Integrated SRNA-Seq and RNA-Seq Analysis Reveals the Regulatory Roles of miRNAs in the Low-Temperature Responses of Canarium album
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Methods
2.2.1. RNA Extraction and Quality Determination
2.2.2. Library Construction and Sequencing
2.2.3. Small RNA Data Analysis
2.2.4. Transcriptome Data Analysis
2.2.5. qRT-PCR Verification of DEMs and DEGs
3. Results
3.1. Phenotypic Changes of Cold-Tolerant and Susceptible C. album cultivars under LTS
3.2. Small RNA Sequencing Analysis
3.2.1. Overview of SRNA-Seq Data and Identification of Conserved miRNAs in C. album
3.2.2. Differential Expression Analysis of miRNAs
3.3. Comparative Transcriptome Analysis Results
3.3.1. RNA-Seq and De Novo Assembly of Transcriptome
3.3.2. DEGs Identification and Enrichment Analysis Results
3.4. Integrated Analysis of Differnetially Expresssed MiRNAs and MRNAs
3.4.1. KEGG Enrichment Analysis of DEM Target Genes
3.4.2. Expression Analysis of DEMs and Their Corresponding Target Genes
4. Discussion
4.1. Some miRNAs Contribute to the Cold-Tolerance of C. album
4.2. The Low Temperature Responses of C. ablum Involved Multiple Metabolic Pathways
4.3. The Interactions of Some MiRNAs and Their Target mRNAs Might Contributed Greatly to the Cold Resistance Response of C. album
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Conflicts of Interest
References
- Theocharis, A.; Clément, C.; Barka, E.A. Physiological and molecular changes in plants grown at low temperatures. Planta 2012, 235, 1091–1105. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huo, C.; Zhang, B.; Wang, R. Research progress on plant noncoding RNAs in response to low-temperature stress. Plant Signal Behav. 2022, 17, 2004035. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, J.; Su, D.; Yang, D.; Dong, T.; Tang, Z.; Li, H.; Han, Y.; Li, Z.; Zhang, B. Chilling and heat stress-induced physiological changes and microRNA-related mechanism in sweetpotato (Ipomoea batatas L.). Front. Plant Sci. 2020, 11, 687. [Google Scholar] [CrossRef] [Scilit]
- Xie, Z.; Wang, A.; Li, H.; Yu, J.; Jiang, J.; Tang, Z.; Ma, D.; Zhang, B.; Han, Y.; Li, Z. High throughput deep sequencing reveals the important roles of microRNAs during sweetpotato storage at chilling temperature. Sci. Rep. 2017, 7, 16578. [Google Scholar] [CrossRef] [Scilit]
- Aydinoglu, F. Elucidating the regulatory roles of microRNAs in maize (Zea mays L.) leaf growth response to chilling stress. Planta 2020, 251, 38. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.; Wang, Y.; Gao, X.; Liu, C.; Gai, S. Identification and characterization of microRNAs in tree peony during chilling induced dormancy release by high-throughput sequencing. Sci. Rep. 2018, 8, 4537. [Google Scholar] [CrossRef] [Scilit]
- Yang, X.; Liu, F.; Zhang, Y.; Wang, L.; Cheng, Y.F. Cold-responsive miRNAs and their target genes in the wild eggplant species Solanum aculeatissimum. BMC Genom. 2017, 18, 1000. [Google Scholar] [CrossRef] [Scilit]
- Gupta, O.P.; Meena, N.L.; Sharma, I.; Sharma, P. Differential regulation of microRNAs in response to osmotic, salt and cold stresses in wheat. Mol. Biol. Rep. 2014, 41, 4623–4629. [Google Scholar] [CrossRef] [Scilit]
- Omidvar, V.; Mohorianu, I.; Dalmay, T.; Fellner, M. MicroRNA regulation of abiotic stress response in 7B-1 male-sterile tomato mutant. Plant Genome 2015, 8, eplantgenome2015.02.0008. [Google Scholar] [CrossRef] [Scilit]
- Yang, L.P.; Gu, X.L.; Chen, J.X.; Yang, J.; Tan, S.Y.; Duan, W.J. Chemical constituents from Canarium album Raeusch and their anti-influenza A virus activities. J. Nat. Med. 2018, 72, 808–815. [Google Scholar] [CrossRef] [Scilit]
- Kuo, Y.H.; Yeh, Y.T.; Pan, S.Y.; Hsieh, S.C. Identification and structural elucidation of anti-inflammatory compounds from Chinese olive (Canarium album L.) fruit extracts. Foods 2019, 8, 441. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, L.L.; Lin, Y.M. Tannins from Canarium album with potent antioxidant activity. J. Zhejiang Univ. Sci. B 2008, 9, 407–415. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lai, R.; Feng, X.; Chen, J.; Zhang, Y.; Wei, X.; Chen, Y.; Cheng, C.; Wu, R. De novo transcriptome assembly and comparative transcriptomic analysis provide molecular insights into low temperature stress response of Canarium album. Sci. Rep. 2021, 11, 10561. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Grabherr, M.G.; Haas, B.J.; Yassour, M.; Levin, J.Z.; Thompson, D.A.; Amit, I.; Adiconis, X.; Fan, L.; Raychowdhury, R.; Zeng, Q.; et al. Trinity: Reconstructing a full-length transcriptome without a genome from RNA-Seq data. Nat. Biotechnol. 2013, 29, 644–652. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Young, M.D.; Wakefield, M.J.; Smyth, G.K.; Oshlack, A. Gene ontology analysis for RNA-seq: Accounting for selection bias. Genome Biol. 2010, 11, R14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mao, X.; Tao, C.; Olyarchuk, J.G.; Wei, L. Automated genome annotation and pathway identification using the KEGG Orthology (KO) as a controlled vocabulary. Bioinformatics 2005, 21, 3787–3793. [Google Scholar] [CrossRef] [Scilit]
- Cheng, C.; Liu, F.; Sun, X.; Wang, B.; Liu, J.; Ni, X.; Hu, C.; Deng, G.; Tong, Z.; Zhang, Y.; et al. Genome-wide identification of FAD gene family and their contributions to the temperature stresses and mutualistic and parasitic fungi colonization responses in banana. Int. J. Biol. Macromol. 2022, 204, 661–676. [Google Scholar] [CrossRef] [Scilit]
- Hussain, H.A.; Hussain, S.; Khaliq, A.; Ashraf, U.; Anjum, S.A.; Men, S.; Wang, L. Chilling and drought stresses in crop plants: Implications, cross talk, and potential management opportunities. Front. Plant Sci. 2018, 9, 393. [Google Scholar] [CrossRef] [Scilit]
- Kang, Y.; Yang, X.; Liu, Y.; Shi, M.; Zhang, W.; Fan, Y.; Yao, Y.; Zhang, J.; Qin, S. Integration of mRNA and miRNA analysis reveals the molecular mechanism of potato (Solanum tuberosum L.) response to alkali stress. Int. J. Biol. Macromol. 2021, 182, 938–949. [Google Scholar] [CrossRef] [Scilit]
- Fu, Y.; Mason, A.S.; Zhang, Y.; Lin, B.; Xiao, M.; Fu, D.; Yu, H. MicroRNA-mRNA expression profiles and their potential role in cadmium stress response in Brassica napus. BMC Plant Biol. 2019, 19, 570. [Google Scholar] [CrossRef] [Scilit]
- Zeng, X.; Xu, Y.; Jiang, J.; Zhang, F.; Ma, L.; Wu, D.; Wang, Y.; Sun, W. Identification of cold stress responsive microRNAs in two winter turnip rape (Brassica rapa L.) by high throughput sequencing. BMC Plant Biol. 2018, 18, 52. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lv, D.K.; Xi, B.; Yong, L.; Ding, X.D.; Ge, Y.; Cai, H.; Ji, W.; Wu, N.; Zhu, Y.M. Profiling of cold-stress-responsive miRNAs in rice by microarrays. Gene 2010, 459, 39–47. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thiebaut, F.; Rojas, C.A.; Almeida, K.L.; Grativol, C.; Domiciano, G.C.; Lamb, C.R.C.; de Almeida Engler, J.; Hemerly, A.S.; Ferreira, P.C. Regulation of miR319 during cold stress in sugarcane. Plant Cell Environ. 2012, 35, 502–512. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ni, Z.; Hu, Z.; Jiang, Q.; Zhang, H. Overexpression of gma-MIR394a confers tolerance to drought in transgenic Arabidopsis thaliana. Biochem. Biophys. Res. Commun. 2012, 427, 330–335. [Google Scholar] [CrossRef] [Scilit]
- Li, A.L.; Wen, Z.; Yang, K.; Wen, X.P. Conserved miR396b-GRF regulation is involved in abiotic stress responses in pitaya (Hylocereus polyrhizus). Int. J. Mol. Sci. 2019, 20, 2501. [Google Scholar] [CrossRef] [Scilit]
- Chen, L.; Luan, Y.; Zhai, J. Sp-miR396a-5p acts as a stress-responsive genes regulator by conferring tolerance to abiotic stresses and susceptibility to Phytophthora nicotianae infection in transgenic tobacco. Plant Cell Rep. 2015, 34, 2013–2025. [Google Scholar] [CrossRef] [Scilit]
- Chen, H.; Chen, X.; Chen, D.; Li, J.; Zhang, Y.; Wang, A. A comparison of the low temperature transcriptomes of two tomato genotypes that differ in freezing tolerance: Solanum lycopersicum and Solanum habrochaites. BMC Plant Biol. 2015, 15, 132. [Google Scholar] [CrossRef] [Scilit]
- Dong, C.H.; Pei, H. Over-expression of miR397 improves plant tolerance to cold stress in Arabidopsis thaliana. J. Plant Biol. 2014, 57, 209–217. [Google Scholar] [CrossRef] [Scilit]
- Sunkar, R.; Zhu, J.K. Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis. Plant Cell 2004, 16, 2001–2019. [Google Scholar] [CrossRef] [Scilit]
- Lu, Q.; Guo, F.; Xu, Q.; Jing, C. LncRNA improves cold resistance of winter wheat by interacting with miR398. Funct. Plant Biol. 2020, 47, 544–557. [Google Scholar] [CrossRef] [Scilit]
- Tchobo, F.P.; Alitonou, G.A.; Soumanou, M.M.; Barea, B.; Bayrasy, C.; Laguerre, M.; Lecomte, J.; Villeneuve, P.; Souhounhloue, K.D. Chemical composition and ability of essential oils from six aromatic plants to counteract lipid oxidation in emulsions. J. Am. Oil Chem. Soc. 2014, 91, 471–479. [Google Scholar] [CrossRef] [Scilit]
- Matthews, D.; Jones, H.; Gans, P.; Coates, S.; Smith, L. Toxic secondary metabolite production in genetically modified potatoes in response to stress. J. Agric. Food Chem. 2005, 53, 7766–7776. [Google Scholar] [CrossRef] [Scilit]
- Chen, X.; Ding, Y.; Yang, Y.; Song, C.; Wang, B.; Yang, S.; Guo, Y.; Gong, Z. Protein kinases in plant responses to drought, salt, and cold stress. J. Integr. Plant Biol. 2021, 63, 53–78. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, Y.; Zeng, X.; Wu, J.; Zhang, F.; Li, C.; Jiang, J.; Wang, Y.; Sun, W. iTRAQ-based quantitative proteome revealed metabolic changes in winter turnip rape (Brassica rapa L.) under cold stress. Int. J. Mol. Sci. 2018, 19, 3346. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tian, X.; Xie, J.; Yu, J. Physiological and transcriptomic responses of Lanzhou Lily (Lilium davidii, var. unicolor) to cold stress. PLoS ONE 2020, 15, e0227921. [Google Scholar] [CrossRef] [Scilit]
- Kim, S.I.; Andaya, V.C.; Tai, T.H. Cold sensitivity in rice (Oryza sativa L.) is strongly correlated with a naturally occurring I99V mutation in the multifunctional glutathione transferase isoenzyme GSTZ2. Biochem. J. 2011, 435, 373–380. [Google Scholar] [CrossRef] [Scilit]
- Zhang, R.; Zhu, J.; Cao, H.Z.; An, Y.R.; Huang, J.J.; Chen, X.H.; Mohammed, N.; Afrin, S.; Luo, Z.Y. Molecular cloning and expression analysis of PDR1-like gene in ginseng subjected to salt and cold stresses or hormonal treatment. Plant Physiol. Biochem. 2013, 71, 203–211. [Google Scholar] [CrossRef] [Scilit]
- Bocian, A.; Zwierzykowski, Z.; Rapacz, M.; Koczyk, G.; Kosmala, A. Metabolite profiling during cold acclimation of Lolium perenne genotypes distinct in the level of frost tolerance. J. Appl. Genet. 2015, 56, 439–449. [Google Scholar] [CrossRef] [Scilit]
- Da Silva, E.M.; Silva, G.F.F.E.; Bidoia, D.B.; da Silva Azevedo, M.; de Jesus, F.A.; Pino, L.E.; Peres, L.E.P.; Carrera, E.; López-Díaz, I.; Nogueira, F.T.S. microRNA159-targeted SlGAMYB transcription factors are required for fruit set in tomato. Plant J. 2017, 92, 95–109. [Google Scholar] [CrossRef] [Scilit]
- Shi, M.; Hu, X.; Wei, Y.; Hou, X.; Yuan, X.; Liu, J.; Liu, Y. Genome-wide profiling of small RNAs and degradome revealed conserved regulations of miRNAs on auxin-responsive genes during fruit enlargement in peaches. Int. J. Mol. Sci. 2017, 18, 2599. [Google Scholar] [CrossRef] [Scilit]
- Fang, Y.; Xie, K.; Xiong, L. Conserved miR164-targeted NAC genes negatively regulate drought resistance in rice. J. Exp. Bot. 2014, 65, 2119–2135. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miura, K.; Tada, Y. Regulation of water, salinity, and cold stress responses by salicylic acid. Front. Plant Sci. 2014, 5, 4. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.; Feng, C.; Zhai, Z.; Peng, X.; Wang, Y.; Sun, Y.; Li, J.; Shen, X.; Xiao, Y.; Zhu, S.; et al. The apple microR171i-SCARECROW-LIKE PROTEINS26.1 module enhances drought stress tolerance by integrating ascorbic acid metabolism. Plant Physiol. 2020, 184, 194–211. [Google Scholar] [CrossRef] [Scilit]
- Mnich, E.; Bjarnholt, N.; Eudes, A.; Harholt, J.; Holland, C.; Jørgensen, B.; Larsen, F.H.; Liu, M.; Manat, R.; Meyer, A.S.; et al. Phenolic cross-links: Building and de-constructing the plant cell wall. Nat. Prod. Rep. 2020, 37, 919–961. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, L.; Wang, D.; Liu, S.; Fang, Z.; Su, S.; Guo, C.; Zhao, C.; Tang, Y. Comprehensive atlas of wheat (Triticum aestivum L.) AUXIN RESPONSE FACTOR expression during male reproductive development and abiotic stress. Front. Plant Sci. 2020, 11, 1500. [Google Scholar] [CrossRef] [Scilit]
- Chen, D.; Wang, W.; Wu, Y.; Xie, H.; Zhao, L.; Zeng, Q.; Zhan, Y. Expression and distribution of the auxin response factors in Sorghum bicolor during development and temperature stress. Int. J. Mol. Sci. 2019, 20, 4816. [Google Scholar] [CrossRef] [Scilit]
- Song, J.; Mo, X.; Yang, H.; Yue, L.; Song, J.; Mo, B. The U-box family genes in Medicago truncatula: Key elements in response to salt, cold, and drought stresses. PLoS ONE 2017, 12, e0182402. [Google Scholar] [CrossRef] [Scilit]
- Bi, H.; Dong, X.; Wu, G.; Wang, M.; Ai, X. Decreased TK activity alters growth, yield and tolerance to low temperature and low light intensity in transgenic cucumber plants. Plant Cell Rep. 2015, 34, 345–354. [Google Scholar] [CrossRef] [Scilit]
- De Abreu-Neto, J.B.; Turchetto-Zolet, A.C.; de Oliveira, L.F.V.; Bodanese Zanettini, M.H.; Margis-Pinheiro, M. Heavy metal-associated isoprenylated plant protein (HIPP): Characterization of a family of proteins exclusive to plants. FEBS J. 2013, 280, 1604–1616. [Google Scholar] [CrossRef] [Scilit]
- Lauxmann, M.A.; Borsani, J.; Osorio, S.; Lombardo, V.A.; Budde, C.O.; Bustamante, C.A.; Monti, L.L.; Andreo, C.S.; Fernie, A.R.; Drincovich, M.F.; et al. Deciphering the metabolic pathways influencing heat and cold responses during post-harvest physiology of peach fruit. Plant Cell Environ. 2014, 37, 601–616. [Google Scholar] [CrossRef] [Scilit]
- Rezaie, R.; Mandoulakani, B.A.; Fattahi, M. Cold stress changes antioxidant defense system, phenylpropanoid contents and expression of genes involved in their biosynthesis in Ocimum basilicum L. Sci. Rep. 2020, 10, 5290. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, L.; Coulter, J.A.; Liu, L.; Zhao, Y.; Chang, Y.; Pu, Y.; Zeng, X.; Xu, Y.; Wu, J.; Fang, Y.; et al. Transcriptome analysis reveals key cold-stress-responsive genes in winter rapeseed (Brassica rapa L.). Int. J. Mol. Sci. 2019, 20, 1071. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mo, X.; Deng, D.; Qin, L.; Cai, S.; Mo, W.; Xia, S. Effects of SNC1 gene mutation on cell proliferation and antioxidation character in Arabidopsis thaliana. Crop Res. 2016, 30, 557–562. (In Chinese) [Google Scholar]







| ID | Primer Sequence (5′-3′) | Description | |
|---|---|---|---|
| Forward | Reverse | ||
| TRINITY_DN10933_c0_g1 | TCTTTCTGGATTTGGGACC | TTCTTCACGCCCTTCAGTC | Scarecrow-like protein 6 |
| TRINITY_DN1114_c0_g1 | TGTTTGGGTTCTATCGGAG | AGAGAGGGTTGGTGGTATTG | Heavy metal-associated isoprenylated plant protein 7 |
| TRINITY_DN18405_c0_g1 | CTACACACCATTGCGGACT | GAAGAAACAGGACCATCGG | U-box domain-containing protein |
| TRINITY_DN2165_c0_g2 | TTGCCGCCAGAGACATTAG | TACCAGAAGAAGTCCGAGCC | Scarecrow-like protein 6 |
| TRINITY_DN24638_c0_g1 | CAAGCACCCATCTAACCTCT | ACTGGCTAAACTGCGAAACT | Laccase-17 |
| TRINITY_DN4966_c0_g1 | GCCACGAATCCTCTATCTCC | TAGTGCCTTGTAACGCCTG | Laccase-4 |
| TRINITY_DN4966_c0_g2 | TGGTCAGGGTTTCGGTAA | CAATCCAAGCCATCCTCA | Laccase-2 |
| TRINITY_DN5262_c0_g1 | ATGGAATGACAGAGGCAGG | CAGAGAGGCACCAGTTTCA | 4-coumarate--CoA ligase 1 |
| TRINITY_DN6730_c0_g1 | GGCTCACAACCGCTACTTT | CACATTCCGTCTCCGTTAC | E3 ubiquitin-protein ligase |
| TRINITY_DN23504_c1_g1 | CAACAAGGGATAGATGCGT | ATTCCAAAGACAGACCTGCT | Suppressor of npr1-1, constitutive1 |
| TRINITY_DN76209_c0_g1 | TGCCTTCAAACCACAACC | TGGAACATAAACAAGCGGAC | Auxin response factor 2A |
| miRNA Name | Forward Primer Sequence (5′-3′) | miRNA Name | Forward Primer Sequence (5′-3′) |
|---|---|---|---|
| cal-miR171_2-1 | TTGAGCCGTGCCAATATC | cal-miR1446-1 | TTCTGAACTCTCTCCCTCAAC |
| cal-miR397-3 | TGAGTGCAGCGTTGATGT | cal-miR171_2-6 | AGATATTGGTGCGGTTCAA |
| cal-miR159-39 | TCTTGTAGTGAAGGGAGCTCT | cal-miR482-22 | TTTCCGACACCTCCCATT |
| cal-miR394-1 | GGCATTCTGTCCACCTCC | cal-undef-8 | CGAAACCTGGCTCTGATACC |
| cal-miR397-3 | TGAGTGCAGCGTTGATGTT | cal-undef-161 | TTCCCCAGTGGAGTCGC |
| Pathway ID | Pathway | Up_Number | Down_Number | DEG_Number | Total_Number | p |
|---|---|---|---|---|---|---|
| ko00940 | Phenylpropanoid biosynthesis | 52 | 22 | 74 | 242 | 1.188 × 10−11 |
| ko00906 | Carotenoid biosynthesis | 26 | 4 | 30 | 78 | 5.732 × 10−8 |
| ko04075 | Plant hormone signal transduction | 53 | 51 | 104 | 455 | 1.035 × 10−7 |
| ko00500 | Starch and sucrose metabolism | 59 | 17 | 76 | 333 | 5.521 × 10−6 |
| ko00909 | Sesquiterpenoid and triterpenoid biosynthesis | 18 | 2 | 20 | 51 | 6.452 × 10−6 |
| ko04626 | Plant-pathogen interaction | 38 | 76 | 114 | 571 | 2.705 × 10−5 |
| ko04712 | Circadian rhythm-plant | 33 | 2 | 35 | 126 | 3.005 × 10−5 |
| ko04016 | MAPK signaling pathway-plant | 17 | 38 | 55 | 242 | 1.157 × 10−4 |
| ko00073 | Cutin, suberine and wax biosynthesis | 13 | 1 | 14 | 38 | 3.378 × 10−4 |
| ko00780 | Biotin metabolism | 8 | 5 | 13 | 38 | 1.226 × 10−3 |
| ko00630 | Glyoxylate and dicarboxylate metabolism | 37 | 10 | 47 | 228 | 3.039 × 10−3 |
| ko00942 | Anthocyanin biosynthesis | 3 | 1 | 4 | 6 | 4.357 × 10−3 |
| ko00260 | Glycine, serine and threonine metabolism | 31 | 8 | 39 | 185 | 4.393 × 10−3 |
| ko00941 | Flavonoid biosynthesis | 17 | 0 | 17 | 66 | 7.264 × 10−3 |
| ko00943 | Isoflavonoid biosynthesis | 0 | 3 | 3 | 4 | 9.510 × 10−3 |
| ko00052 | Galactose metabolism | 18 | 11 | 29 | 138 | 0.013 |
| ko00480 | Glutathione metabolism | 15 | 27 | 42 | 217 | 0.015 |
| ko00520 | Amino sugar and nucleotide sugar metabolism | 33 | 26 | 59 | 323 | 0.015 |
| ko00561 | Glycerolipid metabolism | 18 | 15 | 33 | 171 | 0.029 |
| ko00100 | Steroid biosynthesis | 8 | 4 | 12 | 49 | 0.032 |
| ko00514 | Other types of O-glycan biosynthesis | 2 | 2 | 4 | 10 | 0.039 |
| ko00040 | Pentose and glucuronate interconversions | 16 | 6 | 22 | 109 | 0.042 |
| Pathway ID | Pathway | Up_Number | Down_Number | DEG_Number | Total_Number | p |
|---|---|---|---|---|---|---|
| ko04075 | Plant hormone signal transduction | 42 | 47 | 89 | 455 | 1.748 × 10−8 |
| ko00906 | Carotenoid biosynthesis | 24 | 1 | 25 | 78 | 3.358 × 10−7 |
| ko04016 | MAPK signaling pathway plant | 21 | 30 | 51 | 242 | 2.076 × 10−6 |
| ko04712 | Circadian rhythm-plant | 29 | 3 | 32 | 126 | 2.896 × 10−6 |
| ko00500 | Starch and sucrose metabolism | 40 | 24 | 64 | 333 | 3.199 × 10−6 |
| ko00630 | Glyoxylate and dicarboxylate metabolism | 31 | 11 | 42 | 228 | 3.805 × 10−4 |
| ko00260 | Glycine, serine and threonine metabolism | 24 | 11 | 35 | 185 | 6.814 × 10−4 |
| ko00052 | Galactose metabolism | 15 | 13 | 28 | 138 | 7.346 × 10−4 |
| ko00940 | Phenylpropanoid biosynthesis | 20 | 22 | 42 | 242 | 1.320 × 10−3 |
| ko00909 | Sesquiterpenoid and triterpenoid biosynthesis | 12 | 1 | 13 | 51 | 2.425 × 10−3 |
| ko00710 | Carbon fixation in photosynthetic organisms | 30 | 10 | 40 | 237 | 2.847 × 10−3 |
| ko00942 | Anthocyanin biosynthesis | 3 | 0 | 3 | 6 | 0.020 |
| ko00350 | Tyrosine metabolism | 5 | 13 | 18 | 102 | 0.025 |
| ko02010 | ABC transporters | 13 | 7 | 20 | 117 | 0.025 |
| ko00250 | Alanine, aspartate and glutamate metabolism | 6 | 15 | 21 | 125 | 0.027 |
| ko00100 | Steroid biosynthesis | 7 | 3 | 10 | 49 | 0.034 |
| ko00561 | Glycerolipid metabolism | 11 | 15 | 26 | 171 | 0.046 |
| Pathway ID | Pathway | Up_Number | Down_Number | DEG_Number | Total_Number | p |
|---|---|---|---|---|---|---|
| ko04626 | Plant-pathogen interaction | 26 | 41 | 67 | 571 | 2.335 × 10−23 |
| ko00380 | Tryptophan metabolism | 5 | 2 | 7 | 96 | 0.019 |
| ko03410 | Base excision repair | 1 | 5 | 6 | 78 | 0.023 |
| ko00330 | Arginine and proline metabolism | 7 | 2 | 9 | 156 | 0.034 |
| ko00940 | Phenylpropanoid biosynthesis | 5 | 7 | 12 | 242 | 0.043 |
| Pathway ID | Pathway | Up_Number | Down_Number | DEG_Number | Total_Number | p |
|---|---|---|---|---|---|---|
| ko04626 | Plant–pathogen interaction | 33 | 17 | 50 | 571 | 7.270 × 10−14 |
| ko00940 | Phenylpropanoid biosynthesis | 6 | 11 | 17 | 242 | 2.300 × 10−4 |
| ko00909 | Sesquiterpenoid and triterpenoid biosynthesis | 4 | 2 | 6 | 51 | 2.074 × 10−3 |
| ko00270 | Cysteine and methionine metabolism | 7 | 5 | 12 | 247 | 0.030 |
| Pathway ID | Pathway | Level2 | p |
|---|---|---|---|
| ko00240 | Pyrimidine metabolism | Nucleotide metabolism | 0.049 |
| ko00520 | Amino sugar and nucleotide sugar metabolism | Carbohydrate metabolism | 0.051 |
| ko00780 | Biotin metabolism | Metabolism of cofactors and vitamins | 0.094 |
| ko00073 | Cutin, suberin and wax biosynthesis | Lipid metabolism | 0.094 |
| ko00710 | Carbon fixation in photosynthetic organisms | Energy metabolism | 0.126 |
| ko00620 | Pyruvate metabolism | Carbohydrate metabolism | 0.182 |
| ko00906 | Carotenoid biosynthesis | Metabolism of terpenoids and polyketides | 0.184 |
| ko04626 | Plant-pathogen interaction | Environmental adaptation | 0.184 |
| ko00360 | Phenylalanine metabolism | Amino acid metabolism | 0.229 |
| ko00130 | Ubiquinone and other terpenoid-quinone biosynthesis | Metabolism of cofactors and vitamins | 0.235 |
| Pathway ID | Pathway | Level2 | p |
|---|---|---|---|
| ko00640 | Propanoate metabolism | Carbohydrate metabolism | 0.045 |
| ko00630 | Glyoxylate and dicarboxylate metabolism | Carbohydrate metabolism | 0.080 |
| ko00620 | Pyruvate metabolism | Carbohydrate metabolism | 0.104 |
| ko00520 | Amino sugar and nucleotide sugar metabolism | Carbohydrate metabolism | 0.112 |
| ko00010 | Glycolysis/Gluconeogenesis | Carbohydrate metabolism | 0.121 |
| miRNA | Gene ID | Gene Annotation | QLCK vs. QLCT | RACK vs. RACT | ||
|---|---|---|---|---|---|---|
| log2FC of miRNA | log2FC of Gene | log2FC of miRNA | log2FC of Gene | |||
| cal-miR396-17 | TRINITY_DN16498_c0_g1 | Unknown | 1.200 * | −0.898 | 0.139 | −1.557 * |
| cal-miR1446-1 | TRINITY_DN881_c0_g1 | Unknown | −1.051 * | −1.179 * | 1.308 | −0.770 |
| TRINITY_DN1114_c0_g1 | Heavy metal-associated isoprenylated plant protein 7 | −1.051 * | −0.671 | 1.308 | −1.356 * | |
| cal-miR159-39 | TRINITY_DN76209_c0_g1 | Auxin response factor 2A | 0.615 | 2.002 * | 1.992 * | 0.981 |
| cal-miR171_2-1 | TRINITY_DN10933_c0_g1 | Scarecrow-like protein 6 | 1.018 * | 1.771 * | −0.583 | 1.436 * |
| cal-miR171_2-6 | TRINITY_DN2165_c0_g1 | Unknown | 2.825 * | 1.458 * | 0.596 | 1.309 * |
| TRINITY_DN2165_c0_g2 | Scarecrow-like protein 6 | 2.825 * | 1.102 * | 0.596 | 1.081 * | |
| cal-miR394-1 | TRINITY_DN18405_c0_g1 | U-box domain-containing protein | 1.687 * | 2.940 * | −0.308 | 0.869 |
| cal-miR396-17 | TRINITY_DN4681_c0_g1 | Unknown | 1.200 * | 0.605 | 0.139 | 1.156 * |
| TRINITY_DN1128_c2_g1 | Transketolase-2 | 1.226 * | 1.154 * | 0.139 | 1.137 * | |
| cal-miR396-23 | TRINITY_DN1989_c0_g1 | Unknown | 0.032 | −3.022 * | 2.322 * | −1.548 * |
| cal-miR397-3 | TRINITY_DN4966_c0_g1 | Laccase-4 | 4.368 * | 5.340 * | −0.581 | 2.559 |
| TRINITY_DN24638_c0_g1 | Laccase-17 | 4.368 * | Inf * | −0.581 | 1.590 | |
| TRINITY_DN4966_c0_g2 | Laccase-2 | 4.368 * | 7.229 * | −0.581 | 3.786 * | |
| cal-miR398_2-3 | TRINITY_DN38515_c0_g1 | Unknown | −1.057 * | Inf * | 0.502 | Inf * |
| cal-miR482-22 | TRINITY_DN23504_c1_g1 | Suppressor of npr1-1, constitutive 1 | −0.507 | −0.700 | 1.668 * | −3.987 * |
| cal-undef-161 | TRINITY_DN5262_c0_g1 | 4-coumarate--CoA ligase 1 | −1.952 * | 1.636 * | −0.652 | 1.250 |
| cal-undef-8 | TRINITY_DN5031_c0_g1 | Unknown | −1.471 | −3.372 * | −0.559 | −3.458 * |
| TRINITY_DN6730_c0_g1 | E3 ubiquitin-protein ligase | −1.471 * | 1.160 * | −0.559 | 0.571 | |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lai, R.; Guan, Q.; Shen, C.; Feng, X.; Zhang, Y.; Chen, Y.; Cheng, C.; Wu, R. Integrated SRNA-Seq and RNA-Seq Analysis Reveals the Regulatory Roles of miRNAs in the Low-Temperature Responses of Canarium album. Horticulturae 2022, 8, 667. https://doi.org/10.3390/horticulturae8070667
Lai R, Guan Q, Shen C, Feng X, Zhang Y, Chen Y, Cheng C, Wu R. Integrated SRNA-Seq and RNA-Seq Analysis Reveals the Regulatory Roles of miRNAs in the Low-Temperature Responses of Canarium album. Horticulturae. 2022; 8(7):667. https://doi.org/10.3390/horticulturae8070667
Chicago/Turabian StyleLai, Ruilian, Qingxu Guan, Chaogui Shen, Xin Feng, Yongyan Zhang, Yiting Chen, Chunzhen Cheng, and Rujian Wu. 2022. "Integrated SRNA-Seq and RNA-Seq Analysis Reveals the Regulatory Roles of miRNAs in the Low-Temperature Responses of Canarium album" Horticulturae 8, no. 7: 667. https://doi.org/10.3390/horticulturae8070667
APA StyleLai, R., Guan, Q., Shen, C., Feng, X., Zhang, Y., Chen, Y., Cheng, C., & Wu, R. (2022). Integrated SRNA-Seq and RNA-Seq Analysis Reveals the Regulatory Roles of miRNAs in the Low-Temperature Responses of Canarium album. Horticulturae, 8(7), 667. https://doi.org/10.3390/horticulturae8070667

