Next Article in Journal
Coexisting in the Surf Zone: Age and Feeding Habits of the Spotted Seabass (Dicentrarchus punctatus) and European Seabass (Dicentrarchus labrax) on the Gulf of Cádiz Beaches (Southwest Iberian Peninsula)
Previous Article in Journal
Reducing Artisanal Fishery Impact on Marine Community: New Data from Comparison of Innovative and Traditional Gear
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fishes
Volume 9
Issue 5
10.3390/fishes9050172
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Cloning, Characterization and Functional Analysis of Caspase 8-like Gene in Apoptosis of Crassostrea hongkongensis Response to Hyper-Salinity Stress

by
Jinji Lin
1,2,
Ziqi Yu
2,
Yang Leng
3,
Jiexiong Zhu
1,2,
Feifei Yu
1,2,4,*,
Yishan Lu
1,2,4,*,
Jiayu Chen
1,2,
Wenhao He
1,2,
Yixin Zhang
1,2 and
Yaoshen Wen
2
1
Shenzhen Institute of Guangdong Ocean University, Shenzhen 518120, China
2
Fishery College of Guangdong Ocean University, Zhanjiang 524088, China
3
Experiment Animal Center, Guangdong Medical University, Zhanjiang 524023, China
4
Academician Joint Laboratory of Germplasm Resource Exploitation, Utilization and Health Assessment for Aquatic Animal, Guangdong Ocean University, Zhanjiang 524088, China
*
Authors to whom correspondence should be addressed.
Fishes 2024, 9(5), 172; https://doi.org/10.3390/fishes9050172
Submission received: 21 March 2024 / Revised: 26 April 2024 / Accepted: 6 May 2024 / Published: 9 May 2024
(This article belongs to the Section Aquatic Invertebrates)
Browse Figures
Review Reports Versions Notes

Abstract

:
Caspase-8, a member of the caspase family, is an initiating caspase and plays a crucial role in apoptosis. In this study, the full-length cDNA of caspase8-like (CASP8-like) was isolated from Crassostrea hongkongensis (C. hongkongensis) by RACE-PCR. ChCASP8-like contained a 1599-bp open reading frame (ORF) encoding 533 amino acids with two conserved death effector domains (DEDs) and a cysteine aspartase cysteine structural domain (CASc). Amino acid sequence comparison showed that ChCASP8-like shared the highest identity (85.4%) with CASP8-like of C. angulata. The tissue expression profile showed that ChCASP8-like was constitutively expressed in gills, hepatopancreas, mantle, adductor muscle, hemocytes and gonads, and was significantly upregulated in hemocytes, hepatopancreas and gills under hyper-salinity stress. The apoptosis-related genes, including ATR, CHK1, BCL-XL, CASP8-like, CASP9 and CASP3, were significantly activated by hyper-salinity stress, but were remarkably inhibited by ChCASP8-like silencing. The caspase 8 activity was increased by 1.7-fold after hyper-salinity stress, and was inhibited by 9.4% by ChCASP8-like silencing. Moreover, ChCASP8-like silencing clearly alleviated the apoptosis resulting from hyper-salinity stress. These results collectively demonstrated that ChCASP8-like played a crucial role in inducing apoptosis against hyper-salinity stress.
Keywords:
Crassostrea hongkongensis; caspase8-like; apoptosis; hyper-salinity stress
Key Contribution: In this study; a novel CASP8-like gene was characterized from C. hongkongensis. The tissue expression profile showed that ChCASP8-like had constitutive expression in all tissues, and was significantly upregulated in gills, hepatopancreas and hemocytes after hyper-salinity stress. Apoptosis-related gene transcripts and caspase 8 activity were significantly increased under hyper-salinity stress, and significantly decreased after ChCASP8-like interference. Moreover, exposure to hyper-salinity stress caused severe apoptosis, which could be alleviated by ChCASP8-like silencing.

1. Introduction

Apoptosis, or programmed cell death, plays an important role in the homeostasis and function of the immune system [1,2,3]. Apoptosis is divided into intrinsic and extrinsic apoptosis pathways based on the nature of initiating signals [4]. The intrinsic apoptosis pathway is activated to release cytochrome c from the mitochondria to promote cell apoptosis when the organism suffers from DNA damage, growth arrest, or virus infection [5]. The extrinsic apoptosis pathway is activated through interactions between extracellular ligands and death receptors, and initiates downstream caspase proteins [4].
Caspases (cysteine-dependent aspartyl-specific protease) are essential for the initiation and execution of apoptosis and inflammatory response [6]. As a member of the caspase family, caspase 8 (Casp8) has been well characterized as an initiator caspase involved in extrinsic apoptosis in vertebrates [7]. Caspase 8 associated with Fas-associated protein with the death domain (FADD) to form the death-inducing signaling complex (DISC) [6] undergoes self-cleavage and activates downstream caspase proteins to trigger apoptosis. The Caspase-8-like gene, which is the most similar to caspase 8, is considered to function as an initiator caspase and plays crucial roles in extrinsic apoptotic pathways in some mollusk species [4,8]. However, some researchers found that caspase-8-like worked as a caspase suppressor to inhibit apoptosis and immune signaling in silkworm (Bombyx mori) [9]. The contradiction in this research implies that functional differences in caspase-8-like exist in different invertebrates.
Crassostrea hongkongensis (C. hongkongensis), a commercially valuable marine bivalve in South China, lives in estuaries and exhibits remarkable euryhaline traits with an optimal salinity range of 10–25 ppt [10]. However, large salinity fluctuations in estuary areas often pose a significant threat to oysters, especially hyper-salinity stress due to drought and high temperature. Salinity fluctuation is a crucial environmental factor that affects the reproduction, growth, development and survival of aquatic animals. Changes in salinity create osmotic gradients between intra- and extracellular environments of aquatic species. If not compensated for, these changes might disrupt cell volume, impair protein function and ultimately lead to death [11]. Therefore, shellfish living in estuaries must adjust their physiology to maintain homeostasis in the intracellular environment of their organisms during periods of fluctuating salinity [12,13]. However, prolonged exposure to high salinity can decrease the immunity of bivalves, resulting in outbreaks of various diseases and mass mortality [14,15]. Apoptosis is a crucial process in oyster cells that effectively eliminates damaged, senescent and infected cells without triggering inflammation. The CASP8 gene of C. hongkongensis has been identified and confirmed to activate the NF-κB and p53 signaling pathways in the immune response against bacterial challenge in a previous report. However, there was no elaborate description on the function of the CASP8-like gene in the apoptosis of C. hongkongensis.
In this study, a novel CASP8-like gene was cloned from C. hongkongensis and named ChCASP8-like. The expression profiles in different tissues were analyzed before and after hyper-salinity stress. The function of ChCASP8-like in apoptosis was identified by RNAi, TUNEL (Terminal deoxynucleotidyl transferase (TdT) dUTP Nick-End Labeling) and caspase activity assays.

