Next Article in Journal
The Transcriptome and Metabolome Reveal the Mechanism by Which Melatonin Enhances Drought Tolerance in Platycrater argutae
Previous Article in Journal
Construction and Phenotypic Characterization of a Recombination Inbred Line (RIL) Population from a Melo-agrestis Melon Hybrid
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 11
Issue 9
10.3390/horticulturae11091088
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Addition of Earthworms to Continuous Cropping Soil Inhibits the Fusarium Wilt in Watermelon: Evidence Under Both Field and Pot Conditions

by
Xin Zhao
1,†,
Liang Zheng
2,†,
Dong Liu
1,
Ke Song
3,4,
Ping Lu
5,
Yefeng Yang
6,
Lijuan Yang
7,
Xiaoxiao Li
3,4,
Yinsheng Li
8,
Yue Zhang
3,4,
Weiguang Lv
3,4,* and
Xianqing Zheng
3,4,*
1
School of Ecological Technology and Engineering, Shanghai Institute of Technology, Shanghai 201418, China
2
East China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Shanghai 200090, China
3
Eco-Environment Protection Research Institute, Shanghai Academy of Agricultural Sciences, Shanghai 201403, China
4
National Agricultural Experimental Station for Agricultural Environment, Shanghai 201403, China
5
Jiading District Agro-Technology Extension Center, Shanghai 201899, China
6
Pudong New Area Agro-Technology Extension Center, Shanghai 201201, China
7
Land and Environmental College, Shenyang Agricultural University, Shenyang 110866, China
8
Shanghai Jiao Tong University, Shanghai 200240, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Horticulturae 2025, 11(9), 1088; https://doi.org/10.3390/horticulturae11091088
Submission received: 8 June 2025 / Revised: 22 August 2025 / Accepted: 28 August 2025 / Published: 9 September 2025
(This article belongs to the Section Plant Pathology and Disease Management (PPDM))
Browse Figures
Versions Notes

Abstract

Fusarium wilt is a devastating soilborne disease that significantly reduces watermelon production worldwide. This disease is caused by Fusarium oxysporum subsp. niveum (E.F.Sm.) W.C. Snyder & H.N.Hansen. Earthworms can influence fungal populations either by consuming or dispersing fungal propagules, making them a promising candidate for the biological control of Fusarium wilt. However, the underlying mechanisms remain poorly understood. In this study, we investigated the effects of adding the local earthworm species Metaphire guillelmi (Michaelsen, 1895) on Fusarium wilt in watermelon under field conditions, laboratory pot experiments, and laboratory pot experiments with sterilized soil. The results demonstrated that, compared to the control, the earthworm addition reduced the population of F. oxysporum by approximately 105 copies/mg and suppressed the incidence of Fusarium wilt by 84.4%. A correlation analysis revealed that the abundance of F. oxysporum was negatively correlated with soil organic matter (SOM), available nitrogen (AN), and available phosphorus (AP). The relative interaction index values indicated that earthworms could enhance SOM and AN levels in the soil. A two-factor network relationship analysis showed that the earthworm addition could inhibit bacteria and fungi to stimulate growth of F. oxysporum while restraining them. A metabolomics analysis revealed that most differential metabolites associated with F. oxysporum were upregulated in the presence of earthworms. Overall, M. guillelmi can reduce the occurrence of Fusarium wilt by improving soil fertility, the relationship of F. oxysporum and microorganisms, and may influence the metabolic process, which need further exploration. It is a potential pathway for the biocontrol of Fusarium wilt.

1. Introduction

Watermelon is one of the most widely cultivated fruit crops worldwide. Among all fruit crops, watermelon ranks first globally in terms of cultivated area, with a total production of 104.9 million tonnes in 2023 [1]. China is the world’s largest producer of watermelons, contributing to approximately 67% of the global total output [2]. Continuous cropping practices disrupt the soil nutrient balance, deteriorate physical and chemical properties [3,4], and destabilize the microbial ecology by reducing beneficial bacterial populations and altering community structures [5,6,7,8]. Fusarium oxysporum subsp. Niveum (E.F.Sm) W.C. Snyder & H.N.Hansen, the causative agent of Fusarium wilt, is a major soil-borne disease affecting watermelon production worldwide. This pathogen accounts for 57% of continuous cropping obstacles, with typical infection rates of 10–20% and severe outbreaks reaching 80–90%, potentially causing total crop failure and threatening sustainable watermelon production [9,10,11]. Addressing soil-related challenges has thus become critical for watermelon cultivation. Current mitigation strategies include disease-resistant variety development [12,13], grafting techniques [14,15], agricultural management, chemical control, and microbial interventions [16,17,18,19,20,21]. While effective, these methods face limitations, such as prolonged implementation periods, secondary pollution from external inputs, and inconsistent control efficacy [22]. Microbial amendments, though promising, suffer from instability in the field conditions due to lack of suitable carriers or competition with native microbes [23]. Therefore, developing innovative biological approaches to regulate the soil health in watermelon systems holds significant research value [24]. Among such strategies, the introduction of earthworms represents a promising approach due to their multifunctional ecological roles. As a prominent soil macroorganism, earthworms have been documented to enhance soil physical and chemical properties, to stimulate nutrient cycling, and to modulate the structure and function of soil microbial communities. This makes them a promising solution for alleviating the soil continuous cropping barrier [24,25]. Presently, research on the earthworms’ role in addressing continuous cropping issues primarily concentrates on earthworm manure and earthworm compost. Metagenomic analyses of the intestinal bacterial flora of earthworms showed the presence of numerous bacteria species, generally belonging to Proteobacteria [26]. Cao et al. [27] discovered that in situ vermicomposting significantly enhances soil fertility and microbial diversity in tomato monocropping systems, effectively alleviating continuous cropping obstacles by increasing the beneficial microbial populations and reducing the abundance of pathogenic bacteria. The microorganisms within the earthworm compost, such as Lysinibacillus fusiformis C1, Bacillus megaterium C3, B. safensis VW3, Pseudomonas resinovorans VW4, Lysinibacillus sp. VW6, and Sphingobacterium daejeonense LV1, were identified as the key contributors to these inhibitory effects [28]. Earthworm composting has been shown to significantly decrease the incidence of Fusarium wilt in watermelons and tomatoes, while also improving the fruit quality [29,30]. Although the interaction between earthworms and fungi has garnered significant attention [31,32,33], the potential of using live earthworms to remediate the continuous cropping barrier soil remains largely unexplored. Drawing on the current body of knowledge, Fusarium spp. are intrinsically linked to plant residues throughout their life cycle, which likely facilitates their interaction with detrital food webs. As highlighted by Goncharov et al., the Fusarium species tend to be more favored as a food source compared to other soil fungi [34]. Moody et al. [35,36] discovered that earthworms, when given a choice, prefer to feed on early straw decomposers, which encompass Fusarium species, rather than lignin decomposers. They further posited that the consumption of the pathogenic Fusarium species by earthworms could serve as an effective strategy for controlling diseases in subsequent crops. For instance, when spores of F. laieritium Nees passed through the gut of Lumbricus terrestris L., they failed to germinate, and exposure to the intestinal fluids of L. terrestris was found to diminish the germination rate of F. laieritium spores. However, Brown et al. [37] contended that earthworms might selectively avoid certain Fusarium spp. that can excrete toxic or harmful substances detrimental to earthworms, a behavior that is contingent upon the specific species of both the fungus and the earthworm.
In light of these findings, we hypothesize that introducing live Metaphire guillelmi into continuous cropping systems may represent an effective biological strategy to mitigate Fusarium wilt by modulating soil properties, microbial communities, and pathogen metabolism. To test this hypothesis, we conducted a comprehensive study that integrated a field experiment, a laboratory pot experiment, and a laboratory pot experiment with sterilized soil. In this study, earthworms were introduced into the soil of continuous cropping watermelon plots, which is classified as fluvo-aquic soil under the Chinese Soil Taxonomy and has a loamy texture. Subsequently, we analyzed the soil physical and chemical properties, the structure of the soil bacterial community, and the presence of pathogenic bacteria both with and without the earthworms. The overarching aim was to elucidate the role of earthworms in repairing and enhancing the soil barrier in continuous cropping watermelon systems, thereby providing a valuable technical reference for the restoration of soil barriers in the continuous cropping of watermelon.

2. Materials and Methods

2.1. Experimental Site

The experimental site is situated within the Zhuanghang Comprehensive Test Base of the Shanghai Academy of Agricultural Sciences (30°53’40″ N, 121°23’30″ E). This location falls within the subtropical maritime monsoon climate zone, characterized by four distinct seasons. The average annual temperature stands at 17.1 °C. The annual average sunshine duration is 1919.8 h. The annual effective accumulated temperature is 5565.8 °C. The mean annual precipitation is approximately 1221.8 mm, with roughly 60% of the rainfall occurring during the flood season from May to September. The annual evaporation rate is 1338.2 mm. The average annual frost-free period lasts for 234 days.

