Next Article in Journal
Nutrient Value, Productivity, and Quality Parameters of Organically Grown Red Beet (Beta vulgaris L. var. conditiva Alef.)
Next Article in Special Issue
Physiological, Biochemical, and Transcriptome Analyses Reveal the Potential Role of ABA in Dufulin-Induced Tomato Resistance to Tomato Brown Rugose Fruit Virus (ToBRFV)
Previous Article in Journal
Morphological and Biochemical Attributes of Brassica cretica Populations Grown Under Drought Tolerance Conditions
Previous Article in Special Issue
Acrostalagmus luteoalbus as the Novel Causing Agent of Root Rot on Strawberry and In Vitro Screening of Effective Fungicides
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 12
Issue 1
10.3390/horticulturae12010054
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Characterization of Colletotrichum siamense Causing Leaf Anthracnose on Cornus officinalis and Its In Vitro Sensitivity to Fungicides in China

by
Tan Wang
1,
Enping Zhou
2,
Weifang Zuo
2,
Liang Wang
1,* and
Sengen Zhu
1,*
1
College of Life Science and Technology, Xinjiang University, Urumqi 830046, China
2
College of Life Science, Nanyang Normal University, Nanyang 473061, China
*
Authors to whom correspondence should be addressed.
Horticulturae 2026, 12(1), 54; https://doi.org/10.3390/horticulturae12010054
Submission received: 30 November 2025 / Revised: 25 December 2025 / Accepted: 30 December 2025 / Published: 31 December 2025
(This article belongs to the Special Issue Sustainable Management of Pathogens in Horticultural Crops)
Browse Figures
Versions Notes

Abstract

Cornus officinalis is a valuable traditional Chinese medicinal (TCM) plant species with both therapeutic and ornamental attributes. It is widely used in TCM prescriptions to nourish the liver and kidneys and constitutes a critical component of numerous classical formulas. In recent years, the large-scale cultivation of this medicinal plant has been expanded in Xixia County, Henan Province, China. Field investigations have revealed widespread brown leaf spot, accompanied by reductions in yield and quality. In this study, symptomatic leaves were collected for pathogen isolation. Tissue isolations consistently yielded a Colletotrichum fungus, and morphology combined with multi-locus phylogenetic analyses (the internal transcribed spacer, glyceraldehyde-3-phosphate dehydrogenase, chitin synthase, actin, and β-tubulin) identified the pathogen as Colletotrichum siamense. Pathogenicity assays (conducted by either wounding and inoculating detached leaves with a mycelium plug or spraying a conidium suspension on healthy potted plants) reproduced field symptoms, and the pathogen was re-isolated, thereby fulfilling Koch’s postulates. In vitro fungicide assays showed that carbendazim, tebuconazole, and prochloraz were highly effective against the pathogen, providing preliminary information for chemical management. This is the first documentation of C. siamense causing leaf anthracnose on C. officinalis and provides a basis for developing targeted control strategies to mitigate disease impacts and preserve yield and quality.

1. Introduction

Cornus officinalis Sieb. et Zucc., a member of the Cornaceae family, is a small shrub native to East Asia, with major populations in China, Korea, and Japan. It is a traditional Chinese medicinal plant, and its dried, ripened fruit is widely recognized as a functional food and processed into value-added products such as beverages, vinegar, and wine [1]. Harvesting typically occurs from September to October, although fruits are sometimes collected in late autumn or early winter [2]. In traditional Chinese medicine (TCM), the fruit is characterized as sour, astringent, and warming, and is reputed to nourish the liver and kidneys, reduce excessive perspiration, and ameliorate age-associated disorders such as Alzheimer’s disease [3]. It plays a key role in numerous classical prescriptions [4]. Clinically, it ranks among the most extensively utilized herbal medicines worldwide and has applications in pharmaceuticals, food, and cosmetic formulations owing to its anti-inflammatory, antiviral, and antioxidant properties [5,6,7].
Colletotrichum is among the most prevalent plant-pathogenic fungi worldwide, capable of infecting a broad spectrum of commercially important woody and herbaceous hosts [8,9,10,11,12,13]. Numerous species within this genus have been documented to infect medicinal plants, as well as numerous herbaceous and woody species, causing anthracnose, which leads to significant yield reductions and economic losses [14,15]. Currently, 16 species complexes are recognized within the genus Colletotrichum. Among these, the C. gloeosporioides complex contains the most species, followed by the C. acutatum and C. boninense complexes [16]. Colletotrichum siamense, a member of the C. gloeosporioides species complex, has previously been reported as a pathogen of medicinal plants such as Capsicum annuum and Morus alba in China [17,18]. C. siamense and C. gloeosporioides are associated with the greatest number of host species in the genus, with 1358 host species recorded for Colletotrichum [15]. These observations align with the tendency of C. siamense populations to occur predominantly in tropical and subtropical climates. This fungus is recognized as a common pathogen with an exceptionally broad host range.
C. officinalis is an important medicinal woody crop widely cultivated in China. Xixia County in Henan Province represents a core production region, with approximately 220,000 mu under cultivation and accounting for more than half of the national output, highlighting the economic importance of managing destructive foliar diseases in commercial orchards. Several diseases have been reported on C. officinalis, including leaf blight caused by Didymella glomerata [19], leaf blight associated with Botryosphaeria dothidea [20].
Systematic disease monitoring was conducted in Xixia County during the summers of 2023 and 2024 to support pathogen management programs for this species. Field inspections revealed numerous severely affected leaves displaying symptoms such as brown lesions, marginal scorch, and tip necrosis. To characterize the disease etiology, we performed isolations, followed by morphological examination and multi-locus phylogenetics of fungal isolates to achieve species-level identification. Moreover, we assessed the pathogenicity of isolates to fulfill Koch’s postulates.

2. Materials and Methods

2.1. Sample Collection

Xixia County is one of the most important C. officinalis estate regions in the country, with a cultivation area of about 13,000 hectares. Samples were collected in Taiping Town (33°37′ N, 111°43′ E) and Miping Town (33°34′ N, 111°24′ E), Xixia County, Henan Province, during the summers of 2023 and 2024. Environmental context was compiled from Taiping Town and Miping Town for June to September during 2023 and 2024. We summarized daily mean/max/min temperature, relative humidity, and rainfall, and noted irrigation regime, pruning status, planting density, and cultivar at each site. A five-point sampling strategy was implemented within each orchard, encompassing a total of 50 trees. From each tree, five leaves exhibiting leaf spot symptoms were randomly collected. At each study location, samples were taken from 10 trees. Individual samples were placed into separate paper bags, labeled, and promptly transported to the laboratory for fungal isolation and subsequent DNA extraction.