2. Materials and Methods

2.1. Experimental Animals

First-aged healthy C. hongkongensis (mean weight of 142.2 ± 10.0 g, mean shell length of 6.1 ± 1.0 cm, mean shell width of 4.0 ± 0.5 cm, mean shell height of 9.9 ± 1.0 cm) were collected from an aquaculture farm in Zhanjiang, Guangdong Province, China. The oysters were temporarily raised in 20 ± 0.5‰ seawater at 25.0 ± 0.5 °C for 3 days and fed with Isochrysis zhanjiangensis once a day.

2.2. RNA Isolation and cDNA Synthesis

Total RNA was respectively isolated from 2 g of the gonads, adductor, mantle, gills, hepatopancreas, and hemocytes using TRIzol Reagent (Sangon Biotech, Shanghai, China) according to the manufacturer’s protocol. The integrity of the RNA was verified through 1.0% agarose gel electrophoresis. RNA quality was checked by observing the 260/280 and 260/230 absorbance ratios using a NanoDrop 2000 Spectrophotometer (Thermo Fisher, Waltham, MA, USA). The cDNA was synthesized using 0.1 μg of RNA as a template and 1 μL of 0.1 μg/μL random primer. The first-strand cDNA template was synthesized using the EasyScript® One-Step gDNA Removal and cDNA Synthesis SuperMix Kit (TransGen Biotech, Beijing, China) according to the manufacturer’s instructions.

2.3. cDNA Cloning and Sequence Analysis

Following previous reports [16], the full-length cDNA of CASP8-like was cloned using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher, Waltham, MA, USA), the 5′ RACE system for rapid amplification of cDNA ends (Thermo Fisher, Waltham, MA, USA) and the SMART RACE cDNA amplification kit (Clontech, CA, USA). Based on the ChCASP8-like partial sequences in the transcriptome data, specific primers were designed using Primer Premier 5.0 (https://www.premierbiosoft.com, accessed on 8 April 2023) (Table 1). The ChCASP8-like-outer-F and UMP primers were used to amply the 3′ sequence of 667 bp, and ChCASP8-like-outer-R and UMP primers were used to amply the 5′ sequence of 606 bp. The PCR products were detected using a gel imaging system (Bio-Rad, Hercules, CA, USA), and the target fragments were collected. Nested-PCR was applied using ChCASP8-like-inner-F and ChCASP8-like-inner-R to enrich the specific DNA band. The full-length cDNA sequence of ChCASP8-like was validated by conducting a test-PCR using primers ChCASP8-like-test-F and ChCASP8-like-test-R. The primer sequences are shown in Table 1.
Using the blast program (http://www.ncbi.nlm.nih.gov/, accessed on 10 June 2023), the full-length cDNA of CASP8 was analyzed. The open reading frame (ORF) was identified with the ORF Finder program (https://www.ncbi.nlm.nih.gov/orffinder/, accessed on 16 September 2023). The molecular weight and theoretical isoelectric point (pI) were analyzed using a program online (http://web.expasy.org/cgibin/protparam/protparam, accessed on 23 December 2023). The TMHMM procedure (https://web.expasy.org/protparam/, accessed on 25 December 2023) was used to predict the transmembrane domain, and the SignalP program (http://www.cbs.dtu.dk/services/SignalP/, accessed on 25 December 2023) was used to predict signal peptides. Multiple sequence alignments were created by the ClustalX program. The phylogenetic tree was constructed through the neighbor-joining method using MEGA7.0 software.

2.4. Salt Stress Experiment and Sampling

Healthy oysters were randomly divided into two groups and cultured in two tanks with hyper-salinity seawater (40‰) and natural seawater (20‰), respectively. In total, 25 experimental individuals were placed in each tank. The water used for aquaculture was created by mixing seawater with sea crystals to produce 40‰ seawater (Yantong, Jiangxi, China) [17,18,19]. After 0 and 48 h of salt stress, the adductor muscle, mantle, gills, hepatopancreas and gonads of 5 individuals were collected for subsequent gene expression analysis. The hemolymph was withdrawn from the pericardial cavity of experimental oysters using a 1 mL sterile syringe. Each hemolymph sample was a mixture of three individuals, and 5 parallel samples were collected at each time point. The hemolymph was centrifuged at 3000 rpm at 4.0 °C for 5 min to separate the hemolymph supernatant and hemocytes. The hemocytes were suspended in Trizol reagent (TransGen Biotech, Beijing, China) for RNA extraction.

2.5. RNA Interference (RNAi) Experiment

RNAi was performed to test the function of ChCASP8-like. The specific small interfering RNA (ChCASP8-like-siRNA) was synthesized by ChCASP8-like-siRNA-F and ChCASP8-like-siRNA-R (Table 1). The green fluorescent protein (GFP) was cloned from the pEGFP-N3 plasmid, and GFP-siRNA was generated by GFP-siRNA-F and GFP-siRNA-R primers as a negative control (NC). The siRNA was synthesized with the T7 High Efficiency Transcription Kit (TransGen, Beijing, China) and purified with the EasyPure RNA Purification Kit (TransGen, Beijing, China).
In the RNAi experiment, each oyster was intramuscularly injected with 50.0 μL of 1.0 μg/μL siRNA and reinjected with the same dose on the fourth day to enhance the silencing effect. After the injection, the oysters were subjected to salt stress for 48 h. The hemocytes from 3 individuals were mixed as a sample, and 5 parallel samples were collected for TUNEL assay. The gills, hepatopancreas, mantle, adductor muscle and gonads were collected from each experimental individual for gene expression analysis and caspase activity analysis. Five parallel samples were collected.

2.6. Quantitative Real-Time PCR (qRT-PCR) Analysis

The qRT-PCR was performed using the LightCycler 96 instrument (Roche, Basel, Switzerland) following the manufacturer’s protocol for PerfecterStart Green qPCR SuperMix (TransGen Biotech, Beijing, China). The reaction was run in a 10 µL volume containing 20 ng of cDNA, 0.3 µM of each primer and 5 µL of Green qPCR SuperMix. The optimal PCR conditions were established as follows: 95 °C for 2 min followed by 35 cycles of 95 °C for 5 s, 60 °C for 20 s and 72 °C for 20 s. Each sample was run in triplicate, along with the internal control gene β-actin. The specific primers are listed in Table 1. The relative expression level of each target gene was calculated by the 2−ΔΔCt method [20].

2.7. Caspase 8 and Caspase 3 Activity Analysis in Gills of C. hongkongensis

The caspase 8 and 3 activities of C. hongkongensis were determined using the Caspase 8 and Caspase 3 Assay Kit (Nanjing Jiancheng, Jiangsu, China) according to the manufacturer’s instructions. Briefly, 50 mg of gills was incubated with 50 μL of pre-cooled lysate and homogenized on ice for 15 min. Then, the mixture was centrifuged at 12,000 rpm for 10 min at 4 °C to separate the supernatant. A small amount of supernatant was used to determine the protein concentration by the Bradford method. For caspase 3 activity analysis, 50 μL of supernatant containing 200 μg of protein was mixed with 5 μL of Ac-DEVD-pNA (acetyl-Asp-Glu-Val-Asp p-nitroaniline) substrate and 50 μL of 2× buffer in the dark at 37 °C for 4 h. For caspase 8 activity analysis, 50 μL of supernatant containing 200 μg of protein was mixed with 5 μL of Ac-IETD-pNA (acetyl-Ile-Glu-Thr-Asp p-nitroaniline) substrate and 50 μL of 2× buffer. The concentrations of pNA released from the substrate by caspase 8 and caspase 3 were calculated according to the absorbance values at 405 nm [21]. The activities of caspase 8 and caspase 3 were assessed by measuring the OD405 values of the treated tissues in comparison to the control tissues.

2.8. TUNEL Assay

TUNEL assay was designed to detect apoptotic cells that undergo extensive DNA degradation in early and late stages of apoptosis [22].The TUNEL assay was performed according to the manufacturer’s instruction of the TUNEL Apoptosis Detection Kit (Alexa Fluor 488). The hemocytes of experimental oysters were collected by centrifugation at 2000 rpm for 5 min. The hemocytes were resuspended in PBS (2 × 107/mL) and gently spread on polylysine-coated slides. Then, the hemocytes on the slide were fixed with 4% paraformaldehyde for 25 min at 4 °C and washed with PBS twice. The slide was incubated with 100 μL of 20 μg/mL protease K solution for 5 min at room temperature and washed with PBS three times. Samples were incubated in 5× Equilibration Buffer (Yesen, Shanghai, China) for 20 min and stained with 2 μg/mL of DAPI in the dark for 5 min. The hemocytes were examined under a fluorescence microscope (Thermo Fisher Scientific, Waltham, MA, USA).

2.9. Statistical Analysis

Data were subjected to statistical analyses using SPSS 22.0 software (IBM, Armonk, NY, USA). A one-way analysis of variance (ANOVA) was performed to determine the significant difference in different samples by SPSS (24.0 version, IBM, USA). The significant differences among samples (N = 5) were presented as * p < 0.05, and highly significant differences were shown as ** p < 0.01.

3. Results

3.1. Cloning and Sequence Analysis of Caspase8-like from C. hongkongensis

The full-length cDNA sequence of the CASP8-like gene was cloned from C. hongkongensis by RACE-PCR (GenBank accession number: OR066208) and named Chcaspase8-like (ChCASP8-like). As shown in Figure 1A, the full cDNA sequence of ChCASP8-like was 2015 bp in length, containing a 1599-bp open reading frame (ORF), an 84-bp 5′ untranslated region (UTR) and a 332-bp 3′ UTR with a polyadenylation signal sequence (aataaa) located upstream of the poly (A) tail. The ORF encoded 533 amino acids. The bioinformatics analysis of cDNA sequences did not reveal signal peptides or transmembrane domains. The predicted polypeptide sequence contained a conserved cysteine aspartase cysteine structural domain (CASc) in the C-terminal and two death effector domains (DEDs) in the N-terminal (Figure 1B and Figure 2A). The deduced molecular mass of ChCASP8-like protein was 59.17 kDa with a theoretical isoelectric point (pI) of 5.37.

3.2. Multiple Sequence Alignment and Phylogenetic Analysis

The amino acid sequence of ChCASP8-like was compared among different species. The ChCASP8-like shared the highest identity (85.4%) with CASP8-like of Crassostrea angulata (C. angulate), 56.7% with CASP8-like of Crassostrea virginica (C. virginica) and 49.2% with CASP8-like of Ostrea edulis (O. edulis). However, the ChCASP8-like shared low identity with the CASP8 gene of C. hongkongensis, which was only 30.0%. Lower identity was reported among CASP8 of C. hongkongensis and vertebrates, ranging from 23.1% to 27.7% (Figure 2A).
The phylogenetic trees were constructed using MEGA7 to indicate the evolutionary relationship of caspase 8 from different species (Figure 2B). The results showed that all caspase 8-like genes from the referred mollusks were clustered into one branch, including C. hongkongnsis, C. angulata, C. virginica and O. edulis. All caspase 8 genes from referred species were grouped into a big cluster, in which caspase 8 from vertebrates were classified to a close cluster, including Danio rerio, Mauremys reevesii, Gallus gallus and Homo sapiens. The caspase 8-like and caspase 8 gene of C. hongkongnsis exhibited farther distance.

3.3. ChCASP8-like Expression Profile in Different Tissues

The relative expression levels of ChCASP8-like in different tissues were detected by qRT-PCR before and after salt stress. As shown in Figure 3, ChCASP8-like was constitutively expressed in all analyzed tissues, including gills, hepatopancreas, mantle, adductor muscle, hemocytes and gonads. Before salt stress, ChCASP8-like had the highest expression level in the adductor muscle, a higher level in the gills and mantle, and lower level in the hepatopancreas, gonads and hemocytes. ChCASP8-like transcripts were significantly up-regulated in immune tissues such as gills, hepatopancreas and hemocytes after 48 h of hyper-salinity stress, including a 3.2-fold increase in the gills (p < 0.01), a 3.0-fold increase in the hepatopancreas (p < 0.01) and a 3.0-fold increase in hemocytes (p < 0.01), but it was significantly downregulated by 1.7-fold in the adductor muscle (p < 0.05). These data indicated that ChCASP8-like was involved in the immune response against hyper-salinity stress.

3.4. The Transcriptions of Apoptosis-Related Genes Were Stimulated by Hyper-Salinity Stress, but Were Inhibited by ChCASP8-like Silence

To analyze the function of ChCASP8-like in the analyzed tissues following hyper-salinity stress, ATR, the master regulator of the DNA replication stress response [23,24,25], was significantly increased by 5.9-fold (p < 0.01). CHK1, an important kinase involved in the S phase DNA damage checkpoint, was remarkably upregulated by 9.9-fold (p < 0.01). The CASP8-like, an initiator caspase [26], was significantly upregulated by 5.4-fold (p < 0.01). CASP9, an efficient executor of apoptosis [27], was significantly increased by 8.0-fold (p < 0.01). CASP3 and BCL-XL transcripts showed no significant difference (p > 0.05). These results indicated that hyper-salinity stress induced the expression of most apoptosis-related genes.
However, under ChCASP8-like silence and hyper-salinity stress, the transcripts of ATR, CHK1, BCL-XL, CASP8-like, CASP9 and CASP3 were significantly inhibited compared to the hyper-salinity stress groups, and recovered close to the control level (NC group) (Figure 4). These data indicated that the stimulatory effects of hyper-salinity stress on apoptosis-related genes were blocked by ChCASP8-like silencing.

3.5. The Caspase 8 Activity Was Increased by Hyper-Salinity Stress, but Was Inhibited by ChCASP8-like Silence

Caspase 8 activity is an important indicator of the apoptosis degree. The caspase 8 activity was examined after hyper-salinity stress and ChCASP8-like silencing in gills. As shown in Figure 5A, compared with the control group, the caspase 8 activity was significantly increased by 1.7-fold (p < 0.01) after hyper-salinity stress. With ChCASP8-like knockdown and hyper-salinity stress, the caspase 8 activity was inhibited by 9.4% (p < 0.05) compared to the hyper-salinity stress group. The data showed that caspase 8 activity was significantly activated by hyper-salinity stress, but was slightly reduced by ChCASP8-like silencing, consistent with apoptotic gene expression analysis.
Caspase 3 was a key executor of apoptosis and played a crucial role in the final step of apoptosis. Therefore, the caspase 3 activity was analyzed here. The caspase 3 activity assay showed no significant difference after hyper-salinity stress and ChCASP8-like silencing (Figure 5B).

3.6. ChCASP8-like Silencing Alleviated the Apoptosis Resulted from Hyper-Salinity Stress

To further explore the effect of ChCASP8-like apoptosis resulted from hyper-salinity stress, the TUNEL assay was performed to detect the DNA damage of hemocytes in the ChCASP8-like-siRNA and GFP-siRNA groups. As shown in Figure 6, without the hyper-salinity stress, almost no damaged cells were found in the NC group. After hyper-salinity stress, approximately 87.5% of the hemocytes showed DNA breaks in the positive cells. After silencing ChCASP8-like, fewer DNA breaks were observed in hemocytes in approximately 36.4% of the positive cells. The data indicated that exposure to hyper-salinity stress caused severe apoptosis, which could be alleviated by ChCASP8-like silence. The ChCASP8-like played a crucial role in activating apoptosis against hyper-salinity stress in oysters.

4. Discussion

Oysters, a keystone bivalve living in estuarine and intertidal zones, are subject to frequent environmental disturbances, such as rapid salinity fluctuations [10,28]. C. hongkongensis, the major aquaculture species in South China, is prone to hypersalinity-related mass mortality. It is essential to investigate the strategy of C. hongkongensis against the threat of fluctuating salinity. Apoptosis is an important survival pathway of organism response to salinity stress by orderly caspase events.
The caspase-8-like gene has been characterized in several mollusk species, including Haliotis discus [29], Mytilus galloprovincialis [30], C. hongkongensis and Crassostrea gigas [4]. In vertebrates, caspase 8 had two DED motifs, which were responsible for the self-activation of the inactive proenzyme [31]. In mammals, DEDs formed intracellular filaments and transmitted the external death signals to downstream effectors by cleaving caspase-8 [32]. This was critical for caspase 8 activation and the subsequent induction of apoptosis.
Amino acid sequence alignment showed that CASP8-like of C. hongkongensis had the highest identity (86.5%) with CASP8-like of Crassostrea angulate. The phylogenetic tree analysis also showed that the ChCASP8-like genes of Crassostrea angulate, Crassostrea virginica and Ostrea edulis were grouped into an evolutionary branch. Therefore, the novel caspase gene of C. hongkongensis was named as ChASP8-like. However, it is worth mentioning that the amino acid sequence of ChCASP8-like shared low identity (30.0%) with CASP8 of C. hongkongensis (AHB50667.1) [8]. We hypothesized that ChCASP8-like and CASP8 were different isoforms. Caspase-8 was found to be effective in activating the NF-kB pathway and p53/p21 pathway in oysters after bacterial infection [8]. In our study, we found that salt stress activated DNA damage repair-related genes (e.g., ATR and CHK1), apoptosis-related genes (e.g., caspase 9 and caspase 3) and BCL-XL in the p53 signaling pathway. This implied that salinity stress and bacterial challenge might stimulate different immune pathways, which were mediated by CASP8-like and CASP8 genes in C. hongkongensis, respectively
The expression profile showed that ChCASP8-like had constitutive expression in several tissues, with high expression levels in the gonads, gill, hepatopancreas and mantle. The expression levels were significantly upregulated in all immune tissue by hyper-salinity stress, especially in gills, hepatopancreas and hemocytes. Similarly, caspase 8 from C. virginica was widely expressed in various tissues and developmental stages [4]. High levels of CASP8 transcripts were also found in gills, hemocytes and digestive glands of mussels in response to high-temperature stress in Mytilus coruscus and Mytilus galloprovincialis [30], These data further indicated the hyper-salinity stress stimulated the immune response by activating of ChCASP8-like in C. hongkongensis.
Caspase 8, situated at the apex of the apoptotic cascade, is crucial for activating downstream executioner caspases by cleaving them and leading to cell death [33,34]. Therefore, the caspase 8 activity was examined after ChCASP8-like silencing and hyper-salinity stress in this study. The increased caspase 8 activity after hyper-salinity stress suggested that apoptosis had been activated. Apoptosis was mainly divided into two pathways, the intrinsic pathway and extrinsic pathway. The promoter that regulated the intrinsic pathway of apoptosis was caspase 9, which could bind to the adapter protein apoptosis protease activator 1 (APAF1) upon exposure of the caspase recruitment domain (CARD domain). When apoptosis was induced by positive or negative stimuli, the mitochondrial membrane was altered, allowing apoptotic proteins (such as cytochrome c, Smac/Diablo, and HtrA2/Omi) to move from the mitochondria and activate apoptosis [35]. The extrinsic pathway was mediated by the extracellular death ligands of the TNF family (TNFα, tumor necrosis factor α; FasL, the ligand for Fas and the TNF-associated apoptosis-inducing ligands) and was triggered by the recruitment of FADD and caspase 8 to the death receptor [36,37]. Caspase 8 was activated and cleaved its substrates caspase 3 and caspase 7, ultimately leading to apoptosis. In our study, the decreased caspase 8 activity after RNA interference confirmed the key role of ChCASP8 in apoptosis. Caspase 3 was the key executor of apoptosis and was required to cleave the substrate of the apoptotic pathway during the final step [38]. However, there was no significant difference in caspase 3 activity in this research. The functions of caspase 3 and caspase 7 were reported to overlap in the regulation of apoptosis. A plausible explanation was that the increase in caspase 8 activity may also activate caspase 7 activity, not only caspase 3. This hypothesis needs to be further investigated.
Terminal deoxynucleotidyl transferase (TdT) dUTP Nick-End Labeling (TUNEL) assay is designed to detect apoptotic cells that undergo extensive DNA degradation in early and late stages of apoptosis [22]. The TUNEL assay is based on the ability of TdT to label blunt ends of double-stranded DNA breaks independent of a template, and has been widely used as a measure of apoptotic cell death [39]. In this study, the number of TUNEL-positive hemocytes were significantly increased after hyper-salinity stress, while significantly decreased after silencing caspase8-like. These data confirmed that the hemocytes suffered severe DNA damage from salt stress, and caspase 8 played an important role in inducing apoptosis.

5. Conclusions

In conclusion, a novel CASP8-like gene was characterized from C. hongkongensis. The tissue expression profile showed that ChCASP8-like had constitutive expression in all tissues, and was significantly upregulated in hemocytes, hepatopancreas and gills by hyper-salinity stress. Apoptosis-related gene transcripts and caspase 8 activity were significantly increased after hyper-salinity stress, and significantly decreased after ChCASP8-like interference. Moreover, exposure to hyper-salinity stress caused severe apoptosis, which could be alleviated by ChCASP8-like silence. The results indicated that ChCASP8-like played a crucial role in activating apoptosis against hyper-salinity stress in oysters.

Author Contributions

J.L. performed experiments and wrote the manuscript. Z.Y. performed experiments. Y.L. (Yang Leng) analyzed the data and provided the experimental animals. J.Z. analyzed the data and verified the data. F.Y. designed the experiments and revised the manuscript. Y.L. (Yishan Lu) revised the manuscript. J.C. analyzed the data and proved the data. W.H. analyzed the data and verified the data. Y.Z. contributed to the graphing. Y.W. performed the experiments. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Natural Science Foundation of Guangdong Province (2021A1515011052), Science and Technology Development Project of Zhanjiang (2022A01047), Undergraduate Innovation Team Project of Guangdong Ocean University (CXTD2023005), Shenzhen Science and Technology Program (KCXFZ20211020165547010), the Projects of Innovation Team of Colleges and Universities in Guangdong Province (2022KCXTD013).

Institutional Review Board Statement

Our research was exempt from ethical evaluation because the Animal Ethics Committee’s scope of approval is limited to studies involving vertebrates in China (Laboratory Animal Act, Chapter 5 Article 25).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data involved in this study have been deposited in the NCBI Bioproject under the accession number OR066208. The data that support the study findings are available upon request.

Acknowledgments

The authors would like to thank all the researchers and participants for their valuable contributions to this article. All individuals included in this section have consented to the acknowledge.

Conflicts of Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

References

  1. Holley, M.C. Application of new biological approaches to stimulate sensory repair and protection. Br. Med. Bull. 2002, 63, 157–169. [Google Scholar] [CrossRef]
  2. Raff, M.C. Social controls on cell survival and cell death. Nature 1992, 356, 397–400. [Google Scholar] [CrossRef] [PubMed]
  3. Jones, B.A.; Gores, G.J. Physiology and pathophysiology of apoptosis in epithelial cells of the liver, pancreas, and intestine. Am. J. Physiol. 1997, 273, G1174–G1188. [Google Scholar] [CrossRef] [PubMed]
  4. Li, C.; Qu, T.; Huang, B.; Ji, P.; Huang, W.; Que, H.; Li, L.; Zhang, G. Cloning and characterization of a novel caspase-8-like gene in Crassostrea gigas. Fish Shellfish. Immunol. 2015, 46, 486–492. [Google Scholar] [CrossRef] [PubMed]
  5. Green, D.R.; Llambi, F. Cell Death Signaling. Cold Spring Harb. Perspect. Biol. 2015, 7, a006080. [Google Scholar] [CrossRef] [PubMed]
  6. Sakamaki, K.; Shimizu, K.; Iwata, H.; Imai, K.; Satou, Y.; Funayama, N.; Nozaki, M.; Yajima, M.; Nishimura, O.; Higuchi, M.; et al. The apoptotic initiator caspase-8: Its functional ubiquity and genetic diversity during animal evolution. Mol. Biol. Evol. 2014, 31, 3282–3301. [Google Scholar] [CrossRef]
  7. Takagi, T.; Takayasu, M.; Mizuno, M.; Yoshimoto, M.; Yoshida, J. Caspase activation in neuronal and glial apoptosis following spinal cord injury in mice. Neurol. Med. Chir. 2003, 43, 20–29, Discussion 29–30. [Google Scholar] [CrossRef] [PubMed]
  8. Xiang, Z.; Qu, F.; Qi, L.; Zhang, Y.; Tong, Y.; Yu, Z. Cloning, characterization and expression analysis of a caspase-8 like gene from the Hong Kong oyster, Crassostrea hongkongensis. Fish Shellfish. Immunol. 2013, 35, 1797–1803. [Google Scholar] [CrossRef]
  9. Sun, C.; Wei, D.; Pan, Y.; Xiao, X.; Wang, F. BmCaspase-8-like regulates autophagy by suppressing BmDREDD-mediated cleavage of BmATG6. Insect Sci. 2023, 30, 365–374. [Google Scholar] [CrossRef]
  10. Xiao, S.; Wong, N.K.; Li, J.; Lin, Y.; Zhang, Y.; Ma, H.; Mo, R.; Zhang, Y.; Yu, Z. Analysis of in situ Transcriptomes Reveals Divergent Adaptive Response to Hyper- and Hypo-Salinity in the Hong Kong Oyster, Crassostrea hongkongensis. Front. Physiol. 2018, 9, 1491. [Google Scholar] [CrossRef]
  11. Abdelrahman, H.; ElHady, M.; Alcivar-Warren, A.; Allen, S.; Al-Tobasei, R.; Bao, L.; Beck, B.; Blackburn, H.; Bosworth, B.; Buchanan, J.; et al. Aquaculture genomics, genetics and breeding in the United States: Current status, challenges, and priorities for future research. BMC Genom. 2017, 18, 191. [Google Scholar] [CrossRef] [PubMed]
  12. Burnett, K.G.; Bain, L.J.; Baldwin, W.S.; Callard, G.V.; Cohen, S.; Di Giulio, R.T.; Evans, D.H.; Gómez-Chiarri, M.; Hahn, M.E.; Hoover, C.A.; et al. Fundulus as the premier teleost model in environmental biology: Opportunities for new insights using genomics. Comp. Biochem. Physiol. Part D Genom. Proteom. 2007, 2, 257–286. [Google Scholar] [CrossRef] [PubMed]
  13. Kültz, D. Physiological mechanisms used by fish to cope with salinity stress. J. Exp. Biol. 2015, 218, 1907–1914. [Google Scholar] [CrossRef]
  14. Cheng, B.S.; Chang, A.L.; Deck, A.; Ferner, M.C. Atmospheric rivers and the mass mortality of wild oysters: Insight into an extreme future? Proc. Biol. Sci. 2016, 283, 20161462. [Google Scholar] [CrossRef]
  15. Lacoste, A.; Malham, S.K.; Gélébart, F.; Cueff, A.; Poulet, S.A. Stress-induced immune changes in the oyster Crassostrea gigas. Dev. Comp. Immunol. 2002, 26, 1–9. [Google Scholar] [CrossRef] [PubMed]
  16. Yu, F.; Pan, Z.; Qu, B.; Yu, X.; Xu, K.; Deng, Y.; Liang, F. Identification of a tyrosinase gene and its functional analysis in melanin synthesis of Pteria penguin. Gene 2018, 656, 1–8. [Google Scholar] [CrossRef]
  17. Gao, Y.; Xie, Z.; Qian, J.; Tu, Z.; Yang, C.; Deng, Y.; Xue, Y.; Shang, Y.; Hu, M.; Wang, Y. Effects of diel-cycling hypoxia and salinity on lipid metabolism and fatty acid composition of the oyster Crassostrea hongkongensis. Mar. Environ. Res. 2023, 191, 106124. [Google Scholar] [CrossRef]
  18. Meng, J.; Zhu, Q.; Zhang, L.; Li, C.; Li, L.; She, Z.; Huang, B.; Zhang, G. Genome and transcriptome analyses provide insight into the euryhaline adaptation mechanism of Crassostrea gigas. PLoS ONE 2013, 8, e58563. [Google Scholar] [CrossRef]
  19. Moreira, A.; Figueira, E.; Soares, A.; Freitas, R. Salinity influences the biochemical response of Crassostrea angulata to Arsenic. Environ. Pollut. 2016, 214, 756–766. [Google Scholar] [CrossRef]
  20. Chen, J.Y.; Lin, J.J.; Yu, F.F.; Zhong, Z.M.; Liang, Q.W.; Pang, H.Y.; Wu, S.Y. Transcriptome analysis reveals the function of TLR4-MyD88 pathway in immune response of Crassostrea hongkongensis against Vibrio Parahemolyticus. Aquacult Rep. 2022, 25, 101253. [Google Scholar] [CrossRef]
  21. Park, C.; Lee, H.; Han, M.H.; Jeong, J.W.; Kim, S.O.; Jeong, S.J.; Lee, B.J.; Kim, G.Y.; Park, E.K.; Jeon, Y.J.; et al. Cytoprotective effects of fermented oyster extracts against oxidative stress-induced DNA damage and apoptosis through activation of the Nrf2/HO-1 signaling pathway in MC3T3-E1 osteoblasts. Excli J. 2020, 19, 1102–1119. [Google Scholar] [CrossRef] [PubMed]
  22. Kyrylkova, K.; Kyryachenko, S.; Leid, M.; Kioussi, C. Detection of apoptosis by TUNEL assay. Methods Mol. Biol. 2012, 887, 41–47. [Google Scholar] [CrossRef] [PubMed]
  23. Cimprich, K.A.; Cortez, D. ATR: An essential regulator of genome integrity. Nat. Rev. Mol. Cell Biol. 2008, 9, 616–627. [Google Scholar] [CrossRef] [PubMed]
  24. Flynn, R.L.; Zou, L. ATR: A master conductor of cellular responses to DNA replication stress. Trends Biochem. Sci. 2011, 36, 133–140. [Google Scholar] [CrossRef]
  25. Nam, E.A.; Cortez, D. ATR signalling: More than meeting at the fork. Biochem. J. 2011, 436, 527–536. [Google Scholar] [CrossRef]
  26. Tummers, B.; Mari, L.; Guy, C.S.; Heckmann, B.L.; Rodriguez, D.A.; Rühl, S.; Moretti, J.; Crawford, J.C.; Fitzgerald, P.; Kanneganti, T.D.; et al. Caspase-8-Dependent Inflammatory Responses Are Controlled by Its Adaptor, FADD, and Necroptosis. Immunity 2020, 52, 994–1006.e8. [Google Scholar] [CrossRef] [PubMed]
  27. Brentnall, M.; Rodriguez-Menocal, L.; De Guevara, R.L.; Cepero, E.; Boise, L.H. Caspase-9, caspase-3 and caspase-7 have distinct roles during intrinsic apoptosis. BMC Cell Biol. 2013, 14, 32. [Google Scholar] [CrossRef]
  28. Zhang, Z.; Li, A.; She, Z.; Wang, X.; Jia, Z.; Wang, W.; Zhang, G.; Li, L. Adaptive divergence and underlying mechanisms in response to salinity gradients between two Crassostrea oysters revealed by phenotypic and transcriptomic analyses. Evol. Appl. 2023, 16, 234–249. [Google Scholar] [CrossRef] [PubMed]
  29. Huang, W.B.; Ren, H.L.; Gopalakrishnan, S.; Xu, D.-D.; Qiao, K.; Wang, K.-J. First molecular cloning of a molluscan caspase from variously colored abalone (Haliotis diversicolor) and gene expression analysis with bacterial challenge. Fish Shellfish. Immunol. 2010, 28, 587–595. [Google Scholar] [CrossRef]
  30. Zhang, D.; Wang, H.W.; Yao, C.L. Molecular and acute temperature stress response characterizations of caspase-8 gene in two mussels, Mytilus coruscus and Mytilus galloprovincialis. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2014, 177–178, 10–20. [Google Scholar] [CrossRef]
  31. Fan, T.J.; Han, L.H.; Cong, R.S.; Liang, J. Caspase family proteases and apoptosis. Acta Biochim. Biophys. Sin. 2005, 37, 719–727. [Google Scholar] [CrossRef] [PubMed]
  32. Tibbetts, M.D.; Zheng, L.; Lenardo, M.J. The death effector domain protein family: Regulators of cellular homeostasis. Nat. Immunol. 2003, 4, 404–409. [Google Scholar] [CrossRef]
  33. Scatena, R.; Bottoni, P.; Botta, G.; Martorana, G.E.; Giardina, B. The role of mitochondria in pharmacotoxicology: A reevaluation of an old, newly emerging topic. Am. J. Physiol. Cell Physiol. 2007, 293, C12–C21. [Google Scholar] [CrossRef]
  34. Häcker, G.; Paschen, S.A. Therapeutic targets in the mitochondrial apoptotic pathway. Expert Opin. Ther. Targets 2007, 11, 515–526. [Google Scholar] [CrossRef]
  35. Cain, K.; Bratton, S.B.; Cohen, G.M. The Apaf-1 apoptosome: A large caspase-activating complex. Biochimie 2002, 84, 203–214. [Google Scholar] [CrossRef] [PubMed]
  36. Peter, M.E.; Krammer, P.H. The CD95(APO-1/Fas) DISC and beyond. Cell Death Differ. 2003, 10, 26–35. [Google Scholar] [CrossRef]
  37. Strasser, A.; O’Connor, L.; Dixit, V.M. Apoptosis signaling. Annu. Rev. Biochem. 2000, 69, 217–245. [Google Scholar] [CrossRef] [PubMed]
  38. Wei, L.; He, L.; Fu, J.; Liu, Y.; Ruan, J.; Liu, L.; Zhong, Q. Molecular characterization of caspase-8-like and its expression induced by microcystin-LR in grass carp (Ctenopharygodon idella). Fish Shellfish. Immunol. 2019, 89, 727–735. [Google Scholar] [CrossRef]
  39. Mirzayans, R.; Murray, D. Do TUNEL and Other Apoptosis Assays Detect Cell Death in Preclinical Studies? Int. J. Mol. Sci. 2020, 21, 9090. [Google Scholar] [CrossRef]
Fishes 09 00172 g001
Figure 1. (A) Nucleotide and deduced amino acid sequences of ChCASP8-like. 5′UTR and 3′UTR sequences are shown in lowercase letters, and ORF sequences are shown in uppercase letters. The start codon (ATG) and the stop codon (TAA) are marked with boxes. The conserved CASc domain is underlined, and DEDs are shown with a wavy line. The putative polyadenylation signal (aataaa) is marked in bold. “✳” represents the termination codon. (B) The conserved DEDs and CASc domain of ChCASP8-like were predicted byConserved Domain Database (CDD).
Figure 1. (A) Nucleotide and deduced amino acid sequences of ChCASP8-like. 5′UTR and 3′UTR sequences are shown in lowercase letters, and ORF sequences are shown in uppercase letters. The start codon (ATG) and the stop codon (TAA) are marked with boxes. The conserved CASc domain is underlined, and DEDs are shown with a wavy line. The putative polyadenylation signal (aataaa) is marked in bold. “✳” represents the termination codon. (B) The conserved DEDs and CASc domain of ChCASP8-like were predicted byConserved Domain Database (CDD).
Fishes 09 00172 g001
Fishes 09 00172 g002
Figure 2. Amino acid sequence comparison and phylogenetic analysis. (A) Multiple sequence comparison of caspase 8-like and caspase 8 genes from different species, including Crassostrea hongkongnsis (CASP8-like, OR066208), Crassostrea hongkongnsis (CASP8, AHB50667.1), Crassostrea angulata (CASP8-like, XP_052712040.1), Crassostrea virginica (CASP8-like, XP_022294614.1), Danio rerio (casp8, NP_571585.2), Gallus gallus (Casp8, NP_989923.3), Homo sapiens (CASP8, AAD24962.1), Mauremys reevesii (CASP8, XP_039350847.1), Ostrea edulis (CASP8-like, XP_048769780.1), Xenopus laevis (CASP8, NP_001079034.1) and Bactrocera dorsalis (CASP8, JAC47606.1). Identical residues were shown in black, highly conserved residues in red, and conserved residues in blue. The CASc and DED structural domains are shown in black and red boxes, respectively. (B) Phylogenetic tree analysis. The number on the node indicates the bootstrap value determined by bootstrap analysis for 1000 repetitions. ● represents the caspase 8-like gene of C. hongkongnsis in this research.
Figure 2. Amino acid sequence comparison and phylogenetic analysis. (A) Multiple sequence comparison of caspase 8-like and caspase 8 genes from different species, including Crassostrea hongkongnsis (CASP8-like, OR066208), Crassostrea hongkongnsis (CASP8, AHB50667.1), Crassostrea angulata (CASP8-like, XP_052712040.1), Crassostrea virginica (CASP8-like, XP_022294614.1), Danio rerio (casp8, NP_571585.2), Gallus gallus (Casp8, NP_989923.3), Homo sapiens (CASP8, AAD24962.1), Mauremys reevesii (CASP8, XP_039350847.1), Ostrea edulis (CASP8-like, XP_048769780.1), Xenopus laevis (CASP8, NP_001079034.1) and Bactrocera dorsalis (CASP8, JAC47606.1). Identical residues were shown in black, highly conserved residues in red, and conserved residues in blue. The CASc and DED structural domains are shown in black and red boxes, respectively. (B) Phylogenetic tree analysis. The number on the node indicates the bootstrap value determined by bootstrap analysis for 1000 repetitions. ● represents the caspase 8-like gene of C. hongkongnsis in this research.
Fishes 09 00172 g002
Fishes 09 00172 g003
Figure 3. The relative expression of ChCASP8-like in different tissues before and after hyper-salinity stress. Different lowercase letters (abc) indicate significant differences among tissues before hyper-salinity stress (p < 0.05). Different capital letters (ABC) indicate significant differences among tissues after hyper-salinity stress (p < 0.05). Expression differences in the same tissue before and after hyper-salinity stress are indicated using * (p < 0.05) or ** (p < 0.01) (N = 5).
Figure 3. The relative expression of ChCASP8-like in different tissues before and after hyper-salinity stress. Different lowercase letters (abc) indicate significant differences among tissues before hyper-salinity stress (p < 0.05). Different capital letters (ABC) indicate significant differences among tissues after hyper-salinity stress (p < 0.05). Expression differences in the same tissue before and after hyper-salinity stress are indicated using * (p < 0.05) or ** (p < 0.01) (N = 5).
Fishes 09 00172 g003
Fishes 09 00172 g004
Figure 4. Transcriptional levels of ATR, CASP8-like, BCL-XL, CASP9 and CASP3 in C. hongkongnsis after ChCASP8-like interference and hyper-salinity stress in gill tissue. NC means the negative control group. β-actin was used as an internal reference. Data are presented as mean ± standard deviation (N = 5). * means p < 0.05 and ** means p < 0.01.
Figure 4. Transcriptional levels of ATR, CASP8-like, BCL-XL, CASP9 and CASP3 in C. hongkongnsis after ChCASP8-like interference and hyper-salinity stress in gill tissue. NC means the negative control group. β-actin was used as an internal reference. Data are presented as mean ± standard deviation (N = 5). * means p < 0.05 and ** means p < 0.01.
Fishes 09 00172 g004
Fishes 09 00172 g005
Figure 5. Caspase 8 and caspase 3 activity were analyzed after hyper-salinity stress and ChCASP8-like silencing in gills. (A) Caspase 8 analysis. (B) Caspase 3 analysis. Data are presented as mean ± standard deviation (N = 5). * means p < 0. 05 and ** means p < 0.01.
Figure 5. Caspase 8 and caspase 3 activity were analyzed after hyper-salinity stress and ChCASP8-like silencing in gills. (A) Caspase 8 analysis. (B) Caspase 3 analysis. Data are presented as mean ± standard deviation (N = 5). * means p < 0. 05 and ** means p < 0.01.
Fishes 09 00172 g005
Fishes 09 00172 g006
Figure 6. Fluorescence micrographs of apoptotic hemocytes with and without ChCASP8-like silencing under hyper-salinity stress. Green fluorescence indicated TUNEL-positive apoptotic nuclei and blue fluorescence indicated total nuclei.
Figure 6. Fluorescence micrographs of apoptotic hemocytes with and without ChCASP8-like silencing under hyper-salinity stress. Green fluorescence indicated TUNEL-positive apoptotic nuclei and blue fluorescence indicated total nuclei.
Fishes 09 00172 g006
Table 1. Primers used in the study.
Table 1. Primers used in the study.
PrimerForward Primer/Reverse Primer (5′–3′)ApplicationProduct (bp)
ChCASP8-outer-FCCAGTGGTCCTATGGCGGAAGTGATG3′RACE667
ChCASP8-inner-FTGACAATGGGTCTTTCTTCGTTCAATCCnest-3′RACE543
ChCASP8-outer-RCAGCAACGGAAACAGT5′RACE606
ChCASP8-inner-RGTCCAGACAGTCCCACACGnest-5′RACE561
UPMTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGTRACE
NUPAAGCAGTGGTATCAACGCAGAGTRACE universal primer
ChCASP8-test-FTCGTGTGGGACTGTCTGGAcDNA test1689
ChCASP8-test-RTGCCTAGACCTCGCTTTCAAcDNA test
ChCASP8-siRNA-FGCGTAATACGACTCACTATAGGGGATTCTGCGTCATCTTCARNA interference469
ChCASP8-siRNA-RGCGTAATACGACTCACTATAGGGACTTCCGTCATCACTTCCRNA interference
GFP-siRNA-FGATCACTAATACGACTCACTATAGGGATGGTGAGCAAGGGCGAGGA RNA interference717
GFP-siRNA-RGATCACTAATACGACTCACTATAGGGTTACTTGTACAGCTCGTCCA RNA interference
β-actin-FGTGCTACGTTGCCCTGGACTT qRT-PCR110
β-actin-RTCGCTCGTTGCCAATGGTGAT qRT-PCR
ChCASP8-F AACTGTTTCCGTTGCTGAqRT-PCR89
ChCASP8-RTACTCGCCGACTTCTTGTqRT-PCR
ChCASP3-FAGGCTGGCTGATTATGGGqRT-PCR120
ChCASP3-RTCGTTTGTGACGGTTTGCqRT-PCR
ChATR-FCCTTCCCAACAGACCCAAqRT-PCR130
ChATR-RTCGCTGCCGTTCATCGTGqRT-PCR
CASP9-FCGAGGTGGAAAGGAGAACqRT-PCR146
CASP9-RCTGGGTCAGACTGGAAAGAqRT-PCR
ChCHK1-FCACACGAAAGGAGTTACCCACAGAGqRT-PCR105
ChCHK1-RTCGAAACACAGTAGCCAGTCCAAAGqRT-PCR
ChBCL-XL-FACTCGTGGACTCTATCGTGGACTGqRT-PCR99
ChBCL-XL-RGCAATTCTAAGCGACTCCCATCCCqRT-PCR
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Lin, J.; Yu, Z.; Leng, Y.; Zhu, J.; Yu, F.; Lu, Y.; Chen, J.; He, W.; Zhang, Y.; Wen, Y. Cloning, Characterization and Functional Analysis of Caspase 8-like Gene in Apoptosis of Crassostrea hongkongensis Response to Hyper-Salinity Stress. Fishes 2024, 9, 172. https://doi.org/10.3390/fishes9050172

AMA Style

Lin J, Yu Z, Leng Y, Zhu J, Yu F, Lu Y, Chen J, He W, Zhang Y, Wen Y. Cloning, Characterization and Functional Analysis of Caspase 8-like Gene in Apoptosis of Crassostrea hongkongensis Response to Hyper-Salinity Stress. Fishes. 2024; 9(5):172. https://doi.org/10.3390/fishes9050172

Chicago/Turabian Style

Lin, Jinji, Ziqi Yu, Yang Leng, Jiexiong Zhu, Feifei Yu, Yishan Lu, Jiayu Chen, Wenhao He, Yixin Zhang, and Yaoshen Wen. 2024. "Cloning, Characterization and Functional Analysis of Caspase 8-like Gene in Apoptosis of Crassostrea hongkongensis Response to Hyper-Salinity Stress" Fishes 9, no. 5: 172. https://doi.org/10.3390/fishes9050172

APA Style

Lin, J., Yu, Z., Leng, Y., Zhu, J., Yu, F., Lu, Y., Chen, J., He, W., Zhang, Y., & Wen, Y. (2024). Cloning, Characterization and Functional Analysis of Caspase 8-like Gene in Apoptosis of Crassostrea hongkongensis Response to Hyper-Salinity Stress. Fishes, 9(5), 172. https://doi.org/10.3390/fishes9050172

Article Metrics

Back to TopTop