2.2. Experimental Materials

2.2.1. Watermelon Varieties

The watermelon variety used in this study was the small-fruit-type Zaochunhongyu (Citrullus lanatus). This variety is moderately susceptible to F. oxysporum f. sp. niveum, making it suitable for evaluating soil-based disease suppression under continuous cropping conditions. The cultivation method was hanging vine cultivation, which is commonly used in greenhouse watermelon production to improve air circulation and to reduce soil contact, thereby influencing the incidence of soil-borne diseases, such as Fusarium wilt.

2.2.2. Earthworm Source

The earthworm variety used in the experiment was mature Metaphire guillelmi (2–3 g/individual), which was obtained from the Chongming experimental base of the Shanghai Academy of Agricultural Sciences.

2.2.3. Source of F. oxysporum

The pathogen used in the experiment was F. oxysporum, which was obtained from the plant pathology collection at the Resource Bank of the Institute of Ecological and Environmental Protection, Shanghai Academy of Agricultural Sciences.

2.3. Fertilizer Regime for Watermelon Continuous Cropping

The base fertilizers employed were potassium sulfate (with a K2O content of no less than 520.0 g/kg) and ternary compound fertilizer (with a nutrient ratio of N/P/K = 15:15:15 and a total nutrient content of at least 450.0 g/kg). Both were applied at a rate of 600.0 kg/hm2 prior to watermelon planting. Additionally, root-promoting and fruit-promoting fertilizers were applied at rates of 456.0 kg/hm2 for urea (which has a pure nitrogen content of no less than 464.0 g/kg) and 366.0 kg/hm2 for the ternary compound fertilizer, respectively. The base fertilizers were applied as a one-time basal application one week before transplanting. No additional fertilization was performed during the experiment. The urea was supplied by (Weinan, Shaanxi, China), the ternary compound fertilizer was manufactured by AZOMURES (Târgu Mureș, Romania), and the potassium sulfate was purchased from Heilongjiang United Petrochemical Co., Ltd. (Harbin, Heilongjiang, China; imported from Russia). These application rates were based on the fertilizer management guidelines for watermelon cultivation in Shanghai and for long-term fertilization practices at the experimental base. All treatments received the same fertilization regime.

2.4. Experimental Design

2.4.1. Positioning Experiment of Facility Community

The positioning experiment was conducted in a GSW8435 multispan greenhouse (32 m × 52 m), with an experimental area of 22 m2. To prevent the mutual infiltration of water and fertilizer, the experimental area was separated by a geomembrane (HDPE, 1.2 mm thick). The specific operating steps were as follows: deep ditches (10 cm wide and 80 cm deep) were dug around the community using an artificial deep trench pry, and the geomembranes were vertically inserted to a depth of 80 cm underground. The interfaces were welded using a hot-melt welding machine. The top of the geomembrane protruded 20 cm above the surface and was fixed by a cement beam (30 cm wide and 20 cm high). The bottom of the community was left open. Irrigation water was controlled by independent water meters in each community, and the water consumption of each community was kept the same during the watermelon growing season. The continuous positioning experiment of watermelon cropping in the facility began in 2014, and Fusarium wilt disease first appeared in 2016. After the watermelon harvest in November 2018, the continuous cropping watermelon soil with the earthworm addition experiment was initiated in the facility positioning experiment community. The experiment included two treatments: the earthworm group (EF) and the earthworm-free group (CF), with each treatment having three replicated plots. The specific scheme for the EF was to add earthworms at a ratio of 1 individual per kg of soil, based on the 0–20 cm topsoil, and to maintain soil moisture during the experiment to ensure the survival of the earthworms. The earthworm-to-soil ratio was calculated based on the soil bulk density and the volume of the 0–20 cm soil layer, which was consistent across all replicate plots. Soil samples for both treatment setup and analysis were collected uniformly from this depth. Fusarium wilt incidence (FWI) was assessed by visual observation. A plant was considered diseased if more than 50% of its leaves showed wilting or necrosis, and the incidence was calculated as the percentage of infected plants out of the total number of plants in each plot. The protocol referred to local watermelon planting with some changes for the experiment. The specific soil fertility indicators are representative in watermelon growth. They are key factors to watermelon growth. They were tested according to Lu [38]. Temperature and humidity were maintained consistent within the greenhouse environment throughout the experiment.

2.4.2. Laboratory Pot Experiment

A concurrent laboratory pot experiment and field experiment were conducted. A randomized complete block design was employed for all experiments to reduce the spatial variability. Soil samples were collected from the six communities detailed in Section 2.4.1, gently air-dried at room temperature to preserve microbial and chemical characteristics, then thoroughly homogenized and passed through a 2 mm mesh screen. Basin bowls, each with a diameter of 20 cm and a height of 30 cm, were utilized. Holes were carefully drilled into the sidewalls and bottoms of these bowls to ensure proper ventilation for earthworm respiration while preventing their escape. Subsequently, 10 kg of the prepared soil was added to each bowl, and two distinct treatments were established as follows: (1) the earthworm presence treatment (EP), with a ratio of 1 earthworm/kg soil; and (2) the control group (CP), devoid of earthworms. Watermelon seedlings exhibiting uniform growth were selected and transplanted into the test pots, with two plants per pot and six replicates for each treatment. Throughout the experiment, the soil moisture content was meticulously maintained at 40%, and the ambient air temperature was kept within the range of 25 °C to 30 °C, with a 12 h/12 h light–dark photoperiod to ensure environmental consistency.

2.4.3. Laboratory Pot with Sterilized Soil Test

In addition, the contaminated soil from the six communities mentioned in Section 2.4.1 was collected. The soil was air-dried and then screened to remove particles larger than 2 cm. Subsequently, the soil was sterilized in an oven at 120 °C for over 4 h, in accordance with the methods described by Razavi [39] and Trevors [40]. After sterilization, 3 kg of the sterilized soil was placed into each basin. No additional nutrients or non-pathogenic microbial inoculants were added after sterilization to allow for the assessment of earthworm effects in a microbiologically depleted soil environment. A watermelon-specific spore suspension of F. oxysporum (106 CFU/mL) was added at a rate of 1 mL suspension per kg of soil. The suspension was thoroughly mixed with the soil, and the soil moisture content was adjusted to 40% using sterile water. The soil was then left undisturbed for 15 days to allow the pathogen to stabilize for the pot soil sterilization test. Two experimental treatment groups were established in this experiment. The first group included earthworms at a ratio of 1 worm per kg of soil (ES). The earthworms were starved for 24 h to empty their intestinal contents, washed, and repeatedly sterilized with sterile water before being added to the soil. The second group served as the control and did not include earthworms (CS). Negative infection controls were not included in this experiment, as the primary objective was to compare the effects of the earthworm presence on Fusarium-infested soils. Each treatment had six replicates, and the pots were cultured in an artificial climate chamber at a constant temperature of 25 °C. The experimental design is illustrated in Figure 1.

2.5. Soil Sample Collection

In the field experiment, watermelon seedlings were transplanted on 5 April 2019. Soil samples (which will be described in detail by field in the following text) from the experimental plots were collected at three key stages of watermelon growth: the extension stage (E), the flowering stage (FL), and the fruiting stage (FR). For each treatment and at each growth stage, three composite soil samples were collected by pooling five subsamples taken randomly from the 0–20 cm soil layer in each plot. Each composite sample was then divided into two portions. One portion was stored in a refrigerator at −80 °C, from which soil DNA was extracted to assess the indicators of soil microorganisms and pathogens. The other portion was air-dried for the examination of the soil’s physical and chemical indicators. In April 2019, watermelon seedlings were transplanted into pots within a greenhouse. Soil samples, which will be referred to by pot number in the subsequent text, were collected at 15, 30, and 45 days post-transplantation. For each treatment and time point, one sample was collected from each replicate pot (six replicates in total), without compositing. The pot experiment concluded 60 days after the watermelon seedlings were transplanted, as the incidence rate of Fusarium wilt had reached 80% in the CP treatment. Each soil sample was divided into two portions. One portion was stored in a refrigerator at −80 °C for DNA extraction to assess the indicators related to soil microorganisms and pathogens. The other portion was air-dried for the analysis of the soil’s physical and chemical properties. Following the introduction of earthworms, fresh earthworm feces were collected in conjunction with the soil samples, both with and without earthworms (the latter referred to as sterilized soil in the subsequent text). Fresh earthworm feces were gathered daily from the earthworm-inhabited soil (considered as earthworm intestinal contents) and labeled as ESW, which were then stored in a refrigerator at −80 °C. After a 60-day period, soil samples with and without earthworms were collected and designated as ES and CS, respectively. DNA was extracted from both soil and earthworm feces samples to assess the indicators related to microorganisms, pathogens, and the metabolome. The physical and chemical properties of the soil were analyzed after air-drying.

2.6. Indicator Determination

2.6.1. Determination of Soil Fertility Indices

To elucidate the alterations in the soil micro-ecological environment and the population dynamics of F. oxysporum in watermelon continuous cropping soil following the introduction of earthworms, this study meticulously examined the fertility characteristics and the correlation between the quantity of F. oxysporum and the addition of the earthworms. The fertility indices of the soil and earthworm feces were assessed, encompassing a range of parameters. Soil organic matter (SOM) was determined via the potassium chromate oxidation method, with digestion performed using a DF-101T constant-temperature heating digester (Lichenbangxi Instrument Technology Co., Ltd., Shanghai, China). Total nitrogen (TN) was measured using the Kjeldahl distillation method using a KDN-08C Kjeldahl nitrogen analyzer (Xinrui Chemical Technology Co., Ltd., Shanghai, China). Total phosphorus (TP) and available phosphorus (AP) were determined by the sodium carbonate melting method and the molybdenum blue colorimetric method, respectively, with absorbance measured using a TU-1901 dual-beam UV-visible spectrophotometer (Purkinje General Instrument Co., Ltd., China). Total potassium (TK) was evaluated via the sodium hydroxide alkali melting method and quantified using a flame photometer (FP6450, INESA Electronics (Group) Co., Ltd., China). Available nitrogen (AN) was detected using the alkaline diffusion method. The pH of the soil and the earthworm feces was measured using a pH meter (FE20, Mettler Toledo GmbH, Switzerland). All methodologies were carried out in accordance with the procedures described by Lu [38]. The initial soil fertility is shown as follows: SOM = 16.00 g/kg; TN = 1.73 g/kg; TP = 1.60 g/kg; TK = 1.50 g/kg; AN = 107.41 g/kg; AP = 31.74 g/kg; AK = 80.00 g/kg; pH = 6.92.

2.6.2. Microbial Community Determination

The soil and earthworm feces samples were promptly refrigerated using dry ice and then dispatched to Shanghai Lingen Biotechnology Co. Ltd. for Illumina (PE250) high-throughput sequencing. For the bacterial analysis, the 16S rDNA amplification primer targeting the V4–V5 region was employed, specifically the primer pair 515F–907R. Meanwhile, the 18S rDNA amplification primer for fungi was carefully selected from the ITS1–ITS2 region. DNA extraction and PCR amplification were performed in technical triplicates. Negative extraction and no-template PCR controls were included to monitor contamination. Sequence quality was assessed using Q30 scores, and samples with sequencing depth below 20,000 reads were excluded. Operational taxonomic units (OTUs) were assigned using a 97% similarity cutoff. A rarefaction analysis confirmed sequencing depth saturation.

2.6.3. Quantity Determination of F. oxysporum

The fluorescence quantitative PCR method was employed to determine the absolute quantity of F. oxysporum watermelon specialized type in the soil samples. The specific procedures were as follows: 1.0 g of fresh soil samples from each treatment was accurately weighed. Subsequently, the TIANGEN Catalog DP336-2 soil genomic DNA extraction kit (provided by Tiangen Biochemical Technology (Beijing) Co., Ltd.) was utilized to extract the total microbial DNA from the soil samples for three times, strictly following the operational steps outlined in the manual. The primers required for amplification were the F. oxysporum watermelon specific primers: Fon-1/Fon-2 (5′-3′): CGATTAGGAAGATATCACAAGACT/ACGGTCAAGATGCAGGTAAAGGT. The fluorescence quantitative PCR amplification reaction system is as follows: a total volume of 20 μL, which includes 2 μL of DNA template, 0.5 μL of Fon-1 primer, 0.5 μL of Fon-2 primer, 10 μL of SYBR Premium Ex Taq™ (Takara Bioengineering Co., Ltd.) mixture, and 7 μL of ddH2O. The process was replicated three times. The reaction procedure is as follows: initial denaturation at 95 °C for 2 min, followed by 40 cycles of denaturation at 94 °C for 15 s, annealing at 58 °C for 15 s, and extension at 72 °C for 10 s. The metabolomic profiles of the soil and earthworm feces were characterized using untargeted metabolomics via ultra-high performance liquid chromatography coupled with tandem mass spectrometry (UHPLC-MS/MS). A Thermo Vanquish UHPLC system coupled with a Q Exactive Orbitrap mass spectrometer (Thermo Fisher Scientific, USA) was used for data acquisition. Raw mass spectrometry data were processed using the XCMS platform, including peak detection, alignment, retention time correction, and data normalization. Supervised partial least squares discriminant analysis (PLS-DA) clustering was employed to discern distinct patterns. Compounds that significantly contributed to the classification were identified based on a variable importance in projection (VIP) value exceeding 1. Statistical significance was further assessed using Student’s t-test (p < 0.05). Metabolites were annotated against the Kyoto Encyclopedia of Genes and Genomes (KEGG). Furthermore, a biological pathway enrichment analysis was conducted utilizing MetaboAnalyst 4.0, with a screening threshold set at 0.1, as per the methodology outlined by Swenson and Northen [41]. Detection limits and calibration procedures followed the manufacturer guidelines as per the SYBR qPCR kit (Takara Bioengineering Co., Ltd.) and UHPLC-MS/MS instrument protocols.

2.7. Data Processing and Analysis

The results are presented as mean ± SD. The Shapiro–Wilk test was conducted to verify the normality of the data distribution. Subsequently, t-tests were employed to assess the significance of differences in indicators between the control and treatment groups. Significance was set to p < 0.05. Additionally, the correlation between the abundance of F. oxysporum and the soil physicochemical indicators was examined using a Spearman correlation analysis. All these analyses were performed using SPSS 19.0. The relative interaction index (RII) was employed to assess the direction and magnitude of the impact of the earthworms on various soil physical and chemical properties, as well as the population of F. oxysporum. This index offers a means to compare the RII of the earthworm-added treatment with that of the control treatment devoid of earthworms, thereby determining whether the RII in the earthworm-added treatment is relatively high or low. The formula utilized for the calculation is as follows:
RII trait = (Yearthworm − Ynon-earthworm)/(Yearthworm + Ynon-earthworm).
where Yearthworm is the physical and chemical indicator value or the number of F. oxysporum in the treatment with earthworms and Ynon-earthworm is the physical and chemical indicator value or the number of F. oxysporum in the control without earthworms.
RII was calculated by Microsoft Excel 2016. The figures were plotted by Microsoft Excel 2016.
In the two factor network analysis, F. oxysporum was treated as an environmental factor, and a correlation analysis was conducted with all selected bacteria or fungi. The network relationship between the pathogen and other microorganisms was analyzed. Pathogens and other microorganisms are mutual factors.

3. Results

3.1. Effects of Earthworm on the Occurrence of Fusarium Wilt and Number of F. oxysporum in Continuous Cropping of Watermelon Soil

As depicted in Figure 2A, the incidence rate of Fusarium wilt in the CF treatment increased by 3.9 times from the extension period to the fruiting period. However, in the EF treatment, the significant rise was only 28.9% from the extension period to the flowering period, followed by an increase of 12.5% from the flowering period to the fruiting period. The addition of earthworms significantly reduced the incidence rate of Fusarium wilt by 36.0% (p < 0.05) at the flowering stage and by 63.3% (p < 0.05) at the fruiting stage. Similarly, Figure 2B illustrates that the incidence rate of Fusarium wilt in the CP treatment continued to rise by 24.7 times from day 15 to day 45. By contrast, in the EP treatment, the increase was only observed from day 15 to day 30 by 19.3 times, with only 6.8% in the incidence rate from day 30 to day 45. The pot experiment also demonstrated that the incidence rate of watermelon Fusarium wilt was effectively inhibited by the addition of earthworms. Specifically, the incidence rate in watermelon was significantly lowered by 43.4% (p < 0.05) at 15 days and by 84.4% (p < 0.05) at 45 days. Specifically, this difference was statistically significant in both the potted soil (p < 0.05) and the sterilized soil (p < 0.05, Figure 3). The findings revealed that, across all three experimental conditions, the soil samples containing earthworms exhibited significantly lower Fusarium wilt incidence of watermelon or number of F. oxysporum compared to the earthworm-free soil samples.

3.2. Impact Directions of Earthworm on the Number of F. oxysporum and Soil Fertility Indicators

Comparing the treatments with and without living earthworm, the findings revealed that, under both pot and sterilization experimental conditions, the presence of earthworms exerted a significant inhibitory effect on the proliferation of F. oxysporum, with effect values of −0.400 and −0.545, respectively (p < 0.05). Moreover, across all three experimental settings, the incorporation of earthworms was found to be highly beneficial in significantly augmenting SOM levels (p < 0.05). In the field experiment, the addition of earthworms led to notable enhancements in pH and TK content, while simultaneously causing a significant reduction in the AN (p < 0.05). In the indoor pot experiment, the introduction of earthworms resulted in substantial increases in the AK, AP, and TP, albeit with a significant decline in the soil pH (p < 0.05). Additionally, in the indoor sterilization pot experiment, the presence of earthworms contributed to marked increases in the AK and AN, but concurrently led to significant decreases in the soil pH, TK, and TP (p < 0.05). The addition of earthworms enhances the SOM and reduces the number of F. oxysporum in the three culture conditions. But the fertility indicators are different among the three experiments (Figure 4).

3.3. Relationship Between Soil Fertility Indicators and Number of F. oxysporum

As shown in Table 1, in the pot experiment, a significantly negative correlation was observed between the SOM and the number of F. oxysporum (R = −0.922, p< 0.01), while the pH exhibited a significantly positive correlation with the number of F. oxysporum (R = 0.969, p < 0.01). In the sterilization experiment, the number of F. oxysporum was significantly negatively correlated with the AN (R = −0.917, p < 0.05). However, no indicator was correlated in the field condition with more influence factors.

3.4. Effects of Earthworm on Microbial Diversity in Continuous Cropping Soil

The alpha diversity indices (Chao1, Shannon, and Simpson) of both the bacterial and fungal communities under different treatments are summarized in Table 2 and Table 3.
In the Field group, bacterial diversity showed a significant reduction in the Chao1 and Simpson indices in the EF treatment compared to CF (p = 0.037 and 0.044, respectively), while the Shannon index showed a marginal decrease (p = 0.051). By contrast, the fungal communities exhibited no significant differences in the Chao1 and Shannon indices (p > 0.1), but the Simpson index was slightly higher in EF than in CF (p = 0.048).
In the Pot group, bacterial diversity did not differ significantly between CP and EP in any of the indices (p > 0.1). However, for fungi, the EP group had a significantly higher richness (Chao1 index, p = 0.011) compared to CP, while changes in the Shannon and Simpson indices remained non-significant.
In the Sterilization group, the bacterial communities showed significant decreases in both the Chao1 and Shannon indices in the ES treatment (p = 0.025 and 0.015), with no significant change in the Simpson index. For the fungal communities, none of the indices showed statistically significant differences between CS and ES, although slight increases were observed in the ES group.
To further evaluate the structural differences in the microbial communities under different treatments, a Principal Coordinates Analysis (PCoA) based on Bray–Curtis distances at the OTU level was conducted for both the bacterial and the fungal communities (Figure 5). By contrast, no evident separation was observed between the CP and EP groups, suggesting a limited impact of the earthworms on the bacterial composition in the pot soil. For the fungal communities (ITS), distinct clustering was found only between the CF and EF groups, while the CP and EP, as well as the CS and ES groups, showed considerable overlap, indicating that fungal β-diversity was primarily affected in the field soil. These results demonstrate that the earthworm intervention had a differential influence on microbial β-diversity, with stronger effects on the bacterial communities and context-dependent responses across the soil types.

3.5. Effects of Earthworm on the Correlation Between Soil Microorganisms and F. oxysporum

Based on the two-factor network relationship analysis between the top 500 soil fungal species and the abundance of F. oxysporum, 37 fungal genera were significantly correlated with the abundance of F. oxysporum (p < 0.05). Specifically, in the groups without earthworms, 6 genera were positively correlated with F. oxysporum, while 31 genera were negatively correlated with F. oxysporum (Figure A1A). By contrast, in the earthworm addition groups, 33 fungal genera were significantly correlated with the abundance of F. oxysporum (p < 0.05), with only 1 genus positively correlated and 32 genera negatively correlated with F. oxysporum (Figure A1B).
Similarly, a two-factor network relationship analysis was conducted between the top 500 soil bacterial genera and the abundance of F. oxysporum. The results revealed that, in the groups without earthworms, 216 bacterial genera were significantly correlated with the abundance of F. oxysporum (p < 0.05), of which 46 genera were positively correlated and 170 genera were negatively correlated with F. oxysporum (Figure A1C). In the earthworm addition groups, 203 bacterial genera were significantly correlated with the abundance of F. oxysporum (p < 0.05), with 16 genera positively correlated and 187 genera negatively correlated with F. oxysporum (Figure A1D).
In all, earthworms enhance the microorganism negatively correlated with F. oxysporum and suppress the microorganism positively correlated with F. oxysporum. It shows potential to restrain the growth of F. oxysporum by restructuring the composition of the soil microorganism.

3.6. Effects of Earthworm on the Changes of Metabolome of F. oxysporum in the Eco-Environment

In order to delve deeper into the alterations in the eco-environmental metabolism process of the watermelon Fusarium wilt pathogen following the introduction of earthworms, the metabolomics of F. oxysporum were examined after it had been acted upon by either the earthworm intestinal tract or the secretions from the earthworm body surface. As revealed by the PLS-DA analysis (Figure 6), there were significant differences in the metabolomic data of F. oxysporum between the CS and ES groups, as well as between the CS and ESW groups (p < 0.05). This indicated a distinct separation of metabolic profiles in each group. In the analysis of the 233 detected metabolites, a total of 7 differential metabolites were identified between the ESW and CS groups (p < 0.05, VIP > 1, Table 4). Specifically, the levels of indole, octanoic acid, hard amine, palmitamide, diphthalate, and dipentyl ester were significantly upregulated in the ESW group, while the level of oleic acid was downregulated. When comparing the ES and CS groups, nine differential metabolites were screened out (p < 0.05, VIP > 1, Table 5). In the ES group, the contents of barbituric acid, mannitol, di(2-ethylhexyl) phthalate, palmitamide, methyl methacrylate, and 2-dodecylbenzenesulfonic acid were upregulated. Conversely, the contents of imine, myristyl sulfate, and 4-undecylbenzenesulfonic acid were downregulated. The results imply that the addition of earthworms brought about changes to the metabolome of F. oxysporum which may influence the growth of F. oxysporum.

4. Discussion

In this study, there are several differences in the physical and chemical indicators between the potted and field experiment. Montesinos [42] pointed out that pot experiments are excellent for detecting the subtle differences in plant responses to highly controlled factors, but they do not always accurately reflect the reactions of plants in more complex and variable natural habitats. Field experiments allow for the manipulation and control of a limited number of factors under real natural conditions. However, since most environmental conditions are not accounted for, the results are difficult to replicate. The high incidence of watermelon Fusarium wilt is often associated with a higher density of F. oxysporum in the soil [42]. In this experiment, the addition of the earthworm M. guillelmi was associated with a lower incidence rate of Fusarium wilt and a reduced number of F. oxysporum under three experimental conditions. (Figure 2 and Figure 3). However, it is important to note that the ecological functions of earthworms can vary substantially depending on their ecological category (epigeic, endogeic, or anecic), species traits, and environmental context. Additionally, M. guillelmi has been found to mitigate the occurrence of Fusarium wilt in strawberries [43]. This can be attributed to the fact that earthworms can directly suppress fungal pathogens through selective feeding and by preventing the spread of fungal spores [32,44,45]. A meta-analysis of the experimental study has shown that, among soil fungi, earthworms prefer to feed on Fusarium species as a food source [33]. Besides direct action, vermicomposting from earthworms and its extracts, such as coelomic fluid, skin secretions, and vermiwash, also exhibit antifungal activities [46]. Moreover, earthworms can inhibit the occurrence of watermelon Fusarium wilt by enhancing the soil fertility. A negative correlation was observed between the SOM, AN, and AP and the number of F. oxysporum (Table 4). Soil fertility and the nutrient status of the host plant can influence the host’s susceptibility to pathogens and its resistance to disease [47]. In this study, the addition of earthworms consistently increased the SOM under all three experimental conditions (Figure 4), indicating an increase in nutrient supply. Sufficient nutrients can promote root growth, compensate for tissue loss, and stimulate the production of inhibitory compounds that are general substances for disease resistance, and can respond rapidly to pathogen invasion [48,49]. As a result, the infection of roots by F. oxysporum is inhibited, and the occurrence of Fusarium wilt in watermelons is reduced. A limitation of nitrogen can impair the ability of plants and microorganisms to resist F. oxysporum [42]. The AN was enhanced by the earthworm addition in the sterilized soil (Figure 4), which is conducive to building the defenses against the invading pathogens for watermelons. By contrast, the AN decreased with the addition of earthworms in the field and laboratory pot experiments (Figure 4), possibly due to the greater nitrogen uptake by the healthier watermelon plants. This suggests that both increased and decreased AN reflect positive responses: either improved soil fertility or efficient nutrient utilization by vigorous plants.
For bacterial communities (16S rRNA), clear separations were observed between the CF and EF groups and between the CS and ES groups, indicating that the earthworm addition significantly altered the bacterial community structure in both the field and sterilized soils. A notable characteristic change of continuous cropping soil is the decrease in the microbial community diversity [50]. It is widely accepted that earthworms can enhance the diversity of microorganisms in continuous cropping soil [25,51,52]. Meanwhile, the relationship between microorganisms and pathogens is a key factor in the occurrence of continuous cropping disturbance [53]. Therefore, improving the soil microbial community structure and the relationship between microorganisms and pathogens is crucial to alleviate continuous cropping disturbance. The number of bacterial and fungal genera that promote the growth of F. oxysporum decreased, while the number of those with inhibitory effects increased in the treatments with the earthworm addition (Appendix A), indicating that earthworms can improve the relationship between the soil microbial community and the pathogenic bacteria [54]. Moreover, long-term continuous cropping often causes soil acidification [55], which alters the microbial community structure by reducing bacterial diversity and increasing fungal dominance, thereby promoting soil-borne pathogen proliferation and disease outbreaks [56], so soil pH is a primary driver of soil microbial community dynamics. Recent studies have shown that changes in pH significantly affect bacterial community composition and diversity, often more strongly than fungal communities [57], A long-term liming experiment spanning a pH gradient from 4 to 8 revealed that bacterial α-diversity nearly doubled with the increasing pH, while the fungal community composition remained relatively stable [58]. So the soil pH increased with the earthworm addition in the field experiment (Figure 4), and we observed a decrease in the occurrence of Fusarium wilt in the treatments with the earthworm addition. However, we did not find a pH increase in the two pot experiments, possibly due to the limited soil buffering capacity, smaller soil volume, or shorter experimental duration, which may have constrained the pH-modifying effects of the earthworms [59].
We employed a metabolomic analysis to investigate the effects of the earthworm treatment on the pathogens. Besides the soil fertility and microbial composition shaped by the earthworms, we discovered that the metabolites of the pathogens underwent changes after the earthworm treatment. To elucidate the role of the metabolites in the physiological activity of F. oxysporum, we further analyzed the enriched metabolic pathways. These included the biosynthesis of benzoxazine compounds, the biosynthesis of phenylalanine, tyrosine, and tryptophan, the biosynthesis of cutin, subcutin, and wax, protein digestion and absorption, and tryptophan metabolism. These metabolic pathways are closely associated with the metabolic activity of F. oxysporum in its life cycle and the pathogenic process, particularly the accumulation produced during the infection of plants, including the synthesis of phytotoxic secondary metabolites, cell wall components for host penetration, and signaling molecules essential for host colonization. The upregulation of the differential metabolites suggests that the metabolic pathway process may be influenced. The possible influence of these pathways by the earthworm-mediated changes may impair hyphal development, reduce spore germination efficiency, and ultimately weaken the pathogen’s ability to invade host tissues. These findings suggest that the earthworm treatment may influence the metabolic process of F. oxysporum, although the specific regulatory mechanisms remain to be elucidated. This regulation restricts the activity and infectivity of F. oxysporum, and may ultimately inhibit its potential negative impact on watermelon Fusarium wilt disease. Since there is no direct evidence of the metabolomic change of F. oxysporum by the earthworm addition, our preliminary findings suggest the need for more exploration studies to reveal the mechanism behind it. Although there are few direct studies on the earthworm’s effects on the F. oxysporum metabolism, Zhou et al. [60] found that there are multi-energy metabolic mechanisms of F. oxysporum under low-oxygen conditions, including denitrification and ammonia fermentation. These metabolic pathways may be related to the micro-environmental conditions created by earthworms in the soil, thereby indirectly affecting the metabolism of F. oxysporum. It is worth noting that, while earthworms have shown a potential to improve soil health and reduce F. oxysporum abundance, their ecological impacts may vary depending on the species, soil types, and environmental conditions. Some studies have reported that earthworm activity could also mobilize heavy metals or alter nutrient balances, which may pose risks under certain scenarios. Moreover, this study was conducted under controlled conditions during a single growing season, and only one earthworm species and one fungal strain were tested. These factors may limit the generalizability of the results, and future research should explore a wider range of ecological contexts and longer-term impacts.

5. Conclusions

In this study, we found that the earthworm M. guillelmi can reduce the number of F. oxysporum spores and the incidence of watermelon Fusarium wilt symptoms. In both field and pot conditions, the addition of earthworms improved soil fertility and microorganism structure that were found to limit the metabolic development of F. oxysporum. This study provides the basis for establishing environmentally friendly measures to promote the sustainable development of watermelon plantations; however, because of the complexity of soil environment, these results need further verification.

Author Contributions

X.Z. (Xianqing Zheng) and W.L. planned and designed the research. K.S. and X.L. performed the experiments, P.L., Y.Y. and L.Y. conducted the field work and sampling. D.L. performed the validation. Y.L. and Y.Z. analyzed the data. X.Z. (Xin Zhao) and L.Z. wrote the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research is funded by Shanghai Agricultural Science and Technology Innovation Project (2023-02-08-00-12-F04577), Shanghai’s 2023 “Science and Technology Innovation Action Plan” Domestic Science and Technology Cooperation Projects (23015820900), National Agricultural Experimental Station for Agricultural Environment, Fengxian (Grant number: NAES035AE03) and The Outstanding Team Program of the Shanghai Academy of Agricultural Science [Grant number: Hu-Nong-Ke-Zhuo 2022 (008)].

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors on request.

Conflicts of Interest

The authors declare no conflicts of interest.

Appendix A

Horticulturae 11 01088 g0a1
Figure A1. Two-factor correlation network analysis (p < 0.05): (A) correlation network between F. oxysporum and fungi genus in groups without earthworms; (B) correlation network between F. oxysporum and fungi genus in groups with earthworms; (C) correlation network between F. oxysporum and bacteria genus in groups without earthworms; (D) correlation network between F. oxysporum and bacteria genus in groups with earthworms. The size of the nodes stands for the abundance of genus, and the line colors represent positive (red) or negative (green) correlations.
Figure A1. Two-factor correlation network analysis (p < 0.05): (A) correlation network between F. oxysporum and fungi genus in groups without earthworms; (B) correlation network between F. oxysporum and fungi genus in groups with earthworms; (C) correlation network between F. oxysporum and bacteria genus in groups without earthworms; (D) correlation network between F. oxysporum and bacteria genus in groups with earthworms. The size of the nodes stands for the abundance of genus, and the line colors represent positive (red) or negative (green) correlations.
Horticulturae 11 01088 g0a1

References

  1. FAO. Area and Production of Watermelon. 2023. Available online: http://www.fao.org/faostat/en/#data/QCL (accessed on 26 August 2023).
  2. Zamuz, S.; Munekata, P.E.S.; Gullón, B.; Rocchetti, G.; Montesano, D.; Lorenzo, J.M. Citrullus lanatus as source of bioactive components: An up-to-date review. Trends Food Sci. Technol. 2021, 111, 208–222. [Google Scholar] [CrossRef]
  3. Zhang, P.P.; Xia, L.H.; Sun, Y.T.; Gao, S. Soil nutrients and enzyme activities based on millet continuous cropping obstacles. Sci. Rep. 2024, 14, 17329. [Google Scholar] [CrossRef]
  4. Berendsen, R.L.; Vismans, G.; Yu, K.; Song, Y.; Jonge, R.D.; Burgman, W.P.; Burmølle, M.; Herschend, J.; Bakker, P.A.H.M.; Pieterse, C.M.J. Disease-induced assemblage of a plant-beneficial bacterial consortium. ISME J. 2018, 12, 1496–1507. [Google Scholar] [CrossRef]
  5. Chen, S.; Qi, G.; Luo, T.; Zhang, H.; Jiang, Q.; Wang, R.; Zhao, X. Continuous-cropping tobacco caused variance of chemical properties and structure of bacterial network in soils. Land Degrad. Dev. 2018, 29, 4106–4120. [Google Scholar] [CrossRef]
  6. Chen, J.; Yang, X.; Zhong, D.; Huo, Z.; Sun, R.; Dong, H. Continuous Cropping Alters Soil Microbial Community Assembly and Co-Occurrence Network Complexity in Arid Cotton Fields. Agriculture 2025, 15, 1274. [Google Scholar] [CrossRef]
  7. Xiong, W.; Zhao, Q.; Zhao, J.; Xu, W.; Li, R.; Zhang, R.; Wu, H.; Shen, Q. Different continuous cropping spans significantly affect microbial community membership and structure in a vanilla-grown soil as revealed by deep Pyrosequencing. Microb. Ecol. 2015, 70, 209–218. [Google Scholar] [CrossRef] [PubMed]
  8. Guo, L.; Chen, X.; Li, Z.; Wang, M.; Che, Y.; Zhang, L.; Jiang, Z.; Jie, S. Effects of continuous cropping on bacterial community and diversity in rhizosphere soil of industrial hemp: A five-year experiment. Diversity 2022, 14, 250. [Google Scholar] [CrossRef]
  9. Wei, Z.; Wang, J.; Jiang, F.; Wang, X.; Xu, Y.; Shen, Q. Survival-virulence trade-off of soil-borne pathogenic bacteria. Acta Pedol. Sin. 2021, 59, 324–333, (In Chinses with English Abstract). [Google Scholar]
  10. Rahman, M.Z.; Ahmad, K.; Kutawa, A.B.; Siddiqui, Y.; Saad, N.; Geok Hun, T.; Hata, E.M.; Hossain, M.I. Biology, diversity, detection and management of Fusarium oxysporum f. sp. niveum causing vascular wilt disease of watermelon (Citrullus lanatus): A review. Agronomy 2021, 11, 1310. [Google Scholar]
  11. Ji, W.L.; Zhu, H.; Lu, X.; Zhao, S.; Liu, W. The mechanism of resistance to Fusarium oxysporum f. sp. nveum race 1 in tetraploid watermelon. Sci. Agric. Sin. 2018, 51, 3750–3765, (In Chinses with English Abstract). [Google Scholar]
  12. Biswas, A.; Wechter, P.; Ganaparthi, V.; Jarquin, D.; Kousik, S.; Graham, S.; Levi, A. Comparative genomic prediction of resistance to Fusarium wilt (Fusarium oxysporum f. sp. niveum race 2) in watermelon: Parametric and nonparametric approaches. Theor. Appl. Genet. 2025, 138, 35. [Google Scholar] [CrossRef] [PubMed]
  13. Tong, Y.Y.; Du, H.S.; Xiao, J.; Zhou, B.C.; Zheng, X.J.; Deng, Y.W.; Zheng, X.Q.; Chen, M. Watermelon wilt disease: Causes, harms, and control measures. Front. Microbiol. 2025, 16, 1601130. [Google Scholar] [CrossRef] [PubMed]
  14. Devi, P.; Tymon, L.; Keinath, A.; Miles, C. Progress in grafting watermelon to manage Verticillium wilt. Plant Pathol. 2021, 70, 13344. [Google Scholar] [CrossRef]
  15. Zhou, X.; Guo, B.; Zhang, R.; Zhou, L.; Huang, X.; Liu, L. Investigating Changes in the Soil Fungal Community Structure, Functions, and Network Stability with Prolonged Grafted Watermelon Cultivation. Horticulturae 2024, 10, 971. [Google Scholar] [CrossRef]
  16. Lv, H.F.; Yan, C.S. Effects of wheat intercropping on growth and occurrence of Fusarium wilt in watermelon. PeerJ 2024, 12, e17587. [Google Scholar] [CrossRef]
  17. Wang, K.H. Analysis of obstacles and overcoming measures of continuous watermelon cropping. China Fruit Veg. 2019, 39, 64–66, (In Chinses with English Abstract). [Google Scholar]
  18. Everts, K.L.; Egel, D.S.; Langston, D.; Zhou, X.-G. Chemical management of Fusarium wilt of watermelon. Crop Prot. 2014, 66, 114–119. [Google Scholar] [CrossRef]
  19. Ling, N.; Xue, C.; Huang, Q.; Yang, X.; Xu, Y.; Shen, Q. Development of a mode of application of bioorganic fertilizer for improving the biocontrol efficacy to Fusarium wilt. Biocontrol 2010, 55, 673–683. [Google Scholar] [CrossRef]
  20. Li, Z.; Ma, J.; Li, J.; Chen, Y.; Xie, Z.; Tian, Y.; Su, X.; Tian, T.; Shen, T. A Biocontrol Strain of Serratia plymuthica MM Promotes Growth and Controls Fusarium wilt in Watermelon. Agronomy 2023, 13, 2437. [Google Scholar] [CrossRef]
  21. Zhang, Y.; Tian, C.; Xiao, J.L.; Wei, L.; Tian, Y.; Liang, Z.H. Soil inoculation of Trichoderma asperellum M45a regulates rhizosphere microbes and triggers watermelon resistance to Fusarium wilt. AMB Express 2020, 10, 189. [Google Scholar] [CrossRef]
  22. Pang, B.W.; Li, Y.M.; Xu, K.L.; Fan, M.P. Research progress on effects of vermicompost on soil health and crop growth. Jiangsu Agric. Sci. 2020, 48, 29–35, (In Chinses with English Abstract). [Google Scholar]
  23. Batista, B.D.; Singh, B.K. Realities and hopes in the application of microbial tools in agriculture. Microb. Biotechnol. 2021, 14, 1258–1268. [Google Scholar] [CrossRef] [PubMed]
  24. Zhang, H.; Hua, Z.W.; Liang, W.Z.; Niu, Q.H.; Wang, X. The Prevention of Bio-Organic Fertilizer Fermented from Cow Manure Compost by Bacillus sp. XG-1 on Watermelon Continuous Cropping Barrier. Int. J. Environ. Res. Public Health 2020, 17, 5714. [Google Scholar] [CrossRef]
  25. Rodríguez, M.P.; Domínguez, A.; Gabbarini, L.A.; Escudero, H.J.; Wall, L.G.; Bedano, J.C. Earthworms mediate the effect of diversifying crop rotations on soil organic carbon incorporation, soil structure formation and microbial activity. Agric. Ecosyst. Environ. 2025, 391, 109751. [Google Scholar] [CrossRef]
  26. Singh, A.; Singh, D.P.; Tiwari, R.; Kumar, K.; Singh, R.V.; Singh, S.; Prasanna, R.; Saxena, A.K.; Nain, L. Taxonomic and functional annotation of gut bacterial communities of Eisenia foetida and Perionyx excavatus. Microbiol. Res. 2015, 175, 48–56. [Google Scholar] [CrossRef] [PubMed]
  27. Cao, Y.E.; Yin, C.; Wu, Z.S.; Zhang, M.J.; Li, J.S.; Tian, Y.Q. Studies on in-situ vermicomposting in enhancing soil quality in a continuous monocropping of tomato. J. Plant Nutr. Fertil. 2022, 28, 247–259. [Google Scholar]
  28. Bai, Y.C.; Zhou, X.F.; Zhao, R.X.; Xue, R.X.; Zhou, G.G.; Qiao, X.Q. Solving successive cropping problems with the application of warm cast substrates in watermelon cultivation. Chin. Agric. Sci. Bull. 2011, 27, 212–216, (In Chinese with English Abstract). [Google Scholar]
  29. Wang, Y.F.; Wang, C.C.; Wu, Z. Effects of sheep and earthworm manure on the agronomic traits and quality of tomato. North. Hortic. 2020, 51–55, (In Chinese with English Abstract). [Google Scholar]
  30. Wang, S.Q.; Xu, H.L.; Sun, C.X.; Li, X.H.; Chen, Z.H.; Jiang, N.; Zhang, Y.L. Effects of mushroom-residue vermicompost on soil physicochemical properties and bacterial diversity in strawberry cultivation. J. Jiangsu Agric. Sci. 2023, 51, 218–230. [Google Scholar]
  31. Bonkowski, M.; Griffiths, B.S.; Ritz, K. Food preferences of earthworms for soil fungi. Pedobiologia 2000, 44, 666–676. [Google Scholar] [CrossRef]
  32. Byzov, B.A.; Khomyakov, N.V.; Kharin, S.A.; Kurakov, A.V. Fate of soil bacteria and fungi in the gut of earthworms. Eur. J. Soil Biol. 2007, 43 (Suppl 1), S149–S156. [Google Scholar] [CrossRef]
  33. Plavšin, I.; Velki, M.; Ečimović, S.; Vrandečić, K.; Ćosić, J. Inhibitory effect of earthworm coelomic fluid on growth of the plant parasitic fungus Fusarium oxysporum. Eur. J. Soil Biol. 2017, 78, 1–6. [Google Scholar] [CrossRef]
  34. Goncharov, A.A.; Glebova, A.A.; Tiunov, A.V. Trophic interactions between Fusarium species and Soil fauna: A meta anaysis of experiment studies. Appl. Soil Ecol. 2020, 145, 103302. [Google Scholar] [CrossRef]
  35. Moody, S.A.; Briones, M.J.I.; Piearce, T.G.; Dighton, J. Selective consumption of decompsing wheat straw by earthworms. Soil Biol. Biochem. 1995, 27, 1209–1213. [Google Scholar] [CrossRef]
  36. Moody, S.A.; Piearce, T.G.; Dighton, J. Fate of some fungal spores asscociated with wheat straw decomposition on passage through the guts of Lumbricus terrestris and Aporrectodea Longa. Soil Biol. Biochem. 1996, 28, 533–537. [Google Scholar] [CrossRef]
  37. Brown, G.G.; Barois, I.; Lavelle, P. Regulation of sol organic matter dynamics and microbial activity in the drilosphere and role of interactions with other edaphic functional domains. Eur. J. Soil Biol. 1995, 36, 177–198. [Google Scholar] [CrossRef]
  38. Lu, R.K. Soil Agrochemical Analysis Methods; China Agricultural Science and Technology Press: Beijing, China, 2000. [Google Scholar]
  39. Razavi, D.S. Evaluation of chemical and biological consequences of soil sterilization methods. Casp. J. Environ. Sci. 2007, 5, 87–91. [Google Scholar]
  40. Trevors, J.T. Sterilization and inhibition of microbial activity in soil. J. Microbiol. Methods 1996, 26, 53–59. [Google Scholar] [CrossRef]
  41. Swenson, T.L.; Northen, T.R. Untargeted Soil metabolomics using liquid chromatography–mass spectrometry and gas chromatography–mass spectrometry. In Methods and Protocols; Springer: New York, NY, USA, 2019; pp. 97–109. [Google Scholar]
  42. Montesinos, D. Trade-offs involved in the choice of pot vs field experiments. New Phycol. 2025, 245, 1808–1809. [Google Scholar] [CrossRef] [PubMed]
  43. Tong, Y.; Wang, L.; Wu, C.; Zhang, H.; Deng, Y.; Chen, M.; Zheng, X.; Lv, W.; Chen, J.; Ge, T. Promotion of the symbiotic interaction between phagotrophcic protists and beneficial bacteria, mediated via a balancing of soil nutrients, reduces the incidence of watermelon Fusarium wilt. Pedosphere 2025, 35, 352–363. [Google Scholar] [CrossRef]
  44. Bi, Y.M.; Tian, G.L.; Wang, C.; Zhang, Y.; Wang, D.N.; Zhang, F.F.; Zhang, L.S.; Sun, Z.J. Differential effects of two earthworm species on Fusarium wilt of strawberry. Appl. Soil Ecol. 2018, 126, 174–181. [Google Scholar] [CrossRef]
  45. Bertrand, M.; Blouin, M.; Barot, S.; Charlier, A.; Marchand, D.; Roger-Estrade, J. Biocontrol of eyespot disease on two winter wheat cultivars by an anecic earthworm (Lumbricus terrestris). Appl. Soil Ecol. 2015, 96, 33–41. [Google Scholar] [CrossRef]
  46. Meyer-Wolfarth, F.; Schrader, S.; Olderburg, E.; Weinert, J.; Brunotte, J. Biocontrol of the toxigenic plant pathogen Fusarium clumorum by soil fauna in an agroecosystem. Mycotoxin Res. 2017, 33, 237–244. [Google Scholar] [CrossRef]
  47. Gudeta, K.; Bhagat, A.; Julka, J.M.; Sinha, R.; Verma, R.; Kumar, A.; Kumari, S.; Ameen, F.; Bhat, S.A.; Amarowicz, R.; et al. Vermicompost and its derivatives against phytopathogenic fungi in the soil: A review. Horticulure 2022, 8, 311. [Google Scholar] [CrossRef]
  48. Cao, Y.; Shen, Z.; Zhang, N.; Deng, X.; Thomashow, L.S.; Lidbury, I.; Liu, H.; Li, R.; Shen, Q.; Kowalchuk, G.A. Phosphorus availability influences disease-suppressive soil microbiome through plant-microbe interactions. Microbiome 2024, 12, 185. [Google Scholar] [CrossRef]
  49. Huber, D.; Römheld, V.; Weinmann, M. Relationship between nutrition, plant diseases and pests. In Marschner’s Mineral Nutrition of Higher Plants, 3rd ed.; Marschner, P., Ed.; Science Press: Beijing, China, 2012; pp. 283–298. [Google Scholar]
  50. Veresoglou, S.D.; Barto, E.K.; Menexes, G.; Rillig, M.C. Fertilization affects severity of disease caused by fungal plant pathogens. Plant Pathol. 2013, 62, 961–969. [Google Scholar] [CrossRef]
  51. Pervaiz, Z.H.; Iqbal, J.; Zhang, Q.; Chen, D.; Wei, H.; Saleem, M. Continuous cropping alters multiple biotic and abiotic indicators of soil health. Soil Syst. 2020, 4, 59. [Google Scholar] [CrossRef]
  52. Gao, F.; Ye, L.; Mu, X.; Xu, L.; Shi, Z.; Luo, Y. Synergistic effects of earthworms and cow manure under reduced chemical fertilization modified microbial community structure to mitigate continuous cropping effects on Chinese flowering cabbage. Front. Microbiol. 2023, 14, 1285464. [Google Scholar] [CrossRef] [PubMed]
  53. Lu, Y.; Gao, P.; Wang, Y.; Li, W.; Cui, X.; Zhou, J.; Peng, F.; Dai, L. Earthworm activity optimized the rhizosphere bacterial community structure and further alleviated the yield loss in continuous cropping lily (Lilium lancifolium Thunb.). Sci. Rep. 2021, 11, 20840. [Google Scholar] [CrossRef] [PubMed]
  54. Aghababaei, F.; Raiesi, F.; Hosseinpur, A. The combined effects of earthworms and arbuscular mycorrhizal fungi on microbial biomass and enzyme activities in a calcareous soil spiked with cadmium. Appl. Soil Ecol. 2014, 75, 33–42. [Google Scholar] [CrossRef]
  55. Aira, M.; Sampedro, L.; Monroy, F.; Domiguez, J. Detritivorous earthworms directly modify the structure, thus altering the functioning of a microdecomposer food web. Soil Biol. Biochem. 2008, 40, 2511–2516. [Google Scholar] [CrossRef]
  56. Zhao QXiong, W.; Xing, Y.; Sun, Y.; Lin, X.; Dong, Y. Long-term coffee monoculture alters soil chemical properties and microbial communities. Sci. Rep. 2018, 8, 6116. [Google Scholar] [CrossRef] [PubMed]