2.2. Isolation and Microscopy

A total of 80 specimens from randomly selected leaves were examined microscopically, and the incidence of disease in the field was subsequently determined. Samples were processed as follows: symptomatic leaves were photographed and then pretreated via rinsing under running water for 10 min to remove surface debris. Leaf surfaces were disinfected with 75% ethanol for 30 s, treated with 1% NaClO for 60 s, and rinsed with sterile water, followed by drying with sterile absorbent paper. The pretreated samples were transferred to a laminar flow cabinet, and 5 × 5 mm2 tissue sections were excised from the transition area between the healthy and symptomatic leaf and then inoculated onto potato dextrose agar (PDA) prepared with 200 g of potato, 20 g of glucose, and 15 g of agar per liter and supplemented with streptomycin at 50 μg mL−1 (3–5 blocks per plate). Plates were incubated in an inverted position at 25 °C.
Mycelia from the colony margin were sampled using a 3 mm punch and inoculated at the center of PDA plates for three days to observe colony morphology, color, and size, with photographs taken of individual colonies. After seven days of incubation, the mycelium from the colony margin was used to prepare conidium suspensions with Triton X-100 reagent. Morphological assessments were conducted on 10-day-old cultures using a microscope (BM2100, Jiangnan, Suzhou, China), measuring the dimensions and describing the morphology of conidia (n = 50). At least 50 measurements were taken for taxonomically relevant structures when possible.

2.3. Genomic DNA Extraction, PCR Amplifications and Sequencing

From the isolates obtained, three representative strains (SZY21, SZY22, and SZY23) were selected for DNA extraction and sequencing because they were collected from different towns and years and showed typical Colletotrichum morphology with stable growth in culture. These isolates also produced lesions on C. officinalis leaves in pathogenicity assays and were therefore used as representative strains for molecular identification. Mycelial plugs (0.5 cm diameter) were excised from actively growing cultures on PDA and incubated for 5 days. Genomic DNA was extracted from approximately 200 mg (fresh weight) of mycelium using liquid nitrogen and the CTAB method [21].
Target loci were amplified using the primers in Table 1 (Sangon Biotech, Shanghai, China). Reactions (50 μL) contained 25 μL of Premix Taq (Ex Taq v2.0 plus dye; Takara RR902A), 1 μL of template DNA, 1 μL of each primer, and nuclease-free water to volume. Cycling: 98 °C for 5 min; 35 cycles of 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 60 s; final extension, 72 °C for 10 min. Amplicons were verified on 0.8% agarose gels and Sanger-sequenced (Sangon Biotech, Shanghai, China).

2.4. Phylogenetic Analyses

All sequence data generated in this study were deposited in GenBank. Newly obtained sequences were queried against the GenBank database using BLAST (version 2.17.0) (https://blast.ncbi.nlm.nih.gov/, accessed on 15 October 2025). The sequences of Colletotrichum spp. were retrieved from GenBank (Table 2). For each locus, our sequences, together with representative references retrieved from GenBank, were aligned with MAFFT [27]. The resulting alignments were automatically trimmed with trimAl v1.5.0 and inspected, with manual adjustments made where necessary [28]. Bayesian inference (BI) was conducted on the concatenated dataset comprising the internal transcribed spacer (ITS1-5.8S-ITS2), glyceraldehyde-3-phosphate dehydrogenase (gapdh), chitin synthase (chs-1), actin (act), and β-tubulin (tub2). BI analyses were performed in MrBayes v3.2 [29], with the best-fitting substitution model for each partition selected by ModelFinder [30], and the workflow was managed in PhyloSuite v1.2.3 [31]. Bayesian posterior probabilities (BPPs) are shown at the corresponding nodes of a phylogenetic tree.

2.5. Pathogenicity Tests

Pathogenicity tests were conducted using two approaches. For detached-leaf inoculation, fresh, tender, healthy leaves of C. officinalis were collected, rinsed for approximately 10 min, and transferred to a laminar-flow cabinet. Sterile Petri dishes containing 3 to 5 layers of autoclaved filter paper were pre-moistened with sterile water. Leaves were gently punctured using a disposable syringe needle, agar plugs taken from the actively growing margins of colonies (mycelial side facing the leaf) were placed on the wound site, and the control leaves received sterile PDA plugs. Plates were sealed and incubated at 25 °C, and symptoms were monitored daily. Upon symptom development, the pathogen was re-isolated from lesion margins and morphologically compared with the original inoculum to verify identity. To compare virulence among isolates, disease severity was evaluated under identical inoculation and incubation conditions. Digital images were captured at 0, 2, 3 dpi. Lesion diameter (mm) and area (mm2) were quantified from calibrated images (ImageJ version 1.54p). Virulence was determined by comparing mean lesion area among isolates; the isolate producing the largest lesions (significantly larger than the others, p < 0.05) was considered the most virulent.
For conidial-suspension inoculation, actively sporulating colonies were rinsed with sterile water to obtain a conidial suspension (105 conidia per ml). Ten healthy C. officinalis potted plants (two years old) were selected. Leaves were surface-sterilized and air-dried. Without prior wounding, the conidial suspension (5 mL) was evenly sprayed onto the prepared healthy leaves for each plant, while control plants received sterile water. Inoculated potted plants were incubated at 25 °C for 10 days with a relative humidity of 90%. Incubation period (first visible symptom) was recorded at 1, 2, 3, 5, 7, 10 dpi. The disease severity index (DSI) calculated according to a five-grade scale (0 = healthy, 1 = <5% leaf area affected, 2 = 6–10%, 3 = 11–25%, and 4 = >25%). DSI (%) = ∑(ni × si)/(N × sₘₐₓ) × 100, where nᵢ is the number of leaves in severity class sᵢ, N is the total number of leaves, and sₘₐₓ = 4. Group differences were tested by one-way ANOVA. Following symptom expression, the pathogen was re-isolated from lesion margins and compared with the original inoculum to confirm identity.

2.6. In Vitro Sensitivity of C. siamense to Fungicides

A representative and highly virulent isolate of C. siamense, obtained from symptomatic C. officinalis leaves, was selected for fungicide susceptibility testing because it consistently produced the largest lesions in pathogenicity assays compared with the other tested isolates. Four fungicides that are commonly used for the management of foliar diseases were evaluated: carbendazim, tebuconazole, prochloraz, and difenoconazole (Hansheng Biotechnology, Qingdao, China). Stock solutions of each fungicide were prepared with sterile distilled water and added to molten potato dextrose agar (PDA) that had been autoclaved and cooled to approximately 50 °C. For carbendazim, final concentrations in PDA were 0.01, 0.02, 0.04, 0.08, and 0.16 mg a.i. L−1. For tebuconazole, final concentrations were 0.05, 0.10, 0.20, 0.40, and 0.80 mg a.i. L−1. For prochloraz, final concentrations were 0.10, 0.20, 0.40, 0.80, and 1.60 mg a.i. L−1. For difenoconazole, final concentrations were 0.04, 0.08, 0.16, 0.32, and 0.64 mg a.i. L−1. PDA plates without fungicide served as the untreated control. When an organic solvent was used to dissolve fungicides, solvent-only PDA plates were included as additional controls.
Mycelial plugs (5 mm in diameter) were cut from the actively growing margin of 7-day-old C. siamense colonies on PDA and placed in the center of fungicide-amended or non-amended PDA plates with the mycelium side down. All plates were incubated at 25 °C in the dark for 5 days, or until the colony in the untreated control nearly reached the edge of the plate. Each fungicide concentration was replicated three times, and the experiment was repeated once, yielding similar results. At the end of the incubation period, colony diameter was measured along two perpendicular axes on each plate, and the mean colony diameter was calculated after subtracting the initial plug diameter. The percentage inhibition of mycelial growth (I, %) for each treatment was calculated using the following formula, I (%) = (C−T)/C × 100, where C is the mean colony diameter in the untreated control and T is the mean colony diameter in the fungicide treatment. For each fungicide, the effective concentration required to reduce mycelial growth by 50% (EC50) was estimated by probit analysis of the relationship between percentage inhibition and the logarithm of fungicide concentration using SPSS version 31. Data were subjected to one-way analysis of variance (ANOVA), and treatment means were separated by Tukey’s honestly significant difference (HSD) test at p = 0.05.

3. Results

3.1. Disease Survey and Symptom Description

During the summers of 2023 and 2024, field surveys were conducted in C. officinalis orchards located in Taiping Town and Miping Town, Xixia County. The total surveyed area encompassed approximately 50 mu, a traditional Chinese area unit, ≈3.33 ha. The outbreak in 2023 coincided with mean temperatures of 22.5–28.5 °C, relative humidity (RH) of 70–82%, and monthly rainfall of 89.5–213.0 mm during June–September. In 2024, conditions during June-September included 26.0–28.5 °C, RH 71–82%, and rainfall of 53.3–540.6 mm, which favor anthracnose infections via prolonged leaf wetness. In addition, dense canopy and limited pruning likely increased canopy humidity and inoculum retention. Disease incidence ranged from 50% to 60%. The mean DSI (%) values across survey plots ranged from 32.4% to 36.8%, indicating moderate to severe disease pressure. Accordingly, the risk of spread to other regions will depend on the overlap of suitable temperature–humidity windows, rainfall or irrigation patterns that sustain leaf wetness, and canopy management practices.
As an initial etiological screen, 80 randomly selected symptomatic leaf specimens were examined microscopically. Colletotrichum-like conidia were detected in 43/80 specimens. Among these 43 specimens, 8 also contained Alternaria-like conidia, suggesting possible mixed colonization on some lesions. The remaining 37/80 specimens did not show observable conidia, likely because the lesions were at an early stage with limited sporulation. These microscopy observations were therefore used as preliminary evidence to guide subsequent isolation.
Anthracnose, caused by Colletotrichum spp., was the predominant foliar disease observed in the region. Symptoms were primarily confined to the leaves, initially appearing near the apex within interveinal tissue between the two lateral veins. Early lesions were irregularly shaped, dark brown to blackish brown, and exhibited indistinct margins. As the disease advanced, lesions enlarged and coalesced, forming extensive necrotic areas. In severe cases, necrosis progressed from the leaf tip toward the base, leading to complete foliar blight and premature leaf death (Figure 1).
Quantitative lesion measurements revealed that individual necrotic lesions ranged from 2.1 ± 0.4 mm to 8.6 ± 1.2 mm in diameter during the early stages, with merged lesions covering more than 30% of the leaf area in advanced infections. Field observations indicated that heavily infected trees exhibited premature defoliation, reduced photosynthetic canopy, and a potential impact on fruit yield and quality.

3.2. Morphological Identification of Colletotrichum Isolates

During June–September of 2023 and 2024, symptomatic C. officinalis leaves were collected from orchards in Taiping Town and Miping Town, Xixia County, Henan Province, China. A total of 68 isolates were obtained, and the three representative strains from distinct orchards (SZY21, SZY22, SZY23) displayed typical Colletotrichum colony morphology (Table 3). Initially, colonies on potato dextrose agar (PDA) were white, with flocculent and dense aerial mycelia and irregular margins. With culture aging, some regions gradually developed a dark pigmentation (Figure 2a).
Vegetative hyphae were 2–3.5 µm in diameter, hyaline, smooth-walled, septate, and branched. Conidia were hyaline, smooth-walled, aseptate, straight, and cylindrical, with both ends rounded, measuring 11–19 × 4–6 µm (mean ± SD = 15.1 ± 1.0 × 5.5 ± 0.4 µm), with a length-to-width (L/W) ratio of 2.7 (Figure 2d). Appressoria were abundant on slide cultures, medium to dark brown, single or in small clusters, clavate to broadly ellipsoidal, and sometimes irregularly lobed (Figure 2e). These morphological features were consistent with descriptions of Colletotrichum siamense within the C. gloeosporioides species complex [32].
Among the remaining isolates, 65/68 (95.6%) exhibited colony color, conidial size, and appressorial form consistent with C. siamense. A rapid marker screen on 20 additional isolates (ITS1-5.8S-ITS2) returned best BLAST matches to C. siamense (identity ≥ 99%, coverage ≥ 98%), with no conflicting top hits. These findings corroborate the predominance of C. siamense in the surveyed orchards.

3.3. Phylogenetic Analysis

Five genetic loci—ITS1-5.8S-ITS2, gapdh, chs-1, act, and tub2—were successfully amplified, sequenced, and deposited in GenBank under the accession numbers PV529834–PV529836 (ITS1-5.8S-ITS2), PV540228–PV540230 (gapdh), PV540225–PV540227 (chs-1), PV544191–PV544193 (act), and PV540231–PV540233 (tub2). Sequences from each locus were aligned with those of phylogenetically related Colletotrichum species, as determined via BLAST searches (version 2.16.0) in the NCBI nucleotide database. Phylogenetic reconstruction based on the concatenated dataset of ITS1-5.8S-ITS2, gapdh, chs-1, act, and tub2 generated a well-resolved tree (Figure 3). The alignment is composed of 1259 characters (ITS1-5.8S-ITS2: 1–470, gapdh: 471–607, chs-1: 608–818, act: 819–936, tub2: 937–1259). Colletotrichum arecacearum (LC13850 and LC13851) were used as outgroup taxa. Bayesian Inference phylogenies were inferred using MrBayes under K80 + I + G model (2 parallel runs, 2,000,000 generations), in which the initial 25% of sampled data were discarded as burn-in. The analyses consistently indicated that the strains obtained from C. officinalis represent a previously described species. The C. officinalis isolates clustered with C. siamense with high support, consistent with morphological evidence.

3.4. Pathogenicity Test

Pathogenicity assays conducted using both detached-leaf and conidial-suspension inoculation approaches successfully reproduced typical anthracnose symptoms observed in the field. In the detached-leaf assay, necrotic lesions initiated at the inoculation sites within three days post-inoculation progressively enlarged into irregular dark brown to black spots, which often coalesced to form extensive blighted areas. No symptoms developed on control leaves inoculated with sterile PDA plugs. In the conidial-suspension assay, inoculated potted plants exhibited initial chlorotic spots within seven days, which subsequently expanded into irregular necrotic lesions consistent with field observations, with a disease incidence exceeding 90% by 10 days post-inoculation (Figure 4). Control plants sprayed with sterile water remained symptomless. C. siamense was consistently re-isolated from symptomatic tissues in both assays, and its morphological and molecular characteristics were identical to those of the original inoculum, thereby fulfilling Koch’s postulates.
Detached leaves developed necrotic spots by 2–3 dpi. Mean lesion diameter reached 1.8 ± 0.3 mm at 2 dpi and 3.2 ± 0.4 mm at 3 dpi (LSMeans ± SE); lesion area increased from 3.3 ± 0.2 mm2 (2 dpi) to 9.1 ± 1.2 mm2 (3 dpi) (p < 0.001 for time; treatment × time p < 0.001). In spray assays, the incubation period was 3.6 ± 0.2 days. DSI rose from 8.3 ± 1.1% (3 dpi) to 35.9 ± 2.5% (10 dpi). Among the tested isolates, SZY21 produced the largest lesions on inoculated leaves and was therefore considered the most virulent under our assay conditions; accordingly, SZY21 was used as the representative isolate for fungicide susceptibility testing. These assay values align with field observations (field mean DSI 32.4–36.8%) under warm, humid conditions. In detached-fruit inoculation assays, neither inoculated nor mock-treated harvested fruits developed visible lesions during the observation period.

3.5. Fungicide Sensitivity Assays

All four fungicides significantly inhibited mycelial growth of C. siamense on PDA compared with the untreated control (p < 0.05). For each fungicide, mycelial growth on PDA generally decreased with increasing fungicide concentration. Based on dose–response analyses, the EC50 values of carbendazim, tebuconazole, prochloraz, and difenoconazole against C. siamense were 0.035, 0.211, 0.386, and 0.391 mg a.i. L−1, respectively (Table 4). Among the tested fungicides, carbendazim exhibited the lowest EC50 value, followed by tebuconazole and prochloraz, indicating high intrinsic activity against the pathogen. Difenoconazole showed a much higher EC50 value than the other fungicides, suggesting relatively weaker efficacy under the tested conditions. These results indicate that carbendazim, tebuconazole, and prochloraz are more effective options for inhibiting mycelial growth of C. siamense in vitro and may be considered as promising candidates for chemical management of leaf anthracnose on C. officinalis.

4. Discussion

Previous studies have documented several foliar diseases affecting C. officinalis, including powdery mildew (Erysiphe sp.), reported in Korea [33], and Botryosphaeria dothidea [20] and Didymella species [19], all of which primarily target the leaves rather than fruits. These pathogens are associated with reduced photosynthetic area and premature leaf senescence, ultimately impacting plant vigor and yield potential. In the present study, the pathogen isolated from symptomatic C. officinalis leaves was identified as C. siamense, representing the first record of this species causing anthracnose on this host. This finding indicates a novel disease occurrence in C. officinalis populations.
Our two-year field surveys indicate an epidemiological window for leaf anthracnose in C. officinalis orchards from June to September, characterized by warm temperatures (≈22.5–28.5 °C) together with recurrent rainfall leaf-wetness events and elevated canopy humidity. Such conditions are widely recognized as conducive to anthracnose epidemics and sustained surface wetness promote Colletotrichum conidial germination, appressorium formation, and secondary inoculum production. Consistently, studies have shown that conidial processes of Colletotrichum are strongly temperature–wetness dependent [34], and weather-based advisory systems commonly use temperature, leaf wetness duration, rainfall, and relative humidity to define infection-risk periods and optimize spray timing [35]. Moreover, C. siamense has been reported to grow best at 25–30 °C, which matches the observed summer window in Xixia County. Therefore, management should prioritize reducing leaf wetness, and we recommend weekly scouting from June to September and initiating interventions when disease levels begin to rise (DSI ≥ 10%) and when forecasts indicate prolonged wetness No fruit symptoms were observed in the field, and our postharvest inoculations did not produce lesions, suggesting limited fruit susceptibility under local microclimate. Colletotrichum fruit infections can be latent and become evident during storage [36]. Notably, no visible lesions developed on harvested fruits in our inoculation assays, and the mock controls remained symptomless as well. This negative result suggests that harvested C. officinalis fruits may be less permissive to anthracnose symptom expression under the conditions tested. Colletotrichum infection typically begins with conidial adhesion and germination on the fruit surface, followed by appressorium-mediated penetration through the epidermis; therefore, fruit epidermal features can act as a physical barrier that restricts or delays colonization and symptom development [37].
The relatively low EC50 values of carbendazim, tebuconazole, and prochloraz against C. siamense in this study are comparable to those reported for this species on other hosts, suggesting that these fungicides could be integrated into management programs for leaf anthracnose on C. officinalis, while resistance risks and environmental safety should be carefully considered. In practice, chemical control should rely on foliar sprays applied at least one month prior to fruit harvest, to minimize fungicide residues on the harvested fruits and ensure the safe use of C. officinalis as a medicinal material.
Beyond C. officinalis, C. siamense has been documented on multiple pharmacologically important plants, underscoring its broad host range and epidemiological relevance in TCM systems [38]. Notable first reports include anthracnose on Illicium verum in China [39]. Similarly, Kadsura coccinea, a valued medicinal liana, has been shown to suffer from leaf anthracnose caused by C. siamense in Guangxi [40]. In woody ornamentals with medicinal or aromatic value, such as Osmanthus fragrans, it has been associated with high-incidence leaf anthracnose in South China [41]. Collectively, these cases demonstrate that C. siamense is both frequent and infects diverse medicinal plants, supporting our inference that it may warrant proactive monitoring and targeted management in herb medicine agroecosystems.
Species within the genus Colletotrichum can be differentiated based on colony morphology and conidial characteristics, including pigmentation, texture, growth rate, and the size and shape of conidia. Key microscopic traits, such as conidial length, width, and length-to-width ratio, as well as the presence and dimensions of appressoria, often serve as important diagnostic features. However, species-level identification based solely on morphological criteria is unreliable due to phenotypic plasticity and overlap in morphometric ranges among closely related taxa. Consequently, the current taxonomic consensus advocates the integration of multi-locus DNA sequence analyses for accurate phylogenetic delimitation of species within the genus. In the present study, five genetic loci—ITS1-5.8S-ITS2, gapdh, chs-1, act, and tub2—were sequenced and concatenated to construct a multi-locus phylogeny [42,43]. This approach is consistent with recent studies that have employed combined morphological and molecular datasets to resolve species boundaries within the C. gloeosporioides species complex. Representative species used for comparative analysis included C. cordylinicola, C. endophytica, C. fructicola, C. gardeniae, C. grevilleae, C. jiangxiense, C. kunmingense, C. ligustri, and C. siamense. Species delimitation within the C. gloeosporioides complex relies on multi-locus evidence benchmarked to ex-type references rather than morphology alone. In our dataset, the concatenated tree—rooted with C. arecacearum (LC13850, LC13851)—places the isolates within C. siamense with strong support (BI 0.940). Locus-specific BLAST results showed higher identity to C. siamense ex-type than to C. fructicola across informative markers, and pairwise p-distances to C. siamense were consistently smaller than to C. fructicola. For example, gapdh and act—which are particularly informative in this complex—displayed 100% (114/114) and 100% (126/126) of SZY21 identity to the C. siamense ex-type CBS 130417, respectively, versus 98% (112/114) and 99% (125/126) to C. fructicola ex-type CBS 130416. In the concatenated phylogeny rooted with C. arecacearum (LC13850/LC13851), our isolates (SZY21–SZY23) are nested within the C. siamense clade and cluster with C. siamense NTCC 1308. The relatively long terminal branch leading to our isolates likely reflects concatenation across informative loci and uneven within-species sampling, rather than placement outside C. siamense. Morphological traits are congruent with C. siamense, supporting this identification. Together, these lines of evidence support identification as C. siamense.
While multi-locus phylogeny was performed on three representatives, the morphological concordance across isolates and rapid marker identifications support C. siamense as the dominant pathogen during the outbreak. Nonetheless, low-frequency co-occurring taxa cannot be fully excluded; future work will expand multi-locus sequencing and/or culture-independent metabarcoding to improve detection sensitivity.

5. Conclusions

This study provides the first report of the isolation and identification of the causal agent of anthracnose on C. officinalis leaves. Through the integration of culture-based isolation, ITS1-5.8S-ITS2-region sequencing, and pathogenic assays, C. siamense was confirmed as the predominant pathogen associated with symptomatic leaves and was demonstrated to cause disease in artificial inoculations, thereby fulfilling Koch’s postulates. In addition, in vitro fungicide sensitivity assays showed that C. siamense was most sensitive to carbendazim (lowest EC50 value; 0.035 mg a.i. L−1), providing preliminary guidance for chemical control. Collectively, these findings provide a scientific basis for targeted management of leaf anthracnose on C. officinalis in Henan Province and support carbendazim as a promising candidate for chemical control pending field validation.

Author Contributions

Conceptualization, L.W. and S.Z.; methodology, T.W.; software, T.W.; validation, T.W.; formal analysis, T.W.; investigation, T.W. and E.Z.; resources, W.Z. and E.Z.; data curation, T.W.; writing—original draft preparation, T.W.; writing—review and editing, T.W.; visualization, T.W.; supervision, L.W. and S.Z.; funding acquisition, W.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Science and Technology Key Project of Henan Province (No. 252102110310).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All nucleotide sequences generated in this study have been deposited in NCBI GenBank in Table 2. Records can be accessed via the NCBI Nucleotide database: https://www.ncbi.nlm.nih.gov/nuccore/ accessed on 15 October 2025 using the listed accession numbers.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Han, X.; Ding, C.; Ning, Y.; Shan, Q.; Niu, M.; Cai, H.; Xu, P.; Cao, G. Optimizing Processing Technology of Cornus officinalis: Based on Anti-Fibrotic Activity. Front. Nutr. 2022, 9, 807071. [Google Scholar] [CrossRef] [PubMed]
  2. Cui, C.; Liu, W.; Feng, L.; Zou, J.; Shi, Y.; Sun, J.; Zhang, X.; Huo, E.; Luan, F.; Zhang, M. Cornus officinalis Sieb.: An updated review on the ethnopharmacology, phytochemistry, pharmacology, toxicology, and pharmacokinetics. J. Ethnopharmacol. 2025, 353, 120365. [Google Scholar] [CrossRef]
  3. Peng, Z.-C.; He, J.; Pan, X.-G.; Zhang, J.; Wang, Y.-M.; Ye, X.-S.; Xia, C.-Y.; Lian, W.-W.; Yan, Y.; He, X.-L.; et al. Secoiridoid dimers and their biogenetic precursors from the fruits of Cornus officinalis with potential therapeutic effects on type 2 diabetes. Bioorganic Chem. 2021, 117, 105399. [Google Scholar] [CrossRef]
  4. Huang, J.; Zhang, Y.; Dong, L.; Gao, Q.; Yin, L.; Quan, H.; Chen, R.; Fu, X.; Lin, D. Ethnopharmacology, phytochemistry, and pharmacology of Cornus officinalis Sieb. et Zucc. J. Ethnopharmacol. 2018, 213, 280–301. [Google Scholar] [CrossRef]
  5. Cao, G.; Cai, H.; Cai, B.; Tu, S. Effect of 5-hydroxymethylfurfural derived from processed Cornus officinalis on the prevention of high glucose-induced oxidative stress in human umbilical vein endothelial cells and its mechanism. Food Chem. 2013, 140, 273–279. [Google Scholar] [CrossRef]
  6. Hao, Z.-Y.; Wang, X.-L.; Yang, M.; Cao, B.; Zeng, M.-N.; Zhou, S.-Q.; Li, M.; Cao, Y.-G.; Xie, S.-S.; Zheng, X.-K.; et al. Minor iridoid glycosides from the fruits of Cornus officinalis Sieb. et Zucc. and their anti-diabetic bioactivities. Phytochemistry 2023, 205, 113505. [Google Scholar] [CrossRef]
  7. Aurori, M.; Niculae, M.; Hanganu, D.; Pall, E.; Cenariu, M.; Vodnar, D.C.; Bunea, A.; Fiţ, N.; Andrei, S. Phytochemical Profile, Antioxidant, Antimicrobial and Cytoprotective Effects of Cornelian Cherry (Cornus mas L.) Fruit Extracts. Pharmaceuticals 2023, 16, 420. [Google Scholar] [CrossRef]
  8. Crouch, J.A.; Clarke, B.B.; White, J.F.; Hillman, B.I. Systematic analysis of the falcate-spored graminicolous Colletotrichum and a description of six new species from warm-season grasses. Mycologia 2009, 101, 717–732. [Google Scholar] [CrossRef] [PubMed]
  9. de Silva, D.D.; Ades, P.K.; Crous, P.W.; Taylor, P.W.J. Colletotrichum species associated with chili anthracnose in Australia. Plant Pathol. 2017, 66, 254–267. [Google Scholar] [CrossRef]
  10. Sharma, G.; Maymon, M.; Freeman, S. Epidemiology, pathology and identification of Colletotrichum including a novel species associated with avocado (Persea americana) anthracnose in Israel. Sci. Rep. 2017, 7, 15839. [Google Scholar] [CrossRef]
  11. Talhinhas, P.; Loureiro, A.; Oliveira, H. Olive anthracnose: A yield- and oil quality-degrading disease caused by several species of Colletotrichum that differ in virulence, host preference and geographical distribution. Mol. Plant Pathol. 2018, 19, 1797–1807. [Google Scholar] [CrossRef]
  12. Tovar-Pedraza, J.M.; Mora-Aguilera, J.A.; Nava-Díaz, C.; Lima, N.B.; Michereff, S.J.; Sandoval-Islas, J.S.; Câmara, M.P.S.; Téliz-Ortiz, D.; Leyva-Mir, S.G. Distribution and Pathogenicity of Colletotrichum Species Associated with Mango Anthracnose in Mexico. Plant Dis. 2020, 104, 137–146. [Google Scholar] [CrossRef]
  13. Riolo, M.; Aloi, F.; Pane, A.; Cara, M.; Cacciola, S.O. Twig and Shoot Dieback of Citrus, a New Disease Caused by Colletotrichum Species. Cells 2021, 10, 449. [Google Scholar] [CrossRef] [PubMed]
  14. Liu, X.; Zheng, X.; Khaskheli, M.I.; Sun, X.; Chang, X.; Gong, G. Identification of Colletotrichum Species Associated with Blueberry Anthracnose in Sichuan, China. Pathogens 2020, 9, 718. [Google Scholar] [CrossRef]
  15. Talhinhas, P.; Baroncelli, R. Colletotrichum species and complexes: Geographic distribution, host range and conservation status. Fungal Divers. 2021, 110, 109–198. [Google Scholar] [CrossRef]
  16. Liu, F.; Ma, Z.Y.; Hou, L.W.; Diao, Y.Z.; Wu, W.P.; Damm, U.; Song, S.; Cai, L. Updating species diversity of Colletotrichum, with a phylogenomic overview. Stud. Mycol. 2022, 101, 1–56. [Google Scholar] [CrossRef]
  17. Liu, F.; Tang, G.; Zheng, X.; Li, Y.; Sun, X.; Qi, X.; Zhou, Y.; Xu, J.; Chen, H.; Chang, X.; et al. Molecular and phenotypic characterization of Colletotrichum species associated with anthracnose disease in peppers from Sichuan Province, China. Sci. Rep. 2016, 6, 32761. [Google Scholar] [CrossRef]
  18. Xue, L.; Zhang, L.; Yang, X.X.; Huang, X.; Wu, W.; Zhou, X.; White, J.F.; Liu, Y.; Li, C. Characterization, Phylogenetic Analyses, and Pathogenicity of Colletotrichum Species on Morus alba in Sichuan Province, China. Plant Dis. 2019, 103, 2624–2633. [Google Scholar] [CrossRef] [PubMed]
  19. Huang, S.L.; Wang, L.; Wang, T.; Jiao, Z.J.; Pang, F.H.; Tao, A.L.; Niu, X.R.; Lu, W.H. First Report of Didymella Leaf blight on Cornus officinalis caused by Didymella glomerata in China. Plant Dis. 2018, 102, 1031. [Google Scholar] [CrossRef]
  20. Zhang, Q.-Q.; Kong, W.-L.; Ni, H.; Wu, X.-Q. First Report of Botryosphaeria dothidea Causing Leaf Blight on Cornus officinalis in Jiangsu Province, China. Plant Dis. 2023, 107, 948. [Google Scholar] [CrossRef]
  21. Lee, S.B.; Taylor, J.W. Isolation of DNA from fungal mycelia and single spores. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., Eds.; Academic Press: New York, NY, USA, 1990; pp. 282–287. [Google Scholar]
  22. White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: New York, NY, USA, 1990; pp. 315–322. [Google Scholar]
  23. Templeton, M.D.; Rikkerink, E.H.; Solon, S.L.; Crowhurst, R.N. Cloning and molecular characterization of the glyceraldehyde-3-phosphate dehydrogenase-encoding gene and cDNA from the plant pathogenic fungus Glomerella cingulata. Gene 1992, 122, 225–230. [Google Scholar] [CrossRef]
  24. Carbone, I.; Kohn, L.M. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 1999, 91, 553–556. [Google Scholar] [CrossRef]
  25. Glass, N.L.; Donaldson, G.C. Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Appl. Environ. Microbiol. 1995, 61, 1323–1330. [Google Scholar] [CrossRef]
  26. O’Donnell, K.; Cigelnik, E. Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous. Mol. Phylogenetics Evol. 1997, 7, 103–116. [Google Scholar] [CrossRef]
  27. Katoh, K.; Rozewicki, J.; Yamada, K.D. MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Brief. Bioinform. 2019, 20, 1160–1166. [Google Scholar] [CrossRef]
  28. Capella-Gutiérrez, S.; Silla-Martínez, J.M.; Gabaldón, T. trimAl: A tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics 2009, 25, 1972–1973. [Google Scholar] [CrossRef] [PubMed]
  29. Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef]
  30. Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.K.F.; von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat. Methods 2017, 14, 587–589. [Google Scholar] [CrossRef] [PubMed]
  31. Xiang, C.-Y.; Gao, F.; Jakovlić, I.; Lei, H.-P.; Hu, Y.; Zhang, H.; Zou, H.; Wang, G.-T.; Zhang, D. Using PhyloSuite for molecular phylogeny and tree-based analyses. Imeta 2023, 2, e87. [Google Scholar] [CrossRef] [PubMed]
  32. Weir, B.S.; Johnston, P.R.; Damm, U. The Colletotrichum gloeosporioides species complex. Stud. Mycol. 2012, 73, 115–180. [Google Scholar] [CrossRef]
  33. Choi, I.Y.; Abasova, L.; Choi, J.H.; Park, J.H.; Shin, H.D. Erysiphe cornicola, a Powdery Mildew Occurring on Cornus controversa in Korea. Korean J. Mycol. 2023, 51, 57–62. [Google Scholar] [CrossRef]
  34. Leandro, L.F.S.; Gleason, M.L.; Nutter, F.W.; Wegulo, S.N.; Dixon, P.M. Influence of Temperature and Wetness Duration on Conidia and Appressoria of Colletotrichum acutatum on Symptomless Strawberry Leaves. Phytopathology 2003, 93, 513–520. [Google Scholar] [CrossRef]
  35. Salotti, I.; Ji, T.; Rossi, V. Temperature requirements of Colletotrichum spp. belonging to different clades. Front. Plant Sci. 2022, 13, 953760. [Google Scholar] [CrossRef] [PubMed]
  36. Bernal, V.V.; Boeckman, N.J.; Aćimović, S.G.; Khodadadi, F. The dark side of avocados: A review of anthracnose and stem-end rot in postharvest fruit. Front. Microbiol. 2025, 16, 1644061. [Google Scholar] [CrossRef] [PubMed]
  37. Gomes, S.; Bacelar, E.; Martins-Lopes, P.; Carvalho, T.; Guedes-Pinto, H. Infection Process of Olive Fruits by Colletotrichum acutatum and the Protective Role of the Cuticle and Epidermis. J. Agric. Sci. 2012, 4, 101. [Google Scholar] [CrossRef]
  38. Cui, J.; Sun, J.; Li, M.; Chen, G.; Yang, J.; Wang, Y.; Huang, T.; Gong, D.; Hu, M. First report of Colletotrichum siamense and C. tropicale causing anthracnose of Syngonium podophyllum in China. Crop Prot. 2025, 187, 106978. [Google Scholar] [CrossRef]
  39. Liao, W.; Luo, J.; Zou, D.; Zhong, Y.; Wu, Y.; Yan, K.; Huang, N. First Report of Anthracnose Caused by Colletotrichum siamense on Illicium verum in China. Plant Dis. 2023, 107, 2232. [Google Scholar] [CrossRef]
  40. Jiang, G.H.; Jiang, A.M.; Fan, C.L.; Wei, J.G.; Ren, L.Y.; Luo, J.T. First Report of Anthracnose on Kadsura coccinea Caused by Colletotrichum siamense in China. Plant Dis. 2022, 106, 328. [Google Scholar] [CrossRef]
  41. Liu, C.Y.; Liu, Y.L.; Xie, Z.H. First Report of Colletotrichum siamense Causing Anthracnose in Osmanthus fragrans in China. Plant Dis. 2022, 106, 2749. [Google Scholar] [CrossRef]
  42. Sharma, G.; Pinnaka, A.K.; Shenoy, B.D. Resolving the Colletotrichum siamense species complex using ApMat marker. Fungal Divers. 2015, 71, 247–264. [Google Scholar] [CrossRef]
  43. Zhang, Q.; Nizamani, M.M.; Feng, Y.; Yang, Y.Q.; Jayawardena, R.S.; Hyde, K.D.; Wang, Y.; Li, C. Genome-scale and multi-gene phylogenetic analyses of Colletotrichum spp. host preference and associated with medicinal plants. Mycosphere 2023, 14, 1–106. [Google Scholar] [CrossRef]
Horticulturae 12 00054 g001
Figure 1. Symptoms of leaf necrosis on C. officinalis in the field. (a) Early stage disease symptoms; (b–d) late-stage symptoms. The red arrows in (b,d) indicate lesions that progress along the veins.
Figure 1. Symptoms of leaf necrosis on C. officinalis in the field. (a) Early stage disease symptoms; (b–d) late-stage symptoms. The red arrows in (b,d) indicate lesions that progress along the veins.
Horticulturae 12 00054 g001
Horticulturae 12 00054 g002
Figure 2. Morphology of the three representative isolates of SZY21, SZY22, and SZY23. (a–c) Colony morphology (obverse and reverse) on PDA after 21 days of incubation at 25 °C; (a) SZY21, (b) SZY22, and (c) SZY23; (d) Conidia. Scale bar = 20 μm. (e) Appressoria showing pronounced melanin accumulation. Scale bar = 20 μm.
Figure 2. Morphology of the three representative isolates of SZY21, SZY22, and SZY23. (a–c) Colony morphology (obverse and reverse) on PDA after 21 days of incubation at 25 °C; (a) SZY21, (b) SZY22, and (c) SZY23; (d) Conidia. Scale bar = 20 μm. (e) Appressoria showing pronounced melanin accumulation. Scale bar = 20 μm.
Horticulturae 12 00054 g002
Horticulturae 12 00054 g003
Figure 3. Phylogenetic trees based on Bayesian inference (BI) analysis of a combined dataset of ITS1-5.8S-ITS2, gapdh, chs-1, act, and tub2 gene sequences of Colletotrichum species. Bayesian posterior probabilities (BPPs) are presented above the branches. Red arrows indicate the BPPs that were shifted slightly to avoid overlap with tree branches. Bold indicates the strains described in this study. The scale bar indicates 0.01 substitutions per site. Red arrows indicate the Bayesian posterior probability (BPP) values that were shifted slightly to avoid overlap with tree branches. C. arecacearum (LC13850 and LC13851) was selected as the outgroup.
Figure 3. Phylogenetic trees based on Bayesian inference (BI) analysis of a combined dataset of ITS1-5.8S-ITS2, gapdh, chs-1, act, and tub2 gene sequences of Colletotrichum species. Bayesian posterior probabilities (BPPs) are presented above the branches. Red arrows indicate the BPPs that were shifted slightly to avoid overlap with tree branches. Bold indicates the strains described in this study. The scale bar indicates 0.01 substitutions per site. Red arrows indicate the Bayesian posterior probability (BPP) values that were shifted slightly to avoid overlap with tree branches. C. arecacearum (LC13850 and LC13851) was selected as the outgroup.
Horticulturae 12 00054 g003
Horticulturae 12 00054 g004
Figure 4. Pathogenicity assay results. (a) Symptoms on inoculated leaves; (b) no symptoms can be observed on the healthy control leaves; (c) symptoms on inoculated potted seedlings, 10 days after the inoculation with conidial suspension; (d) no symptoms on control plants.
Figure 4. Pathogenicity assay results. (a) Symptoms on inoculated leaves; (b) no symptoms can be observed on the healthy control leaves; (c) symptoms on inoculated potted seedlings, 10 days after the inoculation with conidial suspension; (d) no symptoms on control plants.
Horticulturae 12 00054 g004
Table 1. The primer sequences for each locus of Colletotrichum sp. in this study.
Table 1. The primer sequences for each locus of Colletotrichum sp. in this study.
LocusPrimerSequencesReferences
ITS1-5.8S-ITS2ITS1TCCGTAGGTGAACCTGCGG[22]
ITS4TCCTCCGCTTATTGATATGC
gapdhGDF1GCCGTCAACGACCCCTTCATTGA[23]
GDR1GGGTGGAGTCGTACTTGAGCATGT
chs-1CHS-79FTGGGGCAAGGATGCTTGGAAGAAG[24]
CHS-354RTGGAAGAACCATCTGTGAGAGTTG
actACT-512FATGTGCAAGGCCGGTTTCGC[24]
ACT-783RTACGAGTCCTTCTGGCCCAT
tub2T1AACATGCGTGAGATTGTAAGT[25,26]
Bt2bACCCTCAGTGTAGTGACCCTTGGC
Table 2. Isolates and GenBank accession numbers used for phylogenetic analyses in this study.
Table 2. Isolates and GenBank accession numbers used for phylogenetic analyses in this study.
Species and StrainsHost and CountryITS1-5.8S-ITS2gapdhchs-1acttub2
C. arecacearum
LC13850
LC13851
Arecaceae sp. ChinaMZ595867MZ664049MZ799262MZ664165MZ673986
Arecaceae sp. ChinaMZ595868MZ664050MZ799263MZ664166MZ673987
C. cordylinicola
GUCC 12080
GUCC 12079
Cordyline fruticose ChinaOP722973OP784100OP730653OP740195OP761966
Cordyline fruticose ChinaOP722972OP784099OP730652OP740194OP761965
C. jiangxiense
GUCC 12044
GUCC 12043
Illicium simonsii ChinaOP722970OP784038OP730595OP740135OP761906
Illicium simonsii ChinaOP722998OP784037OP730594OP740134OP761905
C. gardeniae
GUCC 12049
GUCC 12048
Gardenia jasminoides ChinaOP722959OP737963OP715766OP715801OP720858
Gardenia jasminoides ChinaOP722989OP737962OP715765OP715800OP720857
C. kunmingense
GUCC 12053
Ophiopogon japonicus ChinaOP722975OP737965OP715769OP715804OP720861
C. grevilleae
CBS 132879
Grevillea sp. ItalyKC297078KC297010KC296987KC296941KC297102
C. ligustri
GUCC 12111
Ilex chinensis ChinaOP722988OP737968OP715773OP740216OP720864
C. endophytica
LC0324
Pennisetum purpureum ThailandKC633854KC832854MZ799261KF306258MZ673954
C. fructicola
CBS 130416
GUCC12102
GUCC 12059
ICMP 18646
Coffea arabica ThailandJX010165JX010033JX009866FJ907426JX010405
Curcuma phaeocaulis ChinaOP723019OP784115OP730667OP740203OP761981
Ligustrum lucidum ChinaOP723017OP784075OP730628OP740172OP761941
Tetragastris panamensis PanamaJX010173JX010032JX009874JX009581JX010409
C. siamense
GUCC 12062
GUCC 12061
CBS 130417
NTCC 1308
HSPCS214
C4
SZY21
SZY22
SZY23
Alocasia macrorrhiza ChinaOP722957OP784086OP730639OP740181OP761952
Hymenocallis littoralis ChinaOP722977OP784083OP730636OP740178OP761949
Coffea arabica ThailandJX010171JX009924JX009865FJ907423JX010404
Afrocarpus gracilior IndiaPX250322PX257861PX257860PX257856PX257859
Clausena lansium ChinaPX096396PX120585PX120717PX120655PX120781
Artocarpus heterophyllus ThailandPP960241PP982581PP982566PP975273PP982550
Cornus officinalis ChinaPV529834PV540228PV540225PV544191PV540231
Cornus officinalis ChinaPV529835PV540229PV540226PV544192PV540232
Cornus officinalis ChinaPV529836PV540230PV540227PV544193PV540233
Table 3. Characterization for the three representative isolates from C. officinalis in this study.
Table 3. Characterization for the three representative isolates from C. officinalis in this study.
IsolateYear/MonthLocationHost Tissue
SZY212023.08Taiping TownLeaf lesion
SZY222023.08Taiping TownLeaf lesion
SZY232024.09Miping TownLeaf lesion
Table 4. Mycelial growth inhibition and EC50 estimates of C. siamense for four fungicides.
Table 4. Mycelial growth inhibition and EC50 estimates of C. siamense for four fungicides.
FungicideTested Concentration Range
(mg a.i. L−1)		Inhibition (%)EC50
(mg a.i. L−1)
Carbendazim0.01–0.1643.22–58.260.035
Tebuconazole0.05–0.8042.91–72.400.211
Prochloraz0.10–1.6058.70–80.150.386
Difenoconazole0.04–0.6434.85–75.600.391
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, T.; Zhou, E.; Zuo, W.; Wang, L.; Zhu, S. Characterization of Colletotrichum siamense Causing Leaf Anthracnose on Cornus officinalis and Its In Vitro Sensitivity to Fungicides in China. Horticulturae 2026, 12, 54. https://doi.org/10.3390/horticulturae12010054

AMA Style

Wang T, Zhou E, Zuo W, Wang L, Zhu S. Characterization of Colletotrichum siamense Causing Leaf Anthracnose on Cornus officinalis and Its In Vitro Sensitivity to Fungicides in China. Horticulturae. 2026; 12(1):54. https://doi.org/10.3390/horticulturae12010054

Chicago/Turabian Style

Wang, Tan, Enping Zhou, Weifang Zuo, Liang Wang, and Sengen Zhu. 2026. "Characterization of Colletotrichum siamense Causing Leaf Anthracnose on Cornus officinalis and Its In Vitro Sensitivity to Fungicides in China" Horticulturae 12, no. 1: 54. https://doi.org/10.3390/horticulturae12010054

APA Style

Wang, T., Zhou, E., Zuo, W., Wang, L., & Zhu, S. (2026). Characterization of Colletotrichum siamense Causing Leaf Anthracnose on Cornus officinalis and Its In Vitro Sensitivity to Fungicides in China. Horticulturae, 12(1), 54. https://doi.org/10.3390/horticulturae12010054

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop