prevalence of colonization in this patient population [20,26,27].
Interestingly, it has been seen that HIV-infected patients colonized by P. jirovecii have up to an 8-fold higher risk of airway obstruction compared to noncolonized patients [9]; however, in non-HIV-infected patients, no similar relationship was found, even though several studies have reported a higher prevalence of colonization in patients with severe COPD compared to those with moderate COPD [28]. Some of these studies have associated this finding with the severity of the disease, intuiting a causal association; however, the evidence in this regard is not conclusive [20,28].
Some animal studies have detected an association between colonization by P. jirovecii and impaired lung function [29], while in humans the only causal association, whose clinical implication is still unknown, is the increase in the systemic inflammatory response and increased Th1 activity [8,20]. This inflammatory response could generate a decrease in the lung defense mechanisms and an alteration of the lung microbiome and function [30,31]. In our study, spirometry values and long-term follow-up were unavailable.
We did not find statistically significant differences in our sample of patients, but even though this prevents us from drawing conclusions about possible clinical associations with colonization, it confirms information reported in the international literature about the high prevalence of colonization in patients with COPD [2,3,4]. Hence, future studies with a larger study group that allows us to determine the clinical and epidemiological relevance in our population are needed. If an association between colonization with P. jirovecii and impaired lung function could be verified in the future, it would be worth investigating the colonization time necessary for the increased risk of deterioration. For this, we need to take into account the current evidence about the possible cyclical nature of colonization in patients without HIV infection [32,33]. For example, in patients with cystic fibrosis, a constant cycle of clearance and permanence of colonization by P. jirovecii was observed with genotypic variation in the strains in each cycle [34].
There are some reports with possible associations with the occurrence of exacerbation or the deterioration of lung function in patients with COPD [3,35,36], but more studies that include a wide variety of populations are still needed in this regard.
The limitations of this study are as follows: the sample size of patients was small, and because of this, it was difficult to establish clinical and statistically significant differences for the variables; pairing OPW with another noninvasive method for sample collection might have increased the sensitivity and given us a better sense of the prevalence in our population [14]; lastly, the nature of this study was exploratory, so a future study would greatly benefit from the establishment of a proper statistical hypothesis and sample size calculation for the study group.
Although this exploratory study has various limitations, it adds more evidence to the data in the scientific literature about the prevalence of colonization of P. jirovecii in patients with COPD [3,36], which warrants future research. These findings are relevant to obtaining better knowledge on the current state of the prevalence of P. jirovecii in this population of patients and geographical context, its importance as a research topic, and by carrying out studies with a larger number of patients and molecular techniques that even allow for us to detect the microbiological load (such as RT-PCR), and determine its possible clinical relevance and/or role in the cycle of transmission to the immunosuppressed population with a higher risk of presenting PcP [3]. The molecular techniques at our disposal are far more powerful and accessible than the techniques available a few years ago, and procedures such as OPW are cost-effective options for easy sample collection, especially in developing countries.

Author Contributions

Conceptualization, E.C.-P. and G.C.-G.; methodology, M.P.-C.; formal analysis, G.A.C.-C., C.M.G.-V., and Y.D.A.-R.; investigation, M.P.-C. and A.P.-H.; resources, M.P.-C. and F.J.H.-M.; data curation, A.G.-O. and C.F.-O.; writing—original draft preparation, A.P.d.A.-C. and C.M.G.-V.; writing—review and editing, C.M.G.-V. and E.C.-P.; supervision, E.C.-P.; project administration, S.R.-O. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki, and approved by the Institutional Review Board (or Ethics Committee) of Hospital Civil de Guadalajara Fray Antonio Alcalde (protocol code R-150/22).

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

The data presented in this study are available on request from the corresponding author. The data are not publicly available due to ethical and privacy reasons.

Acknowledgments

We acknowledge Janet Cristina Vázquez-Beltrán for designing the graphical abstract.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Morilla, R.; Martínez-Rísquez, M.T.; De La Horra, C.; Friaza, V.; Martín-Juan, J.; Romero, B.; Conde, M.; Varela, J.M.; Calderón, E.J.; Medrano, F.J. Airborne acquisition of Pneumocystis in bronchoscopy units: A hidden danger to healthcare workers. Med. Mycol. 2018, 57, 542–547. [Google Scholar] [CrossRef] [PubMed]
  2. Morris, A.; Wei, K.; Afshar, K.; Huang, L. Epidemiology and clinical significance of pneumocystis colonization. J. Infect. Dis. 2008, 197, 10–17. [Google Scholar] [CrossRef] [Green Version]
  3. Vera, C.; Vanessa Rueda, Z. Transmission and colonization of Pneumocystis jirovecii. J. Fungi 2021, 7, 979. [Google Scholar] [CrossRef] [PubMed]
  4. Santos, C.R.; de Assis, M.; Luz, E.A.; Lyra, L.; Toro, I.F.; Seabra, J.C.C.; Daldin, D.H.; Marcalto, T.U.; Galasso, M.T.; Macedo, R.F.; et al. Detection of Pneumocystis jirovecii by nested PCR in HIV-negative patients with pulmonary disease. Rev. Iberoam Micol. 2017, 34, 83–88. [Google Scholar] [CrossRef] [PubMed]
  5. de Armas, Y.; Friaza, V.; Capó, V.; Durand-Joly, I.; Govín, A.; de la Horra, C.; Dei-Cas, E.; Calderón, E.J. Low genetic diversity of Pneumocystis jirovecii among Cuban population based on two-locus mitochondrial typing. Med. Mycol. 2012, 50, 417–420. [Google Scholar] [CrossRef] [Green Version]
  6. Varela, J.M.; Respaldiza, N.; Sánchez, B.; De La Horra, C.; Montes-Cano, M.; Rincón, M.; Dapena, J.; González-Becerra, C.; Medrano, F.J.; Calderón, E. Lymphocyte response in subjects with chronic pulmonary disease colonized by Pneumocystis jirovecii. J. Eukaryot. Microbiol. 2003, 50, 672–673. [Google Scholar] [CrossRef]
  7. Sivam, S.; Sciurba, F.C.; Lucht, L.A.; Zhang, Y.; Duncan, S.R.; Norris, K.A.; Morris, A. Distribution of Pneumocystis jirovecii in lungs from colonized COPD patients. Diagn. Microbiol. Infect. Dis. 2011, 71, 24–28. [Google Scholar] [CrossRef] [Green Version]
  8. Fitzpatrick, M.E.; Tedrow, J.R.; Hillenbrand, M.E.; Lucht, L.; Richards, T.; Norris, K.A.; Zhang, Y.; Sciurba, F.C.; Kaminski, N.; Morris, A. Pneumocystis jirovecii colonization is associated with enhanced Th1 inflammatory gene expression in lungs of humans with chronic obstructive pulmonary disease. Microbiol. Immunol. 2014, 58, 202–211. [Google Scholar] [CrossRef] [Green Version]
  9. De La Horra, C.; Medrano, F.J.; Montes-Cano, M.A.; Respaldiza, N.; Varela, J.M.; López-Suárez, A.; Elvira-González, J.; Martín-Juan, J.; Bascuñana, A.; Calderón, E. Pneumocystis jiroveci isolates with dihydropteroate synthase mutations in patients with chronic bronchitis. Eur. J. Clin. Microbiol. Infect. Dis. 2004, 23, 545–549. [Google Scholar]
  10. Global Initiative for Chronic Obstructive Lung Disease. Global Strategy for The Diagnosis, Management, and Prevention of Chronic Obstructive Pulmonary Disease. 2022 Report. Available online: https://goldcopd.org/wp-content/uploads/2021/12/GOLD-REPORT-2022-v1.1-22Nov2021_WMV.pdf (accessed on 10 November 2022).
  11. Olivera, A.; Unnascha, T.; Crothers, K. Performance of a molecular viability assay for the diagnosis of Pneumocystis pneumonia in HIV-infected patients. Diag. Microb. Infect. Dis. 2007, 57, 169–176. [Google Scholar] [CrossRef]
  12. Wakefield, A.E. Genetic heterogeneity in Pneumocystis carinii: An introduction. FEMS Immunol. Med. Microbiol. 1998, 22, 5–13. [Google Scholar] [CrossRef]
  13. Alanio, A.; Bretagne, S. Pneumocystis jirovecii detection in asymptomatic patients: What does its natural history tell us? F1000Res 2017, 6, 739. [Google Scholar] [CrossRef] [Green Version]
  14. Vargas, S.L.; Pizarro, P.; López-Vieyra, M.; Neira-Avilés, P.; Bustamante, R.; Ponce, C.A. Pneumocystis colonization in older adults and diagnostic yield of single versus paired noninvasive respiratory sampling. Clin. Infect. Dis. 2010, 50, e19–e21. [Google Scholar] [CrossRef] [Green Version]
  15. Sethi, S.; Murphy, T.F. Infection in the pathogenesis and course of chronic obstructive pulmonary disease. N. Engl. J. Med. 2008, 359, 2355–2365. [Google Scholar] [CrossRef]
  16. Su, J.; Liu, H.-Y.; Tan, X.-L.; Ji, Y.; Jiang, Y.-X.; Prabhakar, M.; Rong, Z.-H.; Zhou, H.-W.; Zhang, G.-X. Sputum Bacterial and Fungal Dynamics during Exacerbations of Severe COPD. PLoS ONE 2015, 10, e0130736. [Google Scholar] [CrossRef]
  17. Morris, A.; Kingsley, L.; Groner, G.; Lebedeva, I.P.; Beard, C.B.; Norris, K. Prevalence and clinical predictors of Pneumocystis colonization among HIV-infected men. AIDS 2004, 18, 793–798. [Google Scholar] [CrossRef]
  18. Leung, J.M.; Tiew, P.Y.; Mac Aogáin, M.; Budden, K.F.; Yong, V.F.; Thomas, S.S.; Pethe, K.; Hansbro, P.M.; Chotirmall, S.H. The role of acute and chronic respiratory colonization and infections in the pathogenesis of COPD. Respirology 2017, 22, 634–650. [Google Scholar] [CrossRef] [Green Version]
  19. Probst, M.; Ries, H.; Schmidt-Wieland, T.; Serr, A. Detection of Pneumocystis carinii DNA in patients with chronic lung dis-eases. Eur. J. Clin. Microbiol. Infect. Dis. 2000, 19, 644–645. [Google Scholar] [CrossRef]
  20. Calderón, E.J.; Rivero, L.; Respaldiza, N.; Morilla, R.; Montes-Cano, M.A.; Friaza, V.; Muñoz-Lobato, F.; Varela, J.M.; Medrano, F.J.; De La Horra, C. Systemic inflammation in patients with chronic obstructive pulmonary disease who are colonized with Pneumocystis jiroveci. Clin. Infect. Dis. 2007, 45, e17–e19. [Google Scholar] [CrossRef] [Green Version]
  21. Mori, S.; Cho, I.; Ichiyasu, H.; Sugimoto, M. Asymptomatic carriage of Pneumocystis jiroveci in elderly patients with rheumatoid arthritis in Japan: A possible association between colonization and development of Pneumocystis jiroveci pneumonia during low-dose MTX therapy. Mod. Rheumatol. 2008, 18, 240–246. [Google Scholar] [CrossRef]
  22. Özmen, A.; Mıstık, R.; Alver, O.; Coşkun, F.; Ursavaş, A.; Uzaslan, E. Bronkoalveoler lavaj (BAL) ve bronşiyal lavaj yapılan hastalardaki Pneumocystis jirovecii kolonizasyonu ve tanıda kullanılan yöntemlerin karşılaştırması [The Pneumocystis jirovecii colonization in bronchoalveolar lavage (BAL) and bronchial washing and the comparison of methods which are used in diagnosis]. Tuberk Toraks. 2013, 61, 303–311. (In Turkish) [Google Scholar] [PubMed]
  23. Khodadadi, H.; Mirhendi, H.; Mohebali, M.; Kordbacheh, P.; Zarrinfar, H.; Makimura, K. Pneumocystis jirovecii Colonization in Non-HIV-Infected Patients Based on Nested-PCR Detection in Bronchoalveolar Lavage Samples. Iran. J. Public Health 2013, 42, 298–305. [Google Scholar] [PubMed]
  24. Effros, R.B.; Fletcher, C.V.; Gebo, K.; Halter, J.B.; Hazzard, W.R.; Horne, F.M.; Huebner, R.E.; Janoff, E.N.; Justice, A.C.; Kuritzkes, D.; et al. Aging and infectious diseases: Workshop on HIV infection and aging: What is known and future research directions. Clin. Infect. Dis. 2008, 47, 542–553. [Google Scholar] [CrossRef] [PubMed]
  25. Bateman, M.; Oladele, R.; Kolls, J.K. Diagnosing Pneumocystis jirovecii pneumonia: A review of current methods and novel approaches. Med. Mycol. 2020, 58, 1015–1028. [Google Scholar] [CrossRef]
  26. Nevez, G.; Jounieaux, V.; Linas, M.D.; Guyot, K.; Leophonte, P.; Massip, P.; Schmit, J.L.; Seguela, J.P.; Camus, D.; Dei-Cas, E.; et al. High frequency of Pneumocystis carinii sp.f. hominis colonization in HIV-negative patients. J. Eukaryot Microbiol. 1997, 44, 36S. [Google Scholar] [CrossRef]
  27. Sing, A.; Roggenkamp, A.; Autenrieth, I.B.; Heesemann, J. Pneumocystis carinii carriage in immunocompetent patients with primary pulmonary disorders as detected by single or nested PCR. J. Clin. Microbiol. 1999, 37, 3409–3410. [Google Scholar] [CrossRef] [Green Version]
  28. Morris, A.; Sciurba, F.C.; Lebedeva, I.P.; Githaiga, A.; Elliott, W.M.; Hogg, J.C.; Huang, L.; Norris, K.A. Association of chronic obstructive pulmonary disease severity and Pneumocystis colonization. Am. J. Respir. Crit. Care Med. 2004, 170, 408–413. [Google Scholar] [CrossRef]
  29. Kling, H.M.; Shipley, T.W.; Guyach, S.; Tarantelli, R.; Morris, A.; Norris, K.A. Trimethoprim-sulfamethoxazole treatment does not reverse obstructive pulmonary changes in pneumocystis-colonized nonhuman primates with SHIV infection. J. Acquir. Immune Defic. Syndr. 2014, 65, 381–389. [Google Scholar] [CrossRef] [Green Version]
  30. Calderón, E.J.; Regordan, C.; Medrano, F.J.; Ollero, M.; Varela, J.M. Pneumocystis carinii infection in patients with chronic bronchial disease. Lancet 1996, 347, 977. [Google Scholar] [CrossRef]
  31. Mammen, M.J.; Sethi, S. COPD and the microbiome. Respirology 2016, 21, 590–599. [Google Scholar] [CrossRef] [Green Version]
  32. Medrano, F.J.; Montes-Cano, M.; Conde, M.; de la Horra, C.; Respaldiza, N.; Gasch, A.; Perez-Lozano, M.J.; Varela, J.M.; Calderon, E.J. Pneumocystis jirovecii in general population. Emerg. Infect. Dis. 2005, 11, 245–250. [Google Scholar] [CrossRef]
  33. Vera, C.; Aguilar, Y.A.; Vélez, L.A.; Rueda, Z.V. High transient colonization by Pneumocystis jirovecii between mothers and newborn. Eur. J. Pediatr. 2017, 176, 1619–1627. [Google Scholar] [CrossRef]
  34. Montes-Cano, M.A.; de la Horra, C.; Dapena, F.J.; Mateos, I.; Friaza, V.; Respaldiza, N.; Muñoz-Lobato, F.; Medrano, F.J.; Calderon, E.J.; Varela, J.M. Dynamic colonisation by different Pneumocystis jirovecii genotypes in cystic fibrosis patients. Clin. Microbiol. Infect. 2007, 13, 1008–1011. [Google Scholar] [CrossRef] [Green Version]
  35. Gantois, N.; Lesaffre, A.; Durand-Joly, I.; Bautin, N.; Le Rouzic, O.; Nseir, S.; Reboux, G.; Scherer, E.; Aliouat, E.M.; Fry, S.; et al. Factors associated with Pneumocystis colonization and circulating genotypes in chronic obstructive pulmonary disease patients with acute exacerbation or at stable state and their homes. Med. Mycol. 2021, 60, myab070. [Google Scholar] [CrossRef]
  36. Cañas-Arboleda, A.; Hernández-Flórez, C.; Garzón, J.; Parra-Giraldo, C.M.; Burbano, J.F.; Cita-Pardo, J.E. Colonization by Pneumocystis jirovecii in patients with chronic obstructive pulmonary disease: Association with exacerbations and lung function status. Braz. J. Infect. Dis. 2019, 23, 352–357. [Google Scholar] [CrossRef]
Table
Table 1. Sociodemographic characteristics together with clinical and biochemical data for COPD patients (colonization vs. noncolonization).
Table 1. Sociodemographic characteristics together with clinical and biochemical data for COPD patients (colonization vs. noncolonization).
COPD Patients with Colonization (n = 4)COPD Patients without Colonization (n = 11)Prevalence RatioCI 95%p
Male3 (75%)5 (45.5%)2.600.48–170.5692
Age † (SD)64.0 (5.72)61.91 (5.90)-−5.30–9.480.5519
Rural origin1 (25%)1 (9.09%)2.20.35–8.40.4762
FEV1/FVC † (SD)46.88 (3.90)43.39 (16.53)-−14.95–21.930.6892
FEV1% † (SD)1.13 (0.35)0.95 (0.50)-−0.42–0.780.5338
Biomass exposure2 (50%)6 (54.55%)0.870.18–4.150.9999
Current smokers4 (100%)7 (63.64%)0.630.35–1.340.5165
mMRC > 24 (100%)11 (100%)---
GOLD classification categories 1–22 (50%)3 (27.27%)0.750.27–1.450.5604
GOLD classification categories 3–42 (50%)8 (72.73%)20.41–8.930.5604
Comorbidities3 (75%)10 (90.91%)1.530.69–8.260.4762
Microbiological isolation1 (25%)8 (72.73%)1.770.90–4.820.2352
Lactate dehydrogenase (U/µL)171.80 (30.96)203.70 (60.05)-−101–37.050.303
C reactive Protein (mg/mL)45.80 (67.60)82.02 (141.5)-−226.20–153.800.6830
pO2 (mm Hg)55 (11.30) •55.18 (20.38)-−33.55–33.190.9906
Saturation (%)64.50 (24.75) •83 (16.60)-−48.10–11.100.1963
† Median, COPD = chronic obstructive pulmonary disease, SD = standard deviation, CI = confidence interval, FEV1/FVC = the volume exhaled at the end of the first second of forced expiration/forced volume capacity ratio, FEV1% = percentage of volume exhaled at the end of the first second of forced expiration, mMRC = modified dyspnea scale of the British Medical Research Council, GOLD = Global Initiative for Chronic Obstructive Lung Disease, • = sample was only obtained from two patients, pO2 = oxygen pressure.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Plascencia-Cruz, M.; Plascencia-Hernández, A.; De Armas-Rodríguez, Y.; Cervantes-Guevara, G.; Cervantes-Cardona, G.A.; Ramírez-Ochoa, S.; González-Ojeda, A.; Fuentes-Orozco, C.; Hernández-Mora, F.J.; González-Valencia, C.M.; et al. Pneumocystis jirovecii Colonization in Mexican Patients with Chronic Obstructive Pulmonary Disease. Trop. Med. Infect. Dis. 2023, 8, 137. https://doi.org/10.3390/tropicalmed8030137

AMA Style

Plascencia-Cruz M, Plascencia-Hernández A, De Armas-Rodríguez Y, Cervantes-Guevara G, Cervantes-Cardona GA, Ramírez-Ochoa S, González-Ojeda A, Fuentes-Orozco C, Hernández-Mora FJ, González-Valencia CM, et al. Pneumocystis jirovecii Colonization in Mexican Patients with Chronic Obstructive Pulmonary Disease. Tropical Medicine and Infectious Disease. 2023; 8(3):137. https://doi.org/10.3390/tropicalmed8030137

Chicago/Turabian Style

Plascencia-Cruz, Marcela, Arturo Plascencia-Hernández, Yaxsier De Armas-Rodríguez, Gabino Cervantes-Guevara, Guillermo Alonso Cervantes-Cardona, Sol Ramírez-Ochoa, Alejandro González-Ojeda, Clotilde Fuentes-Orozco, Francisco Javier Hernández-Mora, Carlos Miguel González-Valencia, and et al. 2023. "Pneumocystis jirovecii Colonization in Mexican Patients with Chronic Obstructive Pulmonary Disease" Tropical Medicine and Infectious Disease 8, no. 3: 137. https://doi.org/10.3390/tropicalmed8030137

Article Metrics

Back to TopTop