  57. Li, X.; Chen, D.; Carrión, V.J.; Revillini, D.; Yin, S.; Dong, Y.; Zhang, T.; Wang, X.; Delgado-Baquerizo, M. Acidification suppresses the natural capacity of soil microbiome to fight pathogenic Fusarium infections. Nat. Commun. 2023, 14, 5090. [Google Scholar] [CrossRef] [PubMed]
  58. Xiong, R.; He, X.; Gao, N.; Li, Q.; Qiu, Z.; Hou, Y.; Shen, W. Soil pH amendment alters the abundance, diversity, and composition of microbial communities in two contrasting agricultural soils. Microbiol. Spectr. 2024, 12, e04165-23. [Google Scholar] [CrossRef]
  59. Rousk, J.; Bååth, E.; Brookes, P.C.; Lauber, C.L.; Lozupone, C.; Caporaso, J.G.; Knight, R.; Fierer, N. Soil bacterial and fungal communities across a pH gradient in an arable soil. ISME J. 2010, 4, 1340–1351. [Google Scholar] [CrossRef]
  60. Zhou, Z.; Takaya, N.; Shoun, H. Multi-energy metabolic mechanisms of the fungus Fusarium oxysporum in low oxygen envrionment. Biosci. Biotechnol. Biochem. 2010, 74, 2431–2437. [Google Scholar] [CrossRef]
Horticulturae 11 01088 g001
Figure 1. Experiment design flow chart.
Figure 1. Experiment design flow chart.
Horticulturae 11 01088 g001
Horticulturae 11 01088 g002
Figure 2. Effects of the earthworm addition on the incidence rate of continuous cropping watermelon: (A) control in field (CF) vs. treatment with earthworm in field (EF), (B) control in pot (CP) vs. treatment with earthworm in pot (EP). E, FL, and FR denote for extension period, flowering stage, and fruit stage, respectively. Different lowercase letters mean significant differences of incidence rate of Fusarium wilt in watermelon between groups with and without earthworms in the same period. The significance is set to less than 0.05.
Figure 2. Effects of the earthworm addition on the incidence rate of continuous cropping watermelon: (A) control in field (CF) vs. treatment with earthworm in field (EF), (B) control in pot (CP) vs. treatment with earthworm in pot (EP). E, FL, and FR denote for extension period, flowering stage, and fruit stage, respectively. Different lowercase letters mean significant differences of incidence rate of Fusarium wilt in watermelon between groups with and without earthworms in the same period. The significance is set to less than 0.05.
Horticulturae 11 01088 g002
Horticulturae 11 01088 g003
Figure 3. Effects of the earthworm addition on the number of F. oxysporum in continuous cropping watermelon soil for three experiments. CF, EF, CP, EP, CS, and ES denote control in field experiment, group with earthworm in field experiment, control in pot experiment, group with earthworm in pot experiment, control in sterilization experiment, and group with earthworm in sterilization experiment, respectively. Different lowercase letters mean significant differences in number of F. oxysporum in soil between groups with and without earthworms in the same experiment. The significance is set to less than 0.05.
Figure 3. Effects of the earthworm addition on the number of F. oxysporum in continuous cropping watermelon soil for three experiments. CF, EF, CP, EP, CS, and ES denote control in field experiment, group with earthworm in field experiment, control in pot experiment, group with earthworm in pot experiment, control in sterilization experiment, and group with earthworm in sterilization experiment, respectively. Different lowercase letters mean significant differences in number of F. oxysporum in soil between groups with and without earthworms in the same experiment. The significance is set to less than 0.05.
Horticulturae 11 01088 g003
Horticulturae 11 01088 g004
Figure 4. Effects of the earthworm addition on the number of F. oxysporum and the physical and chemical properties of the soil for each experiment presented by the relative interaction index (RII). The number of F. oxysporum. the soil physical and chemical indicator abbreviations are shown in Table 1. RII is used to compare the indicators in the earthworm vs. non-earthworm group. Negative values indicate a higher value in the non-earthworm than in the earthworm treatment and positive values indicate the opposite situation. The RII values differing significantly from 0 are indicated by an asterisk (p < 0.05). Fus, pH, AK, AP, AN, TK, TP, TN, and SOM represent the number of F. oxysporum, pH value, available potassium, available phosphorus, available nitrogen, total potassium, total phosphorus, total nitrogen, and soil organic matter, respectively. * denotes there is significance difference in the diversity index between treatments with and without earthworms (p < 0.05).
Figure 4. Effects of the earthworm addition on the number of F. oxysporum and the physical and chemical properties of the soil for each experiment presented by the relative interaction index (RII). The number of F. oxysporum. the soil physical and chemical indicator abbreviations are shown in Table 1. RII is used to compare the indicators in the earthworm vs. non-earthworm group. Negative values indicate a higher value in the non-earthworm than in the earthworm treatment and positive values indicate the opposite situation. The RII values differing significantly from 0 are indicated by an asterisk (p < 0.05). Fus, pH, AK, AP, AN, TK, TP, TN, and SOM represent the number of F. oxysporum, pH value, available potassium, available phosphorus, available nitrogen, total potassium, total phosphorus, total nitrogen, and soil organic matter, respectively. * denotes there is significance difference in the diversity index between treatments with and without earthworms (p < 0.05).
Horticulturae 11 01088 g004
Horticulturae 11 01088 g005aHorticulturae 11 01088 g005b
Figure 5. PCoA plots based on Bray–Curtis distance at the OTU level showing β-diversity of microbial communities under different treatments. The left three plots (field 1, pot 1, sterilization 1) represent bacterial communities (16S rRNA gene sequencing), while the right three plots (field 2, pot 2, sterilization 2) represent fungal communities (ITS sequencing). Each point represents a sample; colored ellipses indicate 95% confidence intervals. Treatment codes: CF/EF–field soil; CP/EP–pot soil; CS/ES–sterilized soil. CF, EF, CP, EP, CS, and ES denote control in field experiment, group with earthworm in field experiment, control in pot experiment, group with earthworm in pot experiment, control in sterilization experiment, and group with earthworm in sterilization experiment, respectively.
Figure 5. PCoA plots based on Bray–Curtis distance at the OTU level showing β-diversity of microbial communities under different treatments. The left three plots (field 1, pot 1, sterilization 1) represent bacterial communities (16S rRNA gene sequencing), while the right three plots (field 2, pot 2, sterilization 2) represent fungal communities (ITS sequencing). Each point represents a sample; colored ellipses indicate 95% confidence intervals. Treatment codes: CF/EF–field soil; CP/EP–pot soil; CS/ES–sterilized soil. CF, EF, CP, EP, CS, and ES denote control in field experiment, group with earthworm in field experiment, control in pot experiment, group with earthworm in pot experiment, control in sterilization experiment, and group with earthworm in sterilization experiment, respectively.
Horticulturae 11 01088 g005aHorticulturae 11 01088 g005b
Horticulturae 11 01088 g006
Figure 6. PCA analysis of Metabolomes of F. oxysporum regulated by earthworm: (A) earthworm intestinal contents vs. control for sterilized soil, (B) control for sterilized soil and treatment with earthworm in sterilized soil.
Figure 6. PCA analysis of Metabolomes of F. oxysporum regulated by earthworm: (A) earthworm intestinal contents vs. control for sterilized soil, (B) control for sterilized soil and treatment with earthworm in sterilized soil.
Horticulturae 11 01088 g006
Table 1. Relationship between soil fertility indicators and F. oxysporum in three experimental conditions.
Table 1. Relationship between soil fertility indicators and F. oxysporum in three experimental conditions.
Experimental Condition
Fertility IndicatorsFieldPotSterilization
SOM−0.235−0.922 **−0.760
TN0.193−0.384−0.384
TP−0.311−0.6710.703
TK−0.020−0.1440.742
AN−0.094−0.001−0.917 *
AP−0.362−0.674−0.577
AK0.057−0.768−0.711
pH−0.2390.969 **0.715
Note: * means number of F. oxysporum is significantly correlated with soil fertility indicators (p < 0.05), ** means number of F. oxysporum is extremely significantly correlated with soil fertility indicators (p < 0.01).
Table 2. Alpha diversity indices (Chao1, Shannon, and Simpson) of the soil bacterial communities under different treatment groups. Data are expressed as mean ± standard deviation (n = 3). Statistical differences were evaluated by an independent samples t-test. Values marked with superscript asterisks indicate significant differences compared to the control (p < 0.05).
Table 2. Alpha diversity indices (Chao1, Shannon, and Simpson) of the soil bacterial communities under different treatment groups. Data are expressed as mean ± standard deviation (n = 3). Statistical differences were evaluated by an independent samples t-test. Values marked with superscript asterisks indicate significant differences compared to the control (p < 0.05).
GroupChao1 (Mean ± SD)Shannon (Mean ± SD)Simpson (Mean ± SD)
FieldCF2796.17 ± 93.286.21 ± 0.210.007 ± 0.002
EF2563.01 ± 92.335.48 ± 0.410.03 ± 0.01
p-value0.037 *0.0510.044 *
PotCP3161.28 ± 93.846.8 ± 0.060.003 ± 0.001
EP3232.21 ± 62.726.88 ± 0.010.002 ± 0
p-value0.3380.1030.341
SterilizationCS1053.49 ± 52.785.11 ± 0.110.016 ± 0.003
ES930.68 ± 30.124.82 ± 0.060.02 ± 0.002
p-value0.025 *0.015 *0.097
Note: CF, EF, CP, EP, CS, and ES denote control in field experiment, group with earthworm in field experiment, control in pot experiment, group with earthworm in pot experiment, control in sterilization experiment, and group with earthworm in sterilization experiment, respectively. * denotes there is significance difference in the diversity index between treatments with and without earthworms (p < 0.05).
Table 3. Alpha diversity indices (Chao1, Shannon, and Simpson) of the soil fungal communities under different treatment groups. Data are expressed as mean ± standard deviation (n = 3). Statistical differences were evaluated by independent samples t-test. Values marked with superscript asterisks indicate significant differences compared to the control (p < 0.05).
Table 3. Alpha diversity indices (Chao1, Shannon, and Simpson) of the soil fungal communities under different treatment groups. Data are expressed as mean ± standard deviation (n = 3). Statistical differences were evaluated by independent samples t-test. Values marked with superscript asterisks indicate significant differences compared to the control (p < 0.05).
GroupChao1 (Mean ± SD)Shannon (Mean ± SD)Simpson (Mean ± SD)
FieldCF224.15 ± 49.533.43 ± 0.470.07 ± 0.038
EF305.63 ± 46.893.43 ± 0.130.138 ± 0.018
p-value0.1080.9990.048 *
PotCP352.8 ± 0.932.06 ± 0.10.408 ± 0.032
EP412.99 ± 23.082.7 ± 0.460.269 ± 0.125
p-value0.011 *0.0760.138
SterilizationCS50.23 ± 23.391.29 ± 0.530.448 ± 0.144
ES84.67 ± 17.611.75 ± 0.930.347 ± 0.211
p-value0.1110.5020.537
Note: CF, EF, CP, EP, CS, and ES denote control in field experiment, group with earthworm in field experiment, control in pot experiment, group with earthworm in pot experiment, control in sterilization experiment, and group with earthworm in sterilization experiment, respectively. * denotes there is significance difference in the diversity index between treatments with and without earthworms (p < 0.05).
Table 4. Comparison of differential metabolites of F. oxysporum putatively identified between the earthworm intestinal contents and control for sterilized soil.
Table 4. Comparison of differential metabolites of F. oxysporum putatively identified between the earthworm intestinal contents and control for sterilized soil.
Metabolite NameFold ChangeVIPp-Value
Indole1.656641.460690.00101
Octadecanamine5.055232.694040.00180
Stearamine2.859192.093600.00420
Palmitamide1.816361.546320.00926
Bis (2-ethylhexyl) phthalate1.529661.281610.02067
Didrovaltrate56.132641.825320.01117
Oleic acid0.340961.433360.01895
Table 5. Comparison of differential metabolites of F. oxysporum putatively identified between control for sterilized soil and the treatment with earthworms in sterilized soil.
Table 5. Comparison of differential metabolites of F. oxysporum putatively identified between control for sterilized soil and the treatment with earthworms in sterilized soil.
Metabolite NameFold ChangeVIPp-Value
Kynurenic acid1.977281.571680.01096
Maraniol1.476301.189600.01267
Bis(2-ethylhexyl) phthalate1.754341.421750.0195
Palmitamide1.647861.309550.0296
Cyprodenate1.475281.141160.0419
2-Dodecylbenzenesulfonic acid5.688872.215430.0497
Linoleamide0.474351.594350.0497
Myristyl sulfate0.385691.546970.0020
4-Undecylbenzenesulfonic acid0.240381.886920.0104
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhao, X.; Zheng, L.; Liu, D.; Song, K.; Lu, P.; Yang, Y.; Yang, L.; Li, X.; Li, Y.; Zhang, Y.; et al. Addition of Earthworms to Continuous Cropping Soil Inhibits the Fusarium Wilt in Watermelon: Evidence Under Both Field and Pot Conditions. Horticulturae 2025, 11, 1088. https://doi.org/10.3390/horticulturae11091088

AMA Style

Zhao X, Zheng L, Liu D, Song K, Lu P, Yang Y, Yang L, Li X, Li Y, Zhang Y, et al. Addition of Earthworms to Continuous Cropping Soil Inhibits the Fusarium Wilt in Watermelon: Evidence Under Both Field and Pot Conditions. Horticulturae. 2025; 11(9):1088. https://doi.org/10.3390/horticulturae11091088

Chicago/Turabian Style

Zhao, Xin, Liang Zheng, Dong Liu, Ke Song, Ping Lu, Yefeng Yang, Lijuan Yang, Xiaoxiao Li, Yinsheng Li, Yue Zhang, and et al. 2025. "Addition of Earthworms to Continuous Cropping Soil Inhibits the Fusarium Wilt in Watermelon: Evidence Under Both Field and Pot Conditions" Horticulturae 11, no. 9: 1088. https://doi.org/10.3390/horticulturae11091088

APA Style

Zhao, X., Zheng, L., Liu, D., Song, K., Lu, P., Yang, Y., Yang, L., Li, X., Li, Y., Zhang, Y., Lv, W., & Zheng, X. (2025). Addition of Earthworms to Continuous Cropping Soil Inhibits the Fusarium Wilt in Watermelon: Evidence Under Both Field and Pot Conditions. Horticulturae, 11(9), 1088. https://doi.org/10.3390/horticulturae11091088

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop