Next Article in Journal
Clinical Characteristics and Risk Factors of Tuberculosis in Children and Adolescents in Xinjiang, China: A Retrospective Analysis
Next Article in Special Issue
Travel-Related Malaria Diagnosis on Karius Test Despite Negative Blood Smear
Previous Article in Journal
Antibiotic-Resistant Bacteria in Drinking Water Across Twelve Regions of Ghana: Strengthening Evidence for National Surveillance
Previous Article in Special Issue
Structural Drivers of Cutaneous Leishmaniasis: Examining How the Converging Effects of Displacement, Environmental Disruption, and Political Instability Reshape Epidemiology Beyond Endemic Regions
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Characterization of Plasmodium Species to Strengthen Malaria Surveillance in Migrant Populations in Honduras

1
Instituto de Investigaciones en Microbiología, Facultad de Ciencias, Universidad Nacional Autónoma de Honduras, Tegucigalpa 11101, Honduras
2
U.S. Naval Medical Research Unit SOUTH (NAMRU SOUTH), Department of Parasitology, Lima 07006, Peru
3
Laboratorio Nacional de Vigilancia de Malaria, Secretaría de Salud de Honduras, Tegucigalpa 11101, Honduras
*
Author to whom correspondence should be addressed.
These authors contributed equally to the study.
Trop. Med. Infect. Dis. 2025, 10(10), 292; https://doi.org/10.3390/tropicalmed10100292
Submission received: 16 July 2025 / Revised: 18 September 2025 / Accepted: 10 October 2025 / Published: 15 October 2025

Abstract

As Honduras approaches malaria elimination, imported infections pose a growing challenge to disease surveillance and control. In this study, we analyzed 14 molecular markers—six from Plasmodium falciparum and eight from P. vivax—in samples from local and migrant subjects to assess their utility in differentiating local versus imported infections. All P. falciparum isolates carried the wild-type pfcrt haplotype associated with chloroquine susceptibility. However, polymorphisms in pfmdr1, pfama1, pfglurp, and pfs47 revealed distinct genotypes in migrant versus local samples, suggesting external origins. For P. vivax, three novel pvcsp VK210 haplotypes and the first detection of a VK247 variant in Honduras were identified in migrants. Additional novel haplotypes were found in pvmsp1, pvmsp3α, pvmsp3β, pvs47, and pvs48/45. Several of these markers—particularly pfmdr1, pfs47, pvs47, and pvs48/45—proved informative for inferring geographic origin. This study demonstrates the value of molecular surveillance in low-transmission settings, supporting public health efforts by identifying potentially imported cases.

1. Introduction

Malaria remains a significant public health challenge in the Americas, although the region has achieved notable reductions in transmission over the past two decades [1]. Honduras is one of the countries in Central America where malaria continues to be endemic, primarily caused by Plasmodium vivax, with less than 10% of cases of P. falciparum. In recent years, the country has experienced a marked decline in malaria incidence, accompanied by a narrowing of the geographic range and a reduction in parasite genetic diversity [2,3]. These changes have important implications for malaria control and elimination strategies, including surveillance, diagnostics, and treatment policies.
At the same time, increasing human mobility, particularly among individuals transiting through Honduras toward North America, poses new challenges for malaria surveillance [4,5]. Individuals traveling from high-transmission areas in Africa, Asia, and South America may carry genetically distinct parasite strains into regions with limited transmission, such as Honduras [6]. The introduction of non-native Plasmodium strains has potential consequences for drug resistance, diagnostic effectiveness, and transmission dynamics. Thus, there is a need to distinguish between locally acquired infections and those imported from other regions, especially in the context of elimination efforts [7].
Conventional epidemiological surveillance in Honduras is led by the Ministry of Health through standardized protocols, where thick blood smear microscopy remains the gold standard for malaria diagnosis and case confirmation at the national level [8]. National surveillance manuals and operational guidelines emphasize case detection, treatment, and reporting through the health information system. While microscopy is reliable and cost-effective, it has limitations in detecting low-density and mixed infections. In this context, molecular approaches can complement conventional surveillance by improving detection sensitivity and providing species-level identification, which is particularly relevant in migrant populations that may introduce Plasmodium species not commonly found in Honduras.
Molecular tools have become essential in characterizing malaria parasite populations and tracking transmission dynamics. Several genetic markers, including drug resistance genes [9,10], surface antigens [3,11,12], and vaccine candidates [13,14,15,16], have been used to infer parasite origin, assess population structure, and detect novel variants. In settings with limited access to next-generation sequencing (NGS) technologies [17], targeted sequencing of informative loci offers a cost-effective alternative for genetic surveillance. In Honduras, these molecular markers have been employed for over two decades [2,3,15,18,19,20,21,22,23,24,25,26], providing a valuable baseline for comparative genetic analyses.
Therefore, the objective of this study was to evaluate the utility of 14 molecular markers—six for P. falciparum and eight for P. vivax—to distinguish between local and potentially imported malaria infections. We analyzed samples collected from both local patients and migrant individuals transiting through Honduras. By comparing these sequences to existing national and international databases, we sought to determine the informativeness of each marker in inferring geographic origin. Additionally, the study contributes to building a reference framework of parasite genetic diversity within Honduras, which may support future efforts to differentiate between relapses and reinfections in patients treated with radical cure therapies.

2. Materials and Methods

2.1. Sample Collection

A total of 238 blood samples impregnated on Whatman No. 3 filter paper, previously diagnosed with malaria by the Honduran Ministry of Health, were analyzed. These samples, collected between 2023 and 2024, were evaluated as part of quality control for microscopy or rapid diagnostic test (RDT) malaria diagnosis using molecular techniques, as well as for the analysis of drug resistance-associated genes, in compliance with national regulations and routine disease surveillance [8]. According to national guidelines, malaria cases were defined as confirmed when parasites were detected by thick blood smear microscopy or RDT. Imported cases were defined as malaria infections diagnosed in individuals with a travel history to endemic countries outside Honduras during the 30 days preceding diagnosis. Both local and migrant patients were treated according to the national treatment scheme: chloroquine for three days plus primaquine for 14 days for P. vivax, and chloroquine for three days plus a single dose of primaquine for P. falciparum. However, treatment outcomes were not available, as this information was not systematically collected for the patients included in this study. Among the total samples, five were identified as originating from patients in the migration process through Honduras to North America; these five represent the entirety of imported malaria cases detected during the study period. The samples were anonymized, but limited demographic data were available for the patients. Without available NGS capabilities, these five samples were thoroughly characterized in this study using a panel of 14 molecular markers available in our laboratory. Also, four to seven local samples were analyzed using the same panel of molecular markers. This characterization aimed to assess the level of information each marker could provide to determine whether malaria was locally acquired or originated in another geographic region. The study was reviewed and approved by the ethics committee (CEI-MEIZ) of the National Autonomous University of Honduras (UNAH) under protocol number PI 12-2024.

2.2. DNA Extraction and Molecular Diagnosis

DNA extraction was performed using two 2 mm diameter circles that were punched from blood-impregnated filter paper. Genomic DNA was isolated using the Extracta® DNA Prep for PCR kit (QuantaBio, Beverly, MA, USA) according to the manufacturer’s protocol and stored at −20 °C until analysis. Plasmodium genus detection was performed using PET-PCR with primers described in Table 1 [25,27]. Samples testing positive were further amplified with species-specific primers for P. falciparum and P. vivax, the two malaria parasites endemic to Honduras. PCR reactions were prepared in a 20 μL volume containing 10 μL GoTaq® Probe qPCR Master Mix (Promega Corp., Madison, WI, USA), 0.5 μL each of forward and reverse primers (10 μM) (Table 1), 4 μL nuclease-free water, and 5 μL DNA template (~40 ng/μL). Amplification was carried out on a Mic qPCR Cycler (Bio Molecular Systems, Brisbane, Australia) under the following conditions. Initial denaturation: 95 °C for 15 min, 45 cycles of 95 °C for 20 s, 63 °C for 40 s, 72 °C for 30 s. Fluorescence detection used 6FAM-labeled primers for genus identification and HEX-labeled primers for species discrimination. All runs included positive and negative controls, with a cycle threshold (Ct) ≤ 42 defined as a positive result. Data were analyzed using Mic qPCR Cycler Software v2.10.1.3.

2.3. Molecular Markers for P. falciparum: pfcrt, pfmdr1, pfglurp, pfama1, pfhrp2/3, and pfs47

In total, one P. falciparum sample (M1) and four P. vivax samples (M2–M5) were analyzed using the molecular markers listed in Table 2 and Table 3, with the country of origin indicated for each sample.
One sample (designated “M1”) obtained from a foreign subject with falciparum malaria migrating through the country was analyzed. The subject was recruited in the Cortés department, though their country of origin and most recent geographic provenance remain unknown. Additionally, four samples from local patients were analyzed. A 264 bp region of pfcrt exon 2 (encoding amino acids 72–76), known to harbor polymorphisms linked to P. falciparum drug resistance, was amplified and sequenced using nested PCR (nPCR) with primers described in Table 1 [3,29]. Amplicons were visualized on 1% ethidium bromide-stained agarose gels, purified, and sequenced by Psomagen Inc. (Rockville, MD, USA) using primer AL5631 (Table 1). Sequences were analyzed in Geneious Prime v.2024.05 to assess residues 72–76 of pfcrt.
Three regions of the pfmdr1 gene were amplified to identify five polymorphisms at codons 86 and 184 (first segment), 1034 and 1046 (second segment), and 1246 (third segment). The three regions were amplified by nested PCRs according to a previous report [20] (Table 1). PCR products were resolved on 2% agarose gels stained with ethidium bromide and visualized under UV transillumination. The products were sequenced from both sides.
A semi-nested and a nested PCR were used to amplify a fragment of the P. falciparum glurp [3,11] and ama1 genes [3,37], respectively (Table 1). Amplicons were bidirectionally sequenced and subsequently aligned to generate a consensus sequence for each individual. The nucleotide sequences of pfglurp and pfama1 were translated into amino acid sequences using the correct open reading frame (ORF). The identified haplotypes were compared against those previously reported as circulating in the country. For any novel haplotypes discovered, sequences were deposited in GenBank, and accession numbers were assigned.
The presence or absence of partial coding regions between exons 1 and 2 of the pfhrp2 and pfhrp3 genes was assessed using two nested PCR assays as previously described [18,19] (Table 1). Positive and negative controls were used within each experiment. For the positive controls, we used DNA from previously confirmed clinical isolates available in our laboratory, which had been validated in earlier published studies and samples confirmed by sequencing in prior work. All negative samples were screened a second time and samples showing double deletions in both target regions underwent a third round of amplification.
Putative SNPs at positions 707/718/725 of the polymorphic region of domain 2 of the pfs47 gene were genotyped as previously described [15,31] (Table 1). Sample “M1” from the migrant and two local samples were sequenced.

2.4. Molecular Markers for P. vivax: pvcsp, pvmsp1-F2 block, pvmsp3α, pvmsp3β, pvs47, and pvs48/45

Four samples obtained from foreign patients with vivax malaria migrating through the country were analyzed. The subjects were recruited in the Cortés and El Paraíso departments. One of these subjects was from Afghanistan (“M2”), one from Venezuela (sample designated “M3”), and the nationality of the other two was unknown (“M4” and “M5”). Several local samples were also analyzed.
Seven protein-coding genes expressed on the surface of different P. vivax life stages were amplified and bidirectionally sequenced to assess sequence polymorphisms. For pvcsp, sequencing enabled classification between the two major types (VK210 and VK247). The pvcsp and pvmsp1 (F2) genes were amplified and sequenced as previously described [24], employing the primers detailed in Table 1. Similarly, the pvmsp3α and pvmsp3β genes were analyzed [3]. Nucleotide sequences were translated to amino acid sequences using the correct ORF, and identified haplotypes were compared against those previously reported as circulating in the country. Novel haplotypes were deposited in GenBank, with corresponding accession numbers assigned.
The full coding sequences of two genes encoding antigens proposed as potential transmission-blocking vaccine (TBV) candidates—Pvs47 and Pvs48/45—were amplified and sequenced using primers previously described [16,34,35,36].
Pvs47 was amplified by PCR in a 50 µL reaction volume containing 25 µL of 2X Taq Master Mix (Promega Corp., Madison, WI, USA), 2 µL of each primer at 10 µM (Table 1), 2 µL of BSA (10 mg/mL), and 4 µL of genomic DNA. The PCR cycling conditions consisted of an initial denaturation at 95 °C for 5 min, followed by 25 cycles of 95 °C for 1 min, 58 °C for 1 min, and 72 °C for 2 min, with a final extension at 72 °C for 10 min. A nested PCR (nPCR) was performed using 1 µL of the first-round PCR product in a 50 µL reaction containing 25 µL of Taq Master Mix, 2 µL of each nested primer at 10 µM (Table 1), and 2 µL of BSA (10 mg/mL). The program for the nested PCR included an initial denaturation at 95 °C for 5 min, followed by 35 cycles at 95 °C for 1 min, 58 °C for 1 min, and 72 °C for 2 min, with a final extension at 72 °C for 10 min. Amplicons were visualized by agarose gel electrophoresis, stained with ethidium bromide, and sequenced bidirectionally using the internal primers. A total of 23 samples from local patients and 3 from foreign migrant patients were successfully sequenced. All sequences were aligned and analyzed for the presence of polymorphisms.
The pvs48/45 gene was also amplified using several PCR reactions and under the same conditions described for pvs47 except that the annealing temperature of the second PCR was 53 °C. Primers used in the first and second reactions are listed in Table 1. Given that the gene is over 1350 nucleotides in length, its full sequence could not be obtained using only the primers from the second semi-nested PCR reaction. Therefore, nine internal primers were employed to assemble each complete sequence (Table 1, Sequencing primers). A total of 23 sequences from local isolates and 3 from migrant patients were sequenced and assembled. Sequences obtained were deposited in GenBank, with corresponding accession numbers assigned. For both pvs47 and pvs48/45, homologous sequences were deposited in GenBank and accession numbers were assigned.

3. Results

3.1. Molecular Markers for P. falciparum

Genotype and phenotype analysis was performed for two parasite genes associated with antimalarial drug resistance, pfcrt and pfmdr1. In this context, the term “phenotype” refers to the in silico translation of the gene sequences into their corresponding amino acid sequences, which allows the prediction of potential resistance-associated profiles. The pfcrt wild-type haplotype (72CVMNK76), indicating chloroquine susceptibility, was detected in all samples (n = 4), including the sample of the migrant subject named “M1”. pfmdr1 polymorphisms differed between the migrant “M1” (N86/184F/S1034/N1042/D1246) and local (N86/184F/1034C/1042D/D1246) cases, suggesting distinct genetic profiles (Table 2).
Additionally, partial coding regions of two genetic diversity markers (pfglurp and pfama1) were sequenced. For pfglurp, the migrant patient’s sample “M1” revealed a novel haplotype not previously reported in Honduras, differing by two residues from the reference sequence (GenBank accession PP681141). This new sequence was deposited in GenBank under accession PV567568. The remaining three local sequences were identical to the reference sequence PP681141. Similarly, the “M1” sample revealed a novel pfama1 haplotype, not previously reported in the country, which differed by 7 residues from the reference sequence (GenBank accession PP795732). This new haplotype was deposited in GenBank under accession number PV567569. Local samples’ sequences were identical to PP795732 (Table 2).
We also assessed the presence/absence of pfhrp2 and pfhrp3, genes encoding antigens widely used in malaria rapid diagnostic tests (RDTs). The migrant subject’s sample tested positive for both loci (pfhrp2+/pfhrp3+), whereas local samples exhibited an pfhrp2+/pfhrp3− genotype (Table 2).
Regarding pfs47, three polymorphic positions of domain 2 of the pfs47 gene (707, 718, and 725), which have been used to infer the possible geographic origin of parasite strains [31], were evaluated. “M1” exhibited the 707C/718C/725C genotype, whereas the local samples showed the T707/T718/T725 genotype (Table 2).

3.2. Molecular Markers for P. vivax

We evaluated six molecular markers (pvcsp, pvmsp1-F2 block, pvmsp3αN1 and N2, and pvmsp3βN1 and N2) commonly used to assess P. vivax genetic diversity. For pvcsp, all analyzed samples—including two from migrant individuals—exhibited four VK210-type allelic variants (“M4” and “M5”), three of which were novel haplotypes and previously unreported in Honduras (Figure 1). These new variants were deposited in GenBank (Accession No. PV567570-2) (Table 3). Notably, one sample from an Afghan subject (“M2”) revealed a VK247-type variant, which constitutes the first report of this genotype in Honduras (Accession No. PV567574).
We additionally sequenced the F2 segment of pvmsp1, encompassing one conserved block and two variable blocks (blocks 6 and 8) of the gene. Two samples collected from migrant patients (“M3” and “M5”) exhibited haplotypes previously reported in Honduras (GenBank Accession No. JQ903607 and JQ903606). In comparison, two local patient samples revealed novel haplotypes not previously described in the country (Acc. No. PV590043 and PV594050) (Table 3).
The two remaining genetic markers, pvmsp3α and pvmsp3β, were sequenced in both directions. Consensus sequences could not be generated due to the length of the sequences and the difficulty in aligning the forward primer-derived sequences with those obtained from the reverse primer. Consequently, each sequence was considered as an individual marker (pvmsp3α-N1, pvmsp3α-N2, pvmsp3β-N1, and pvmsp3β-N2). Regarding the pvmsp3α-N1 locus, two samples (“M3” and “M5”) exhibited a haplotype previously reported in the country (GenBank accession numbers PP913947-8 and PP795720). A third sample from a migrant subject (“M4”) revealed a novel haplotype, not previously documented in Honduras, which was deposited in GenBank under accession number PV590041. This haplotype showed 100% similarity with sequences reported in the Americas (e.g., AAO20877, AGR50762) and Asia (e.g., WQM98282). For the pvmsp3β-N1 locus, all three migrant samples displayed the same haplotype, which had not been previously reported in the country (Acc. No. PV590042). One local sample also revealed a novel haplotype (Acc. No. PV594049). Sequencing with the N2 primer (for both pvmsp3α and pvmsp3β) did not reveal any new haplotypes in Honduras. The three migrant patient samples all exhibited known haplotypes: pvmsp3α (Acc. No. PP913961-2) and pvmsp3β (Acc. No. PP795728-31, PP886070) (Table 3).

pvs47 and pvs48/45

The coding sequence of the pvs47 gene, comprising 1299 nucleotides, was sequenced in 23 samples from local patients and 4 from migrant subjects. Translation of this sequence yielded a 433-residue polypeptide. A single SNP was detected at position 22 of the polypeptide (F22L). Seven samples exhibited the F22 phenotype, two of which were from migrant individuals (“M2” and “M4”), while the remaining samples displayed the 22L phenotype, including “M3” and “M5”. Table 3 also describes 13 additional positions that have been reported as polymorphic in the literature [14,16,35]. GenBank accession numbers were assigned to the genotypes described in this study (Acc. No. PV700528-9, PV30102).
The pvs48/45 gene, consisting of 1350 nucleotides and encoding 450 amino acids, was also sequenced in 23 local samples and 3 from migrant individuals. Three polymorphic positions were identified: H211N, K250N, and E353Q. “M2” exhibited the H211/250N/353Q phenotype, while “M3” and “M5” revealed the 211N/K250/E353 genotype. “M4” could not be successfully sequenced. An additional nine positions previously reported as polymorphic [16] are shown in Table 3. The remaining local sequences (n = 18) revealed the haplotype E35/Y196/K211/K250/D335/E353/A376/I380/K390/K418 (Acc. No. PV700525-7).

4. Discussion

Human mobility represents one of the main challenges for infectious disease control globally. Migratory flows can facilitate the introduction of vector-borne diseases, including malaria, into regions with low endemicity or near elimination [38]. Such mobility poses the additional risk of introducing Plasmodium strains carrying drug resistance mutations or genetic variants not previously detected locally. In this context, the implementation of molecular tools for malaria surveillance is increasingly relevant, as they provide valuable information that complements conventional case surveillance and supports regional elimination goals [39].
In Honduras, malaria surveillance is coordinated by the Ministry of Health through standardized protocols in which thick blood smear microscopy remains the gold standard for case confirmation and reporting [8]. All confirmed malaria cases are entered into the national epidemiological information system, which serves as the country’s repository of case data. While microscopy is reliable and cost-effective, its limitations in detecting low-density and mixed infections highlight the potential of molecular approaches to add resolution by identifying Plasmodium species and genetic variants, and by contributing to the monitoring of drug resistance [20,40]. The present study was therefore designed not to replace, but to complement conventional malaria surveillance with molecular evidence.
In this study, six molecular markers of P. falciparum and eight of P. vivax were analyzed in samples from malaria patients in transit through Honduras en route to northern regions of the Americas, as well as in samples from local patients. The objective of characterizing these Plasmodium isolates was to evaluate the informativeness of the 14 molecular markers in distinguishing whether the infections originated from external geographic regions or within the national territory. Additionally, a detailed characterization of the genotypes circulating within the country may soon become a valuable tool for distinguishing relapses from reinfections in malaria patients treated with primaquine or tafenoquine, especially in a context of limited access to next-generation sequencing (NGS) technologies [41].
The first marker evaluated in patients with P. falciparum malaria was pfcrt, a transporter gene whose mutations at codons 72 to 76 confer resistance to chloroquine (CQ). The haplotype identified in “M1”, a sample from a migrant patient, was 72CVMNK76, described as the wild-type phenotype and associated with CQ susceptibility. CQ-resistant phenotypes (CVIET, SVMNT, CVIDT, and CVMNT) have been reported for several decades in nearly all malaria-endemic regions [42], except Central America, where the wild-type CVMNK remains the only circulating haplotype [3,20,21,43]. The fact that patient “M1” was infected with a strain carrying the wild-type pfcrt phenotype suggests that the origin of the infection may have been Honduras or a neighboring country, including Haiti or the Dominican Republic. However, the withdrawal of CQ as treatment in several African countries has led to an almost complete re-emergence of CQ-sensitive parasite populations [9,29,44,45,46,47], along with the appearance of some CQ-sensitive populations in Asia [48]. Consequently, the CVMNK haplotype can no longer be considered exclusive to the Central American region.
A second antimalarial drug resistance marker evaluated in this study was pfmdr1. The haplotype detected in “M1” was N86/184F/S1034/N1042/D1246 (NFSND haplotype), which differs at positions 1034 and 1042 from the local strains, all of which exhibited the NFCDD phenotype. Previous studies have analyzed the pfmdr1 gene in strains collected in Honduras. In 2011, the N86 phenotype was identified in 30 samples from Honduras, while one sample from Africa and one from the Pacific region showed the mutant 86Y genotype [22]. In 2020, Valdivia et al. analyzed 16 strains from Honduras that revealed the N86, 184F, D1246 haplotype [17]. In 2021, 51 local strains were analyzed, and all displayed the NFCDD haplotype [20]. On the other hand, the reference strain HB3, originally isolated in Honduras, carries the NFSDD haplotype. Thus, the NFSND haplotype had not been previously reported in Honduras and may be indicative of an infection acquired outside the national territory.
Two genetic markers widely used to estimate parasite genetic diversity were also sequenced. For both pfglurp and pfama1, “M1” exhibited haplotypes that had not been previously reported in Honduras. Recently, Zamora et al. analyzed both genes in 90 P. falciparum strains collected from malaria-endemic regions of Honduras [3]. In both cases, 89 out of the 90 strains were identical, and for pfglurp, only one strain showed a 56-nucleotide deletion, indicating high homogeneity in these markers. A GenBank search for the pfglurp genotype found in “M1” showed 100% identity with the 3D7 strain (Acc. No. MG578504) and with other entries reported from India and Indonesia (Acc. Nos. KY425859–64–95, AF191066), among others. For pfama1, the highest similarity of the genotype found in “M1” to sequences in GenBank was 98.42%. Given the low genetic diversity of the parasite population in Honduras, the detection of divergent variants in pfglurp and pfama1 in “M1” further supports the hypothesis of an imported strain from a foreign country.
Our study also screened for deletions on pfhrp2 and pfhrp3. Their presence or absence has been relevant since 2010 due to their involvement in rapid diagnostic tests (RDTs) [49]. The “M1” sample showed the presence of both gene segments (pfhrp2+/pfhrp3+), whereas six local samples displayed the pfhrp2+/pfhrp3− haplotype. Deletions at both loci have been previously investigated in Central America. The first study, published in 2015, analyzed 68 samples collected in the city of Puerto Lempira. All samples tested positive for pfhrp2, and only 50% were positive for pfhrp3 [18]. In 2018, a follow-up study was published analyzing 128 samples from Honduras, Guatemala, and Nicaragua [19]. In that study, only 8.6% of the isolates were pfhrp3+, suggesting that the pfhrp2+/pfhrp3+ haplotype is not common in Honduras, although its occurrence in the circulating parasite population cannot be entirely ruled out.
The final P. falciparum marker analyzed was pfs47, a gene that mediates the parasite’s ability to evade the mosquito immune system and is therefore critical for parasite survival and transmission [50]. It has been shown that pfs47 exhibits strong geographic population structure, with distinct haplotypes predominating across continents [31,41]. The major differences among these haplotypes are based on polymorphisms at nucleotide positions 707, 718, 725, and 742. Sequencing of the gene in sample “M1” revealed the genotype 707C/725C (CC), whereas local samples in this study and 31 additional samples analyzed in a previous study [15] displayed the 707T/725T (TT) genotype. The TT genotype has been described as the most frequent in Latin America, while the CC genotype is more common in Africa. This evidence supports the hypothesis of an infection acquired outside the country.
We also analyzed four molecular markers commonly used to assess P. vivax genetic diversity—pvcsp, pvmsp1 (F2 block), pvmsp3α, and pvmsp3β—in both local and migrant patient samples. All pvcsp sequences belonged to the VK210 type, except one from an Afghan migrant (“M2”), which revealed the VK247 genotype, marking its first report in Honduras, supporting the hypothesis that this isolate may have a non-American origin. Among the VK210 variants, three novel haplotypes were identified compared to those previously described in a study that sequenced 84 samples collected from all malaria-endemic regions at that time [24]. Sequencing of the pvmsp1-F2 segment revealed two migrant samples (“M3” and “M5”) with known Honduran haplotypes, while two local samples exhibited previously undescribed variants [24], suggesting locally acquired infections. Unfortunately, pvmsp1 could not be sequenced in “M2” or “M4”.
At the pvmsp3α-N1 locus, two migrant samples carried known haplotypes [3], while a third (“M4”) displayed a novel variant with 100% similarity to sequences from South America (Acc. No. AAO20877, AGR50762) and Myanmar (Acc. No. WQM98282). This result, along with the novel VK210 haplotype found for pvcsp, would also suggest that this parasite strain could have been imported. For pvmsp3β-N1, all three migrant samples and one local sample revealed previously unreported haplotypes [3]. Thus, this locus does not allow for discrimination of the parasites’ origin.
Finally, the complete coding sequences of two candidate transmission-blocking vaccine genes, pvs47 and pvs48/45, were sequenced. In pvs47, only a single SNP was detected, resulting in a phenylalanine at residue 22 in samples “M2” and “M4,” whereas local samples and the other two migrant samples displayed the 22L phenotype. For pvs48/45, three polymorphic positions were identified: H211N, K250N, and E353Q. Sample “M2” exhibited the H211/250N/353Q phenotype, while “M3” and “M5” showed the 211N/K250/E353 genotype. “M4” could not be successfully sequenced. Eighteen local samples revealed a diverse haplotype (K211/K250/E353). These findings strongly suggest that both markers are highly informative for inferring the geographic origin of P. vivax strains, particularly in the current context of low transmission and reduced genetic diversity in Honduras.
Taken together, these results demonstrate the value of incorporating molecular markers as a complementary tool to the national malaria surveillance system. By situating the findings in the broader problem of imported diseases, we emphasize that molecular approaches add resolution to case detection, help identify imported strains with potential drug resistance, and provide data on parasite population structure. These contributions are particularly relevant in countries like Honduras, where malaria transmission is now focalized, and where elimination goals will depend on distinguishing local from imported cases with greater accuracy.

5. Conclusions

This study fulfilled its objective of assessing the utility of multiple molecular markers to differentiate between locally acquired and potentially imported malaria infections in Honduras, a country currently experiencing low transmission and limited genetic diversity of the parasites. By analyzing six P. falciparum and eight P. vivax genetic markers, we identified novel haplotypes and allelic variants that had not been previously reported in the country, particularly in samples from migrant patients. Some markers—such as pfmdr1, pfama1, pfs47 for P. falciparum, and pvcsp, pvmsp3α, and the transmission-blocking vaccine candidates pvs47 and pvs48/45 for P. vivax—proved especially informative in inferring the likely geographic origin of infections. These findings demonstrate the value of molecular surveillance in detecting the introduction of foreign strains and complementing conventional surveillance systems and in guiding public health strategies, especially in settings where advanced sequencing technologies remain unavailable. We also acknowledge the main limitations of the study, including the small number of migrant samples and the lack of systematic follow-up of clinical outcomes, which should be addressed in future research with larger cohorts.

Author Contributions

Conceptualization, G.F.; methodology, A.G., K.E., A.P. and G.F.; validation, A.P., L.C., G.A. and G.F.; formal analysis, H.O.V. and G.F.; investigation, A.G., K.E., A.P., L.C. and G.A.; resources, H.O.V. and G.F.; data curation, G.F.; writing—original draft preparation, G.F.; writing—review and editing, A.G., K.E., A.P., H.O.V. and G.F.; visualization, G.F.; supervision, G.F.; project administration, G.F.; funding acquisition, H.O.V. and G.F. All authors have read and agreed to the published version of the manuscript.

Funding

Funding for this study was provided by the Genetic Research Center, CIG-UNAH, and by the Armed Forces Health Surveillance Division (AFHSD), Global Emerging Infections Surveillance (GEIS) Branch (PROMIS ID P0091_24_N6). The funders had no role in study design, data collection, analysis, decision to publish, or preparation of the manuscript. The APC was funded by DICIHT-UNAH.

Institutional Review Board Statement

The study made secondary use of biological specimens originally collected for malaria diagnosis as per standard of care in Honduras, to identify parasite species and analyze genes linked to drug resistance, following national regulations for routine malaria surveillance. The ethics committee CEI-MEIZ-UNAH reviewed and approved the study (PI 12-2024; approval date: 12 December 2024). The study protocol NAMRU6.2018.0002 (Original approval date 7 March 2018; Last revision: 7 October 2025) was reviewed and approved by the Research Administration Program of the Naval Medical Research Unit SOUTH (NAMRU SOUTH) in compliance with all applicable federal regulations governing the protection of human subjects.

Informed Consent Statement

The consent to participate was exempted based on: (a) The absence of personal information; (b) the study’s contribution to public health; and (c) the absence of any harm to the participants. The blood samples were anonymized and irrevocably stripped of direct identifiers, so future re-identification of individuals was not possible.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author. The newly generated sequences were submitted to the GenBank database under the accession numbers cited in the text.

Acknowledgments

We would like to express our sincere gratitude to Álvaro Molina-Cruz (National Institute of Allergy and Infectious Diseases, NIH, USA) for kindly providing some of the PCR primers used in this study. His generous support contributed to the successful completion of our molecular analyses.

Conflicts of Interest

One of the authors of this manuscript (H.O.V.) is an employee of the U.S. Government. This work was prepared as part of his official duties. Title 17 U.S.C. §105 provides that “Copyright protection under this Title is not available for any work of the United States Government”. Title 17 U.S.C. §101 defines a U.S. Government work as a work prepared by a military service member or employee of the U.S. Government as part of that person’s official duties. The views expressed in this article are those of the authors and do not necessarily reflect the official policy or position of the Department of the Navy, Department of Defense, nor the U.S. Government.

Abbreviations

The following abbreviations are used in this manuscript:
NGSNext Generation Sequencing
CQChloroquine
PvcspPlasmodium vivax circumsporozoite protein
Pvmsp3aPlasmodium vivax merozoite surface protein 2 alpha
Pvmsp3bPlasmodium vivax merozoite surface protein 2 beta
Pvmsp1Plasmodium vivax merozoite surface protein 1
Pvs47Plasmodium vivax surface protein 47
Pvs48/45Plasmodium vivax surface protein 48/45
PfcrtPlasmodium falciparum chloroquine transporter
Pfmdr1Plasmodium falciparum multidrug resistance 1
Pfhrp2/3Plasmodium falciparum histidine rich proteins 2/3
Pfama1Plasmodium falciparum apical membrane antigen 1
Pfs47Plasmodium falciparum surface protein 47

References

  1. World Health Organization. World Malaria Report 2024; Global Malaria Programme (GMP), WHO: Geneva, Switzerland, 2024; p. 316. [Google Scholar]
  2. Pinto, A.; Archaga, O.; Mejia, A.; Escober, L.; Henriquez, J.; Montoya, A.; Valdivia, H.O.; Fontecha, G. Evidence of a Recent Bottleneck in Plasmodium falciparum Populations on the Honduran-Nicaraguan Border. Pathogens 2021, 10, 1432. [Google Scholar] [CrossRef]
  3. Zamora, A.; Pinto, A.; Escobar, D.; Valdivia, H.O.; Chaver, L.; Ardon, G.; Carranza, E.; Fontecha, G. Genetic diversity of Plasmodium vivax and Plasmodium falciparum field isolates from Honduras in the malaria elimination phase. Curr. Res. Parasitol. Vector Borne Dis. 2025, 7, 100230. [Google Scholar] [CrossRef]
  4. Agudelo Higuita, N.I.; Franco-Paredes, C.; Henao-Martinez, A.F.; Mendez Rojas, B.; Suarez, J.A.; Naranjo, L.; Alger, J. Migrants in transit across Central America and the potential spread of chloroquine resistant malaria-a call for action. Lancet Reg. Health Am. 2023, 22, 100505. [Google Scholar] [CrossRef]
  5. Loyola-Cruz, M.A.; Duran-Manuel, E.M.; Cruz-Cruz, C.; Bravata-Alcantara, J.C.; Gutierrez-Munoz, V.H.; Marquez-Valdelamar, L.M.; Leal-Escobar, B.; Vasquez-Jimenez, E.; Cureno-Diaz, M.A.; Lugo-Zamudio, G.E.; et al. Imported malaria cases by Plasmodium falciparum and Plasmodium vivax in Mexican territory: Potential impact of the migration crisis. Travel Med. Infect. Dis. 2024, 62, 102773. [Google Scholar] [CrossRef]
  6. Fontecha, G. The Honduran diaspora and infectious diseases: An urgent need for action. Travel Med. Infect. Dis. 2023, 53, 102567. [Google Scholar] [CrossRef]
  7. He, X.; Zhong, D.; Zou, C.; Pi, L.; Zhao, L.; Qin, Y.; Pan, M.; Wang, S.; Zeng, W.; Xiang, Z.; et al. Unraveling the Complexity of Imported Malaria Infections by Amplicon Deep Sequencing. Front. Cell. Infect. Microbiol. 2021, 11, 725859. [Google Scholar] [CrossRef]
  8. Secretaría de Salud de Honduras. Norma Nacional de Malaria de Honduras; Secretaría de Salud de Honduras: Tegucigalpa, Honduras, 2018. [Google Scholar]
  9. Balikagala, B.; Sakurai-Yatsushiro, M.; Tachibana, S.I.; Ikeda, M.; Yamauchi, M.; Katuro, O.T.; Ntege, E.H.; Sekihara, M.; Fukuda, N.; Takahashi, N.; et al. Recovery and stable persistence of chloroquine sensitivity in Plasmodium falciparum parasites after its discontinued use in Northern Uganda. Malar. J. 2020, 19, 76. [Google Scholar] [CrossRef]
  10. Dakorah, M.P.; Aninagyei, E.; Attoh, J.; Adzakpah, G.; Tukwarlba, I.; Acheampong, D.O. Profiling antimalarial drug-resistant haplotypes in Pfcrt, Pfmdr1, Pfdhps and Pfdhfr genes in Plasmodium falciparum causing malaria in the Central Region of Ghana: A multicentre cross-sectional study. Ther. Adv. Infect. Dis. 2025, 12, 20499361251319665. [Google Scholar] [CrossRef]
  11. Sathishkumar, V.; Nirmolia, T.; Bhattacharyya, D.R.; Patgiri, S.J. Genetic polymorphism of Plasmodium falciparum msp-1, msp-2 and glurp vaccine candidate genes in pre-artemisinin era clinical isolates from Lakhimpur district in Assam, Northeast India. Access Microbiol. 2022, 4, 000350. [Google Scholar] [CrossRef]
  12. Thanapongpichat, S.; Khammanee, T.; Sawangjaroen, N.; Buncherd, H.; Tun, A.W. Genetic Diversity of Plasmodium vivax in Clinical Isolates from Southern Thailand using PvMSP1, PvMSP3 (PvMSP3alpha, PvMSP3beta) Genes and Eight Microsatellite Markers. Korean J. Parasitol. 2019, 57, 469–479. [Google Scholar] [CrossRef]
  13. Ciubotariu, I.I.; Broyles, B.K.; Xie, S.; Thimmapuram, J.; Mwenda, M.C.; Mambwe, B.; Mulube, C.; Matoba, J.; Schue, J.L.; Moss, W.J.; et al. Diversity and selection analyses identify transmission-blocking antigens as the optimal vaccine candidates in Plasmodium falciparum. medRxiv 2024. [Google Scholar] [CrossRef]
  14. Barillas-Mury, C.; Molina-Cruz, A.; Torres, T.; Raytselis, N.; Young, M.; Kamath, N.; McNich, C.; Su, X.-Z.; Dwivedi, A.; Silva, J.; et al. Worldwide genetic diversity and population structure of Plasmodium vivax Pv47 is consistent with natural selection by anopheline mosquitoes. Res. Sq. 2024. [Google Scholar] [CrossRef]
  15. Fontecha, G.; Escobar, D.; Ortiz, B.; Pinto, A. A PCR-RFLP Technique to Assess the Geographic Origin of Plasmodium falciparum Strains in Central America. Trop. Med. Infect. Dis. 2022, 7, 149. [Google Scholar] [CrossRef]
  16. Woo, M.K.; Kim, K.A.; Kim, J.; Oh, J.S.; Han, E.T.; An, S.S.; Lim, C.S. Sequence polymorphisms in Pvs48/45 and Pvs47 gametocyte and gamete surface proteins in Plasmodium vivax isolated in Korea. Mem. Inst. Oswaldo Cruz 2013, 108, 359–367. [Google Scholar] [CrossRef]
  17. Valdivia, H.O.; Villena, F.E.; Lizewski, S.E.; Garcia, J.; Alger, J.; Bishop, D.K. Genomic surveillance of Plasmodium falciparum and Plasmodium vivax cases at the University Hospital in Tegucigalpa, Honduras. Sci. Rep. 2020, 10, 20975. [Google Scholar] [CrossRef]
  18. Abdallah, J.F.; Okoth, S.A.; Fontecha, G.A.; Torres, R.E.; Banegas, E.I.; Matute, M.L.; Bucheli, S.T.; Goldman, I.F.; de Oliveira, A.M.; Barnwell, J.W.; et al. Prevalence of pfhrp2 and pfhrp3 gene deletions in Puerto Lempira, Honduras. Malar. J. 2015, 14, 19. [Google Scholar] [CrossRef]
  19. Fontecha, G.; Mejia, R.E.; Banegas, E.; Ade, M.P.; Mendoza, L.; Ortiz, B.; Sabillon, I.; Alvarado, G.; Matamoros, G.; Pinto, A. Deletions of pfhrp2 and pfhrp3 genes of Plasmodium falciparum from Honduras, Guatemala and Nicaragua. Malar. J. 2018, 17, 320. [Google Scholar] [CrossRef]
  20. Fontecha, G.; Pinto, A.; Archaga, O.; Betancourth, S.; Escober, L.; Henriquez, J.; Valdivia, H.O.; Montoya, A.; Mejia, R.E. Assessment of Plasmodium falciparum anti-malarial drug resistance markers in pfcrt and pfmdr1 genes in isolates from Honduras and Nicaragua, 2018–2021. Malar. J. 2021, 20, 465. [Google Scholar] [CrossRef]
  21. Fontecha, G.A.; Sanchez, A.L.; Mendoza, M.; Banegas, E.; Mejia-Torres, R.E. A four-year surveillance program for detection of Plasmodium falciparum chloroquine resistance in Honduras. Mem. Inst. Oswaldo Cruz 2014, 109, 492–493. [Google Scholar] [CrossRef]
  22. Jovel, I.T.; Mejia, R.E.; Banegas, E.; Piedade, R.; Alger, J.; Fontecha, G.; Ferreira, P.E.; Veiga, M.I.; Enamorado, I.G.; Bjorkman, A.; et al. Drug resistance associated genetic polymorphisms in Plasmodium falciparum and Plasmodium vivax collected in Honduras, Central America. Malar. J. 2011, 10, 376. [Google Scholar] [CrossRef]
  23. Lefebvre, M.J.M.; Degrugillier, F.; Arnathau, C.; Fontecha, G.A.; Noya, O.; Houze, S.; Severini, C.; Pradines, B.; Berry, A.; Trape, J.F.; et al. Genomic exploration of the journey of Plasmodium vivax in Latin America. PLoS Pathog. 2025, 21, e1012811. [Google Scholar] [CrossRef]
  24. Lopez, A.C.; Ortiz, A.; Coello, J.; Sosa-Ochoa, W.; Torres, R.E.; Banegas, E.I.; Jovel, I.; Fontecha, G.A. Genetic diversity of Plasmodium vivax and Plasmodium falciparum in Honduras. Malar. J. 2012, 11, 391. [Google Scholar] [CrossRef]
  25. Matamoros, G.; Escobar, D.; Pinto, A.; Serrano, D.; Ksandrova, E.; Grimaldi, N.; Juarez-Fontecha, G.; Moncada, M.; Valdivia, H.O.; Fontecha, G. PET-PCR reveals low parasitaemia and submicroscopic malarial infections in Honduran Moskitia. Malar. J. 2023, 22, 110. [Google Scholar] [CrossRef]
  26. Ortiz-Morazan, A.S.; Moncada, M.M.; Escobar, D.; Cabrera-Moreno, L.A.; Fontecha, G. Coevolutionary Analysis of the Pfs47-P47Rec Complex: A Bioinformatics Approach. Bioinform. Biol. Insights 2024, 18, 11779322241284223. [Google Scholar] [CrossRef]
  27. Lucchi, N.W.; Narayanan, J.; Karell, M.A.; Xayavong, M.; Kariuki, S.; DaSilva, A.J.; Hill, V.; Udhayakumar, V. Molecular diagnosis of malaria by photo-induced electron transfer fluorogenic primers: PET-PCR. PLoS ONE 2013, 8, e56677. [Google Scholar] [CrossRef]
  28. Kudyba, H.M.; Louzada, J.; Ljolje, D.; Kudyba, K.A.; Muralidharan, V.; Oliveira-Ferreira, J.; Lucchi, N.W. Field evaluation of malaria malachite green loop-mediated isothermal amplification in health posts in Roraima state, Brazil. Malar. J. 2019, 18, 98. [Google Scholar] [CrossRef]
  29. Griffing, S.; Syphard, L.; Sridaran, S.; McCollum, A.M.; Mixson-Hayden, T.; Vinayak, S.; Villegas, L.; Barnwell, J.W.; Escalante, A.A.; Udhayakumar, V. pfmdr1 amplification and fixation of pfcrt chloroquine resistance alleles in Plasmodium falciparum in Venezuela. Antimicrob. Agents Chemother. 2010, 54, 1572–1579. [Google Scholar] [CrossRef]
  30. Kang, J.M.; Lee, J.; Moe, M.; Jun, H.; Le, H.G.; Kim, T.I.; Thai, T.L.; Sohn, W.M.; Myint, M.K.; Lin, K.; et al. Population genetic structure and natural selection of Plasmodium falciparum apical membrane antigen-1 in Myanmar isolates. Malar. J. 2018, 17, 71. [Google Scholar] [CrossRef]
  31. Molina-Cruz, A.; Raytselis, N.; Withers, R.; Dwivedi, A.; Crompton, P.D.; Traore, B.; Carpi, G.; Silva, J.C.; Barillas-Mury, C. A genotyping assay to determine geographic origin and transmission potential of Plasmodium falciparum malaria cases. Commun. Biol. 2021, 4, 1145. [Google Scholar] [CrossRef]
  32. Imwong, M.; Pukrittayakamee, S.; Gruner, A.C.; Renia, L.; Letourneur, F.; Looareesuwan, S.; White, N.J.; Snounou, G. Practical PCR genotyping protocols for Plasmodium vivax using Pvcs and Pvmsp1. Malar. J. 2005, 4, 20. [Google Scholar] [CrossRef]
  33. Han, E.T.; Park, J.H.; Shin, E.H.; Choi, M.H.; Oh, M.D.; Chai, J.Y. Apical membrane antigen-1 (AMA-1) gene sequences of re-emerging Plasmodium vivax in South Korea. Korean J. Parasitol. 2002, 40, 157–162. [Google Scholar] [CrossRef][Green Version]
  34. Tachibana, M.; Suwanabun, N.; Kaneko, O.; Iriko, H.; Otsuki, H.; Sattabongkot, J.; Kaneko, A.; Herrera, S.; Torii, M.; Tsuboi, T. Plasmodium vivax gametocyte proteins, Pvs48/45 and Pvs47, induce transmission-reducing antibodies by DNA immunization. Vaccine 2015, 33, 1901–1908. [Google Scholar] [CrossRef]
  35. Vallejo, A.F.; Martinez, N.L.; Tobon, A.; Alger, J.; Lacerda, M.V.; Kajava, A.V.; Arevalo-Herrera, M.; Herrera, S. Global genetic diversity of the Plasmodium vivax transmission-blocking vaccine candidate Pvs48/45. Malar. J. 2016, 15, 202. [Google Scholar] [CrossRef]
  36. Cao, Y.; Hart, R.J.; Bansal, G.P.; Kumar, N. Functional Conservation of P48/45 Proteins in the Transmission Stages of Plasmodium vivax (Human Malaria Parasite) and P. berghei (Murine Malaria Parasite). mBio 2018, 9, e01627-18. [Google Scholar] [CrossRef]
  37. Kang, J.M.; Le, H.G.; Vo, T.C.; Naw, H.; Yoo, W.G.; Sohn, W.M.; Trinh, N.T.M.; Quang, H.H.; Na, B.K. Genetic Polymorphism and Natural Selection of Apical Membrane Antigen-1 in Plasmodium falciparum Isolates from Vietnam. Genes 2021, 12, 1903. [Google Scholar] [CrossRef]
  38. Tatem, A.J.; Jia, P.; Ordanovich, D.; Falkner, M.; Huang, Z.; Howes, R.; Hay, S.I.; Gething, P.W.; Smith, D.L. The geography of imported malaria to non-endemic countries: A meta-analysis of nationally reported statistics. Lancet Infect. Dis. 2017, 17, 98–107. [Google Scholar] [CrossRef]
  39. Oyegoke, O.O.; Maharaj, L.; Akoniyon, O.P.; Kwoji, I.; Roux, A.T.; Adewumi, T.S.; Maharaj, R.; Oyebola, B.T.; Adeleke, M.A.; Okpeku, M. Malaria diagnostic methods with the elimination goal in view. Parasitol. Res. 2022, 121, 1867–1885. [Google Scholar] [CrossRef]
  40. Banegas, S.; Escobar, D.; Pinto, A.; Moncada, M.; Matamoros, G.; Valdivia, H.O.; Reyes, A.; Fontecha, G. Asymptomatic Malaria Reservoirs in Honduras: A Challenge for Elimination. Pathogens 2024, 13, 541. [Google Scholar] [CrossRef]
  41. Pierre-Louis, E.; Kelley, J.; Patel, D.; Carlson, C.; Talundzic, E.; Jacobson, D.; Barratt, J.L.N. Geo-classification of drug-resistant travel-associated Plasmodium falciparum using Pfs47 and Pfcpmp gene sequences (USA, 2018–2021). Antimicrob. Agents Chemother. 2024, 68, e0120324. [Google Scholar] [CrossRef]
  42. Takahashi, N.; Tanabe, K.; Tsukahara, T.; Dzodzomenyo, M.; Dysoley, L.; Khamlome, B.; Sattabongkot, J.; Nakamura, M.; Sakurai, M.; Kobayashi, J.; et al. Large-scale survey for novel genotypes of Plasmodium falciparum chloroquine-resistance gene pfcrt. Malar. J. 2012, 11, 92. [Google Scholar] [CrossRef]
  43. Mejia Torres, R.E.; Banegas, E.I.; Mendoza, M.; Diaz, C.; Bucheli, S.T.; Fontecha, G.A.; Alam, M.T.; Goldman, I.; Udhayakumar, V.; Zambrano, J.O. Efficacy of chloroquine for the treatment of uncomplicated Plasmodium falciparum malaria in Honduras. Am. J. Trop. Med. Hyg. 2013, 88, 850–854. [Google Scholar] [CrossRef]
  44. Mohammed, A.; Ndaro, A.; Kalinga, A.; Manjurano, A.; Mosha, J.F.; Mosha, D.F.; van Zwetselaar, M.; Koenderink, J.B.; Mosha, F.W.; Alifrangis, M.; et al. Trends in chloroquine resistance marker, Pfcrt-K76T mutation ten years after chloroquine withdrawal in Tanzania. Malar. J. 2013, 12, 415. [Google Scholar] [CrossRef]
  45. Musyoka, K.B.; Kiiru, J.N.; Aluvaala, E.; Omondi, P.; Chege, W.K.; Judah, T.; Kiboi, D.; Nganga, J.K.; Kimani, F.T. Prevalence of mutations in Plasmodium falciparum genes associated with resistance to different antimalarial drugs in Nyando, Kisumu County in Kenya. Infect. Genet. Evol. 2020, 78, 104121. [Google Scholar] [CrossRef]
  46. Sarah-Matio, E.M.; Guillochon, E.; Nsango, S.E.; Abate, L.; Ngou, C.M.; Bouopda, G.A.; Feufack-Donfack, L.B.; Bayibeki, A.N.; Tchioffo Tsapi, M.; Talman, A.; et al. Genetic Diversity of Plasmodium falciparum and Distribution of Antimalarial Drug Resistance Mutations in Symptomatic and Asymptomatic Infections. Antimicrob. Agents Chemother. 2022, 66, e0018822. [Google Scholar] [CrossRef]
  47. Xu, W.; Zhang, X.; Chen, H.; Zhang, J.; Lu, Q.; Ruan, W.; Wang, X. Molecular markers associated with drug resistance in Plasmodium falciparum parasites in central Africa between 2016 and 2021. Front. Public Health 2023, 11, 1239274. [Google Scholar] [CrossRef]
  48. Zhang, J.J.; Senaratne, T.N.; Daniels, R.; Valim, C.; Alifrangis, M.; Amerasinghe, P.; Konradsen, F.; Rajakaruna, R.; Wirth, D.F.; Karunaweera, N.D. Distribution pattern of Plasmodium falciparum chloroquine transporter (pfcrt) gene haplotypes in Sri Lanka 1996–2006. Am. J. Trop. Med. Hyg. 2011, 85, 811–814. [Google Scholar] [CrossRef]
  49. Gamboa, D.; Ho, M.F.; Bendezu, J.; Torres, K.; Chiodini, P.L.; Barnwell, J.W.; Incardona, S.; Perkins, M.; Bell, D.; McCarthy, J.; et al. A large proportion of P. falciparum isolates in the Amazon region of Peru lack pfhrp2 and pfhrp3: Implications for malaria rapid diagnostic tests. PLoS ONE 2010, 5, e8091. [Google Scholar] [CrossRef]
  50. Molina-Cruz, A.; Canepa, G.E.; Alves, E.S.T.L.; Williams, A.E.; Nagyal, S.; Yenkoidiok-Douti, L.; Nagata, B.M.; Calvo, E.; Andersen, J.; Boulanger, M.J.; et al. Plasmodium falciparum evades immunity of anopheline mosquitoes by interacting with a Pfs47 midgut receptor. Proc. Natl. Acad. Sci. USA 2020, 117, 2597–2605. [Google Scholar] [CrossRef]
Figure 1. Schematic representation of the amino acid motifs of the three allelic pvcsp variants bearing the VK210 repeat type and one bearing the VK247 type.
Figure 1. Schematic representation of the amino acid motifs of the three allelic pvcsp variants bearing the VK210 repeat type and one bearing the VK247 type.
Tropicalmed 10 00292 g001
Table 1. List of primers used for the amplification of molecular markers of Plasmodium vivax and P. falciparum.
Table 1. List of primers used for the amplification of molecular markers of Plasmodium vivax and P. falciparum.
Target GeneReactionPrimer NamePrimer Sequence (5′-3′)References
18Sr RNA genePET-PCR for genus PlasmodiumGenus forwardGGC CTA ACA TGG CTA TGA CG[25,27]
Genus reverse6FAM-agg cgc ata gcg cct gg CTG CCT TCC TTA GAT GTG GTA GCT
18Sr RNA genePET-PCR for P. falciparumFalciparum forwardACC CCT CGC CTG GTG TTT TT[27]
Falciparum reverseHEX-agg cgc ata gcg cct gg TCG GGC CCC AAA AAT AGG AA
18Sr RNA genePET-PCR for P. vivaxVivax forwardACT GAC ACT GAT GAT TTA GAA CCC ATT T[28]
Vivax reverseHEX- agg cgc ata gcg cct ggT GGA GAG ATC TTT CCA TCC TAA ACC T
pfcrt1st roundAL6821AGC AAA AAT GAC GAG CGT TAT AG[3,29]
AL6822ATT GGT AGG TGG AAT AGA TTC TC
2nd roundAL5631TTT TTC CCT TGT CGA CCT TAA C
AL5632AGG AAT AAA CAA TAA AGA ACA TAA TCA TAC
pfmdr1SNPs 86, 184MDR1-1FTTA AAT GTT TAC CTG CAC AAC ATA GAA AAT T[20]
MDR1-1RCTC CAC AAT AAC TTG CAA CAG TTC TTA
MDR1-2FTGT ATG TGC TGT ATT ATC AGGA
MDR1-2RCTC TTC TAT AAT GGA CAT GGTA
pfmdr1SNPs 1034, 10461042-AGTC GAA AAG ACT ATG AAA CGT AGA[20]
1042-CCTC AAA TGA TAA TTT TGC AT
1042-BGAT CCA AGT TTT TTA ATA CA
1042-CCTC AAA TGA TAA TTT TGC AT
pfmdr1SNP 12461246-AGTG GAA AAT CAA CTT TTA TGA[20]
1246-BTTA GGT TCT CTT AAT AAT GCT
1246-CGAC TTG AAA AAT GAT CAC ATT
1246-DGTC CAC CTG ATA TGC TTT T
pfglurp1st roundGLURPOFTGA ATT TGA AGA TGT TCA CAC TGA AC[3,11]
GLURPORGTG GAA TTG CTT TTT CTT CAA CAC TAA
2nd roundGLURPGNFTGT TCA CAC TGA ACA ATT AGA TTT AGA TCA
GLURPORGTG GAA TTG CTT TTT CTT CAA CAC TAA
pfama11st roundPfama1FGTA CTT GTT ATA AAT TGT ACA[30]
Pfama1RTTT TAG CAT AAA AGA GAA GC
2nd roundPfama1F1ACA AAA ATG AGA AAA TTA TAC TGC[30]
Pfama1R1TTA ATA GTA TGG TTT TTC CAT CAG AAC
pfhrp2 exons 1–21st round2E12F1GGT TTC CTT CTC AAA AAA TAA AG[18,19]
2E12R1TCT ACA TGT GCT TGA GTT TCG
2nd round2E12FGTA TTA TCC GCT GCC GTT TTT GCC
2E12RCTA CAC AAG TTA TTA TTA AAT GCG GAA
pfhrp3 exons 1–21st round3E12F1GGT TTC CTT CTC AAA AAA TAA AA[18,19]
3E12R1CCT GCA TGT GCT TGA CTT TA
2nd round3E12FATA TTA TCG CTG CCG TTT TTG CT
3E12RCTA AAC AAG TTA TTG TTA AAT TCG GAG
pfs47 Pfs47_SNP707_FGAA GAA ACT ATT GTA GAA TCT GGA AA[15,31]
Pfs47SNP725_RAAG GCA TTT TTA TAA CCA CAT TAT TA
pvcsp1st roundVCS-OFATG TAG ATC TGT CCA AGG CCA TAA A[24,32]
VCS-ORTAA TTG AAT AAT GCT AGG ACT AAC AAT ATG
2nd roundVCS-NFGCA GAA CCA AAA AAT CCA CGT GAA AAT AAG
VCS-NRCCA ACG GTA GCT CTA ACT TTA TCT AGG TAT[24,33]
pvmsp1 F2 block1st roundVMI-O2FGAT GGA AAG CAA CCG AAG AAG GGA AT[24,32]
VMI-O2RAGC TTG TAC TTT CCA TAG TGG TCC AG
2nd roundVMI-N2FAAA ATC GAG AGC ATG ATC GCC ACT GAG AAG
VMI-O2RAGC TTG TAC TTT CCA TAG TGG TCC AG
pvmsp3α1st roundPvmsp3a P1CAG CAG ACA CCA TTT AAG G[3,12]
Pvmsp3a P2CCG TTT GTT GAT TAG TTG C
2nd roundPvmsp3a N1GAC CAG TGT GAT ACC ATT AAC C
pvmsp3β1st roundPvmsp3b P1GTA TTC TTC GCA ACA CTC
Pvmsp3b P2CTT CTG ATG TTA TTT CCA G
2nd roundPvmsp3b N1CGA GGG GCG AAA TTG TAA ACC
Pvmsp3b N2GCT GCT TCT TTT GCA AAG G
pvs471st roundCM 000453 FwdCAC ACC ACC GCA AAC AGG[16]
CM 000453 RevGTG CAC ATT CCG CGG TTG
2nd roundnst 1440 FwdGCG GTC CAC CCT AAC TGT AAThis study
nst 1440 RevTGC TGC AAA CCA CAC ATG T[34]
Sequencing primerspPvs47-FATA TTT CCA ACG AAG CAT TTA TGC
pPvs47-RTTT TCC ATT ATG CTC ACA AAC GC
Pvs47F2GAA GAA AGG GGA GGA CCA AG[16]
pvs48/451st roundPvs4845FGGA ATA ATT TCG ACC ACT C[35]
887TCA GAA GTA CAA CAG GAG GAG CAC[36]
2nd round866ATG TTG AAG CGC CAG CTC GCC AA
887TCA GAA GTA CAA CAG GAG GAG CAC
pvs48/45Sequencing primerspPvs4845FATG GCC AAA GGA GAG GTC AAG TAC[34]
pPvs4845RTCG GCA GAT GCA AGT GAA GGA AGT C
pPvs48/45-6C-FTCG GCA GAT GCA AGT GAA GGA AGT C
Pvs4845FFTGT AAA ATC TGC GGA CGT GA[16]
Pvs4845RRCGGGTGCTTTAAAAATGGAA
1001FGAATGAGTTGCCCTGGGGAAThis study
1025FTGCCCGAGTGCTTCTTTCAA
249RTCCTGGGATCTTCTTCGGGA
494RAAGGCCACTCTTCCCTTCAC
Table 2. Results of P. falciparum molecular markers applied to sample “M1”.
Table 2. Results of P. falciparum molecular markers applied to sample “M1”.
SampleOriginpfcrtpfmdr1pfhrp2pfhrp3pfama1pfs47
M1Unknown72CVMNK76NFSNDPresentPresentNew haplotype
(Acc. No. PV567569)
707C, 725C
Table 3. Results of P. vivax molecular markers applied to samples “M2” to “M5”.
Table 3. Results of P. vivax molecular markers applied to samples “M2” to “M5”.
SampleOriginpvcsppvmsp3a-N1pvmsp3a-N2pvmsp3b-N1pvmsp3b-N2pvmsp1(F2)pvs47pvs48/45
M2AfghanistanVK247 type.
New haplotype (Acc. No. PV567574)
-PD *New haplotype (Acc. No. PV590042)PD-F22, F24, K27, D31, S57, S62, L82, D156, V230, M233, E240, I262, I273, A373E35, Y196, H211, K250, D335, E353, A376, I380, K390, K418
M3Venezuela-PDPDNew haplotype (Acc. No. PV590042)PDPD22L, F24; K27, D31, S57, S62, L82, D156, V230, M233, E240, I262, I273, A373E35, Y196, 211N, K250, D335, E353, A376, I380, K390, K418
M4UnknownVK210 type.
New haplotype (Acc. No. PV567571)
New haplotype (Acc. No. PV590041)PD---F22, F24; K27, D31, S57, S62, L82, D156, V230, M233, E240, I262, I273, A373-
M5UnknownVK210 type.
New haplotype (Acc. No. PV567570)
PDPDNew haplotype (Acc. No. PV590042)PDPD22L, F24; K27, D31, S57, S62, L82, D156, V230, M233, E240, I262, I273, A373E35, Y196, 211N, K250, D335, E353, A376, I380, K390, K418
* PD = Previously described in the country.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Godoy, A.; Euceda, K.; Pinto, A.; Valdivia, H.O.; Chaver, L.; Ardon, G.; Fontecha, G. Molecular Characterization of Plasmodium Species to Strengthen Malaria Surveillance in Migrant Populations in Honduras. Trop. Med. Infect. Dis. 2025, 10, 292. https://doi.org/10.3390/tropicalmed10100292

AMA Style

Godoy A, Euceda K, Pinto A, Valdivia HO, Chaver L, Ardon G, Fontecha G. Molecular Characterization of Plasmodium Species to Strengthen Malaria Surveillance in Migrant Populations in Honduras. Tropical Medicine and Infectious Disease. 2025; 10(10):292. https://doi.org/10.3390/tropicalmed10100292

Chicago/Turabian Style

Godoy, Ashley, Kevin Euceda, Alejandra Pinto, Hugo O. Valdivia, Lesly Chaver, Gloria Ardon, and Gustavo Fontecha. 2025. "Molecular Characterization of Plasmodium Species to Strengthen Malaria Surveillance in Migrant Populations in Honduras" Tropical Medicine and Infectious Disease 10, no. 10: 292. https://doi.org/10.3390/tropicalmed10100292

APA Style

Godoy, A., Euceda, K., Pinto, A., Valdivia, H. O., Chaver, L., Ardon, G., & Fontecha, G. (2025). Molecular Characterization of Plasmodium Species to Strengthen Malaria Surveillance in Migrant Populations in Honduras. Tropical Medicine and Infectious Disease, 10(10), 292. https://doi.org/10.3390/tropicalmed10100292

Article Metrics

Back to TopTop