Next Article in Journal
Enhancing Calcium Transport in Table Grapes Using Sorbitol: A Sustainable Strategy for Promoting Fruit Quality
Previous Article in Journal
Ensuring Reproducibility and Transparency in Experimental Methods and Data Analysis: A Guideline for Authors Submitting to Horticulturae
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 11
Issue 11
10.3390/horticulturae11111321
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Host Genotype Shapes Fungal Symbiont-Mediated Nutrient and Growth Benefits in Citrus

by
Yu-Xi Wan
,
Yang Lü
,
Zi-Yi Rong
,
Ying-Ning Zou
and
Qiang-Sheng Wu
*
Hubei Key Laboratory of Spices & Horticultural Plant Germplasm Innovation & Utilization, College of Horticulture and Gardening, Yangtze University, Jingzhou 434025, China
*
Author to whom correspondence should be addressed.
Horticulturae 2025, 11(11), 1321; https://doi.org/10.3390/horticulturae11111321
Submission received: 21 August 2025 / Revised: 22 October 2025 / Accepted: 30 October 2025 / Published: 3 November 2025
(This article belongs to the Special Issue The Role of Plant Growth-Promoting Microorganisms (PGPMs) in Horticulture Production)
Browse Figures
Versions Notes

Abstract

Given the global economic importance of citrus and growing threats from climate change and soil degradation, this study investigated how arbuscular mycorrhizal (AM) fungi (Funneliformis mosseae, Fm, formerly Glomus mosseae; Diversispora versiformis, Dv, formerly Glomus versiforme) and endophytic fungus Serendipita indica (Si, formerly Piriformospora indica) differentially enhance spring shoot growth, nutrient acquisition, phytohormone profiles, and expression patterns of Fe/Mg transporter genes in two citrus cultivars (‘Beni-Madonna’ and ‘Lane Late’). Si achieved higher root colonization than AM fungi (Fm/Dv) in both cultivars, with peak colonization observed in September. Fungal inoculation differentially enhanced spring shoot growth and leaf gas exchange, with Fm and Dv demonstrating cultivar-specific effects, while Si consistently increased shoot number across cultivars but showed limited gas exchange influence in ‘Lane Late’. In ‘Beni-Madonna’, AM fungi broadly enhanced auxins/cytokinins, while Si specifically increased indole-3-acetic acid and dihydrozeatin but reduced N6-isopentenyladenine; ‘Lane Late’ showed comprehensive hormone upregulation by all fungi except Si’s dihydrozeatin suppression. AM fungi enhanced Ca, Mg, and Mn in ‘Beni-Madonna’ and P, S, Zn, and B in ‘Lane Late’, while Si increased Fe and Zn in the former and P, S, and B in the latter. Fungal symbionts differentially regulated Fe/Mg transporter genes in a cultivar-specific manner. In ‘Beni-Madonna’, Fm upregulated key Fe transporters (CsFRO1, CsHA1, and CsIRT1) while Si broadly enhanced all Fe transporters, correlating with increased leaf Fe levels; Fm specifically induced CsMGT2 and CsMGT8, showing strong association with Mg accumulation. ‘Lane Late’ exhibited distinct responses, with Si comprehensively activating both Fe (CsFRO1, CsHA1-2, and CsIRT1-2) and Mg (CsMGT6/8) transporter genes, while Dv showing minimal effects. These findings demonstrate that fungal symbionts differentially regulate citrus growth and nutrient homeostasis in a cultivar-dependent manner, highlighting the importance of host genotype-specific fungal partnerships for sustainable citrus production.

1. Introduction

Citrus fruits are highly valuable in the global market due to their distinctive flavor, nutritional richness, and health benefits [1]. Among them, ‘Beni-Madonna’ (Citrus nanko × C. amakusa ‘Beni-Madonna’), an early-maturing hybrid cultivar developed in Ehime, Japan, is widely favored for its attractive appearance, delicate texture, and high economic value [2]. On the other hand, the late-maturing variety, ‘Lane Late’ navel orange (Citrus sinensis ‘Lane Late’), originating from Australia, exhibits robust growth, broad adaptability, and cold tolerance [3]. However, citrus production faces significant challenges, including reduced water and nutrient use efficiency, declining soil health, and compromised plant stress resistance due to climate change and soil degradation [4]. The challenges synergistically constrain citrus fruit productivity and quality, while simultaneously escalating economic losses across the global grower community. As climate change drives an increase in the frequency and intensity of extreme weather events, improving the resilience of citrus crops becomes an urgent task for sustainable agricultural systems. In this context, optimizing mineral nutrition and improving stress resilience are foundational to ensuring long-term citrus production [5]. The use of microbial symbionts, such as arbuscular mycorrhizal (AM) fungi and endophytes, has emerged as a promising strategy to enhance plant performance and soil health [6,7], although their effects are often context- and host-dependent.
AM fungi form mutualistic associations with approximately 80% of vascular plants, known as arbuscular mycorrhizas, which can significantly enhance host nutrient uptake, growth vigor, and soil health [8,9]. By extending extraradical hyphal networks, AM fungi increase the root absorption zone, thereby improving plant access to water and mineral elements such as phosphorus (P), potassium (K), copper (Cu), zinc (Zn), and manganese (Mn) [10]. Previous studies have demonstrated the contribution of AM fungi to enhancing stress resilience, as evidenced in cucumber where AM inoculation elevated antioxidant enzyme activity and the expression of specific plasma membrane intrinsic protein (PIP) genes under waterlogging stress [11]. In trifoliate orange (Poncirus trifoliata), AM fungi were shown to upregulate H+-ATPase activity and PtAHA2 gene expression, which promoted nutrient acquisition, root growth, and rhizosphere acidification under drought stress [12]. However, the influence of AM fungi on nutrient levels of host roots (such as citrus and walnut) varied depending on fungal species and mineral nutrient type [13]. This functional variability highlights the context-dependent nature of AM–plant symbioses, where outcomes are influenced by the compatibility between fungal traits and plant nutrient demands. AM fungi may selectively promote the uptake of specific nutrients, likely through differential activation of transporters or excretion of enzymes [14,15,16]. This selective mechanism indicates that plants may preferentially associate with AM fungal species that offer superior nutrient benefits [17]. Earlier studies have emphasized the importance of AM fungi in Fe and Mg transport to plants. For example, Rahman et al. [18] demonstrated that AM fungi significantly induced the expression of MsFRO1 in alfalfa roots under Fe-deficient conditions. Similarly, Liu et al. [19] reported that AM fungi modulated the expression of several SlMGT genes in tomatoes, with a significant increase in SlMGT1-1 transcript levels in mycorrhizal roots, indicating its potential role in maintaining Mg homeostasis. These findings highlight the role of AM fungi in Fe and Mg homeostasis; however, whether fungal inoculation induces correlative changes between Fe/Mg accumulation and transporter gene expression in citrus has not been investigated. Furthermore, although phytohormones play a central role in mediating AM-induced growth and stress responses [20], their specific regulation in citrus–AM interactions is poorly documented. For instance, cytokinins and auxins are known to be modulated by AM symbiosis and contribute to root development and nutrient partitioning [21], yet their profiles in citrus under AM inoculation require further investigation.
In contrast to AM fungi, the endophytic fungus Serendipita indica originally isolated from the Thar Desert in India exhibits distinct ecological and functional traits distinct from AM fungi [22]. Unlike obligate symbiotic AM fungus, S. indica can colonize both mycorrhizal and non-mycorrhizal plant species and grow axenically in laboratory conditions [23,24]. This adaptability makes it a promising candidate as a biofertilizer for sustainable agriculture [25]. Earlier studies have demonstrated that S. indica promotes plant growth, enhances nutrient absorption, and alleviates stress [21,26,27,28,29]. Despite these promising results, the mechanisms underlying S. indica–citrus interactions, especially their impact on phytohormone dynamics and mineral homeostasis, remain underexplored. Under P-deficient conditions, S. indica enhanced tea seedling growth by regulating phytohormone balance [28]. The fungus also induced arsenic accumulation in tomato roots while significantly reducing its translocation to fruits [26]. Furthermore, both single inoculation with S. indica and co-inoculation with AM fungi have been shown to increase endogenous hormone levels in trifoliate orange, including auxins and cytokinins [21]. Although this fungus influences plant growth in various plant species by regulating endogenous hormones and nutrient uptake, its specific mechanisms and effects in citrus crops still lack direct research support.
Although previous studies have examined the individual effects of AM fungi and S. indica on citrus species [27,30], a comparative assessment is lacking of how AM fungi and S. indica differentially regulate key genes and phytohormone pathways to mediate nutrient acquisition in contrasting citrus cultivars. In particular, the expression of key nutrient transporter genes (e.g., for Fe and Mg) and the role of phytohormones in mediating fungal benefits in citrus have not been thoroughly studied. Understanding the response of plant mineral status, nutrient transporter gene expression, and phytohormone levels to fungal inoculation is critically important for sustainable agriculture. To address this knowledge gap, the present study aimed to conduct a pot experiment to compare the regulatory effects of two AMF strains and S. indica on growth parameters, endogenous phytohormone profiles, mineral nutrient accumulation, and expression patterns of Fe/Mg transporter genes in ‘Beni-Madonna’ and ‘Lane Late’ citrus cultivars. The findings provide a mechanistic basis for understanding how microbial symbionts differentially regulate phytohormones and nutrient homeostasis in citrus, offering a foundation to refine microbial strategies for improved, climate-resilient cultivation of distinct cultivars.

2. Materials and Methods

2.1. Fungal Inoculum Preparation

The experiment utilized two distinct AM fungal species: Funneliformis mosseae (BGC XZ02A; designated as Fm) and Diversispora versiformis (BGC NM04B; designated as Dv), obtained from the Bank of Glomeromycota in China (BGC). Prior to inoculation, both AM fungal strains underwent a 10-week propagation phase using white clover as the host plant. The resulting inoculum consisted of infected root fragments, growth medium, and fungal structures including spores (18–20 sporangiospores per g) and hyphae. For the endophytic fungus S. indica (designated as Si), the fungal propagation protocol followed an established method by Yang et al. [31] with minor modifications. Initial growth occurred on solid potato dextrose agar plates until complete surface colonization. Subsequently, the fungal biomass was transferred to liquid culture to generate a concentrated basidiospore suspension of S. indica. This suspension was then diluted (1:20 ratio) with distilled water to produce the working inoculum, which contained 12.4 g/L mycelial biomass with a final viable S. indica spore count of 2.72 × 109 CFU/mL.

2.2. Plant Culture

The study employed two citrus cultivars: four-year-old ‘Beni-Madonna’ grafted plants (provided by the Fruit and Tea Research Institute, Hubei Academy of Agricultural Sciences, Wuhan, China) and two-year-old ‘Lane Late’ navel orange (supplied by Hubei April Green Agricultural Co., Ltd., Yichang, China), both at the 8–12 leaf stage and similar size. Each cultivar was grafted onto trifoliate orange rootstock. These plants had a very low rate of mycorrhizal colonization (<2.5%) and were not infected by S. indica. These plants were grown in 15-liter plastic containers (with an upper diameter of 27.5 cm, a lower diameter of 26 cm, and a height of 31 cm) filled with 13.0 kg of autoclaved growth substrate. The substrate (pH 7.0) consisted of a 69:25:6 mixture of peat, vermiculite, and perlite, with initial nutrient concentrations of 30.49 mg/kg ammonium nitrogen, 42.52 mg/kg nitrate nitrogen, 57.17 mg/kg Olsen-phosphorus, and 60.28 mg/kg soluble potassium.
Fungal inoculation took place at the time of transplantation in April 2021, with both Dv and Fm inoculants applied at a rate of 800 g per pot and a Si spore suspension at 1.0 L per pot. Control plants received an equivalent quantity of autoclaved (treated at 121 °C, 0.11 MPa for 2 h) inoculants. Cross-contamination between fungal treatments was prevented by conducting a pot tray, disinfecting all culture racks, and ensuring that watering containers did not contact the substrate surface. After inoculation, a 15-day indoor acclimatization period was conducted before transferring the plants to a plastic greenhouse at Yangtze University. Substrate moisture was maintained at 75% of the maximum water-holding capacity by daily monitoring pot weight and replenishing water loss with deionized water as needed. The plants were grown in a greenhouse under the following controlled conditions: a 28/23 °C day/night temperature regime, 72% relative humidity, and a 16-hour photoperiod. To minimize positional effects, all pots were repositioned weekly within the greenhouse. The shading strategy implemented from July to September, which reduced natural light intensity by approximately 40%, was primarily adopted to mitigate excessively high temperatures (>40 °C) in the greenhouse. No supplemental fertilization was provided during the experimental period. Root samples for endophytic fungal colonization were collected every three months starting in March 2022. The entire research period lasted from April 2021 to December 2022.

2.3. Experimental Design

In this study, a completely randomized design was utilized, incorporating citrus cultivars ‘Beni-Madonna’ and ‘Lane Late’ alongside inoculation treatments comprising Dv, Fm, Si, and a non-inoculated control. Each treatment was replicated five times (n = 5), resulting in a total of 40 experimental units (pots).

2.4. Assessment of Root Colonization and Spring Shoot Growth

To assess fungal colonization at March, June, September, and December, root samples were collected from a total of 40 pots, with five replicates per time point. The time points were chosen to capture different stages of root development. Colonization rates were calculated separately for each time point by examining the root segments collected. For root colonization analysis [32], fifty randomly selected 1-cm root segments from each sample were cleared in 10% KOH at 90 °C until achieving translucency, bleached with 10% H2O2 for 10 min, and acidified with 0.2 mol/L HCl for 10 min. Staining was performed using 0.05% trypan blue in lactophenol for 1 min before microscopic examination of hyphae colonized at 400× magnification. The colonization rate was calculated as the percentage of colonized root segments relative to the total observed segments. Prior to plant harvest, vegetative growth parameters were quantified by counting all spring shoots per plant, measuring spring shoot length from base to apical meristem, and determining stem diameter of spring shoots using precision digital calipers. Additionally, the plant height was measured as the length from the soil surface to the top of the plant using a tape measure, and the stem diameter at the base was measured using a Vernier caliper. The measurements of spring shoot growth and stem diameter were all conducted in June 2022.

2.5. Determination of Leaf Gas Exchange Parameters

Leaf gas exchange measurements were conducted in September 2022 using a portable photosynthesis system (Li-6400, LI-COR Biosciences, Lincoln, NE, USA). Following a 30-min light adaptation period, photosynthetic parameters were recorded from the third fully expanded healthy leaf of each plant’s spring shoots between 9:00 and 11:00 a.m. The measured parameters included net photosynthetic rate (Pn), stomatal conductance (Gs), and transpiration rate (Tr). During measurements, the environmental conditions were maintained at ambient CO2 concentration (400 μmol/mol) with a constant flow rate of 500 μmol/s. Three consecutive stable readings were taken for each leaf.

2.6. Analysis of Endogenous Phytohormones

The extraction and quantification of endogenous phytohormones, including indole-3-acetic acid (IAA), indole-3-butyric acid (IBA), trans-zeatin (TZ), dihydrozeatin (DZ), and N6-isopentenyladenine (IP) in the third fully expanded healthy leaf of spring shoots, were performed following the methodology described by Rong et al. [28]. Fresh leaf samples (0.35 g) collected in September 2022 were homogenized in liquid nitrogen and extracted with 1 mL of ice-cold extraction solution (methanol/distilled water/formic acid = 15:4:1, v/v/v) at 4 °C for 12 h. After centrifugation at 8000× g for 10 min, the residue was re-extracted with 0.5 mL of the same solution for an additional 2 h at 4 °C. The combined supernatants were concentrated to approximately 0.5 mL under reduced pressure at 40 °C, followed by three successive petroleum ether washes (0.5 mL each) to remove pigments. The aqueous phase was evaporated to complete dryness and reconstituted in 0.5 mL of HPLC mobile phase (methanol/ddH2O = 2:3, v/v). HPLC analysis was conducted using an LC-100 system (Shanghai Precision Instrument Co., Ltd., Shanghai, China) equipped with a C18 reverse-phase column (250 mm × 4.6 mm, 5 μm particle size). The separation was achieved with an isocratic elution at a flow rate of 0.8 mL/min and column temperature of 35 °C. A 10 μL aliquot of each sample was injected, and the detection was performed at 254 nm wavelength over a 40-min run time. Phytohormone identification and quantification were based on retention times and peak areas compared with authentic standards. Method validation included recovery tests (85–110%) and calibration curves (R2 > 0.995) for each analyte. Three technical replicates were analyzed for each biological sample to account for analytical variability.

2.7. Determination of Mineral Element Concentrations in Leaves

The experimental plants exhibited distinctly consistent chlorosis symptoms in newly developed leaves, manifesting as pronounced yellowing with irregular chlorotic patches. To investigate the potential involvement of mineral nutrient imbalances in these phenotypic abnormalities, we conducted a comprehensive analysis of essential mineral elements in leaf tissues (the third fully expanded healthy leaf of spring shoots) in September 2022. Leaf samples involved heat deactivation at 105 °C for 15 min, followed by complete drying at 75 °C until constant weight was achieved. The dried leaf samples were finely ground, passed through a 0.5 mm sieve, and subjected to acid digestion prior to analysis. Quantitative determination of both macronutrients (phosphorus, potassium, calcium, magnesium, and sulfur) and micronutrients (boron, copper, iron, manganese, and zinc) was performed using an inductively coupled plasma optical emission spectrometer (ICP-OES; IRIS Advantage, Thermo Scientific, Waltham, MA, USA). The instrument was operated at optimized parameters including an RF power of 1150 W, plasma gas flow rate of 15 L/min, and nebulizer pressure of 30 psi.

2.8. Analysis of Fe/Mg Transporter Gene Expression

Total RNA was isolated from leaf samples (the third fully expanded healthy leaf of spring shoots collected in September 2022) using the FastPure Plant Total RNA Isolation Kit (RC401-01; Vazyme Biotech, Nanjing, China), followed by cDNA synthesis with the HiScript® II First Strand cDNA Synthesis Kit (R212; Vazyme) incorporating gDNA removal. RNA integrity was verified through 1% agarose gel electrophoresis, while concentration and purity were determined spectrophotometrically (BioPhotometer Plus 6132, Eppendorf, Hamburg, Germany). Based on the studies conducted by Martinez-Cuenca et al. [33] and Liu et al. [34], we examined the expression profiles of key Fe transporter genes (FRO, ferric reductase oxidase; HA, high-affinity Fe transporter; IRT, iron-regulated transporter) and Mg transporter genes (MGT) in citrus leaves. Gene sequences were retrieved from GenBank (http://www.ncbi.nlm.nih.gov/genbank/; accessed on 17 September 2022) and the Citrus Genome Database (http://citrus.hzau.edu.cn/index.php; accessed on 17 September 2022), with specific primers designed using Prime Premier 5 software (Table 1) and synthesized by Sangon Biotech (Shanghai, China). Quantitative real-time PCR (qRT-PCR) was performed using a CFX96 Touch system (Bio-Rad), with gene expression levels normalized to the reference gene β-actin and calculated using the 2−ΔΔCt method [35]. Final expression values were standardized relative to non-inoculated control plants to determine the fold-change in gene expression induced by fungal inoculation. Each analysis included three technical replicates to ensure data reproducibility.

2.9. Statistical Analysis and Data Visualization

The experimental data were subjected to comprehensive statistical analysis using SAS 8.1 software (SAS Institute Inc., Cary, NC, USA). The analysis of variance (ANOVA) was performed at a significance level of α = 0.05. Post hoc multiple comparisons were conducted using Duncan’s test, with statistically different groups denoted by distinct lowercase letters. All graphical representations were generated using Origin 2024 (OriginLab Corporation, Northampton, MA, USA), where bar charts display error bars representing the standard error of the mean (SEM). Correlation analyses between root colonization, spring shoot growth, growth performance, and hormone levels were performed using Pearson’s correlation coefficients, with the resulting correlation matrix visualized as a heatmap through Origin 2024. The analytical workflow incorporated appropriate data transformations when necessary to meet the assumptions of parametric tests, including verification of normality (Shapiro–Wilk test) and homogeneity of variance (Levene’s test).

3. Results

3.1. Effects of Fungal Inoculation on Root Colonization Rates of Citrus

Control plants exhibited minimal natural AM fungal colonization (2.8–3.5% in ‘Lane Late’ and 3.1–3.6% in ‘Beni-Madonna’) (Table 2). In ‘Beni-Madonna’, the fungal treatments increased colonization rates across different sampling periods, with Si consistently showing the highest colonization rate, followed by Dv and Fm. The root colonization rates across all four sampling time points consistently demonstrated significantly higher colonization rates by Si compared to Fm and Dv, while no significant difference between the latter two fungi except in March, when Dv surpassed Fm. Similarly, ‘Lane Late’ demonstrated colonization improvements by fungal inoculations, maintaining significant colonization rate hierarchy of Si > Fm > Dv throughout the sampling period. Both cultivars exhibited peak colonization rate in September, irrespective of endophytic fungi, reaching maximum rates of 61.3% for ‘Beni-Madonna’ and 62.4% for ‘Lane Late’ in Si-treated plants.

3.2. Effects of Fungal Inoculation on Spring Shoot Growth and Growth Performance of Citrus

In ‘Beni-Madonna’, Fm inoculation significantly enhanced spring shoot number by 29.41% and spring shoot length by 17.61%, alongside no significant effect on spring shoot diameter (Figure 1a–c). Additionally, Fm significantly increased plant height by 20.55% and stem diameter by 24.38% in this cultivar (Figure 1d–e). Conversely, Dv treatment produced more complex effects, dramatically increasing spring shoot number by 58.82% but concurrently reducing spring shoot length by 22.08%, with no significant alteration in spring shoot diameter. Dv also significantly improved plant height and stem diameter by 17.16% and 11.38%, respectively. Si inoculation in this cultivar specifically increased spring shoot number (33.33% improvement) and significantly elevated plant height (18.62%) and stem diameter (24.3%), without affecting other growth parameters. For ‘Lane Late’, all fungal treatments demonstrated more uniformly positive effects (Figure 1f–j). Both AM fungal strains (Fm and Dv) significantly improved all measured growth parameters: spring shoot number increased by 85.00–90.00%, spring shoot length by 121.93–140.89%, and spring shoot diameter by 25.77–32.52%. In this cultivar, Fm and Dv also markedly enhanced plant height and stem diameter (Figure 1i–j). Nevertheless, Si inoculation showed strong promotion of spring shoot number (95.00%) and length (95.54%), along with no significant influence on shoot diameter in this cultivar. Si similarly boosted plant height and stem diameter by 93.89% and 55.92%, respectively.

3.3. Effects of Fungal Inoculation on Leaf Gas Exchange Parameters of Citrus

In ‘Beni-Madonna’, Dv demonstrated the most pronounced effects, increasing Pn, Gs, and Tr by 72.55%, 234.62%, and 91.01%, respectively, compared to non-inoculated controls (Figure 2a–c). Similarly, Fm showed significant enhancement of Pn (50.30%), Gs (130.77%), and Tr (40.74%), while Si only significantly improved Pn (26.45%) and Gs (67.31%) without significantly affecting Tr. For ‘Lane Late’, all three fungal treatments (Fm, Dv, and Si) significantly enhanced both Pn and Tr, with Dv showing the promotion of Pn (113.21%) followed by Fm (68.22%) and Si (52.97%) (Figure 2d,f). The Tr responses followed a similar pattern, with Fm (113.21%), Dv (68.87%), and Si (56.60%) all showing significant increases. Regarding Gs, Fm and Dv increased it by 32.43% and 59.46%, respectively, while Si had no significant effect in this cultivar (Figure 2e).

3.4. Effects of Fungal Inoculation on Leaf Endogenous Hormone Levels of Citrus

In ‘Beni-Madonna’, all three fungal treatments (Fm, Dv, and Si) significantly increased IAA and DZ levels relative to non-inoculated controls (Figure 3a). Specifically, IAA levels rose by 8.75% (Fm), 21.45% (Dv), and 9.54% (Si), while DZ levels increased by 2.49% (Fm), 24.79% (Dv), and 27.28% (Si). The AMF strains (Fm and Dv) additionally enhanced other hormonal components, with Fm elevating IBA by 4.35%, IP by 7.20%, and TZ by 21.26%, while Dv increased these hormones by 5.15%, 15.07%, and 5.62%, respectively. In contrast, Si uniquely reduced IP levels by 3.73% without significantly affecting IBA or TZ levels. The fungal inoculants induced a comprehensive phytohormone response in ‘Lane Late’ (Figure 3b). The three fungal inoculations, Fm, Dv, and Si, significantly boosted IAA levels by 25.46%, 53.15%, and 4.12%, IBA levels by 18.20%, 7.34%, and 6.09%, IP levels by 22.72%, 24.46%, and 15.86%, and TZ levels by 17.19%, 7.06%, and 13.79%, respectively. However, DZ regulation showed divergent trends, in which Fm and Dv increased DZ levels by 11.08% and 7.84%, respectively, while Si treatment unexpectedly decreased DZ levels by 4.95%.

3.5. Effects of Fungal Inoculation on Leaf Mineral Element Concentrations of Citrus

In ‘Beni-Madonna’, Fm inoculation significantly enhanced Ca (9.14%), Mg (19.11%), and Mn concentrations (40.58%) while reducing P (37.25%), K (15.82%), S (15.38%), Cu (28.57%), Zn (36.47%), and B (32.21%) concentrations, with no effect on Fe concentrations, compared with the non-inoculated controls (Figure 4a,b). Dv treatment showed similar reductions in P (59.31%), K (32.44%), S (17.81%), Cu (45.68%), Zn (32.87%), and B concentrations (27.45%) but distinctly increased Ca (14.41%), Fe (36.71%), and Mn concentrations (67.84%) without altering Mg concentrations. Si displayed yet another pattern, elevating Ca (18.06%), Mg (14.22%), Fe (43.50%), Mn (44.97%), and Zn concentrations (22.54%) while decreasing P (46.24%), K (23.28%), Cu (25.57%), and B concentrations (21.66%), with S concentrations remaining unaffected. Compared to non-inoculated controls, Fm increased P (32.05%), S (84.83%), Zn (61.01%), and B (84.36%) while reducing Ca (14.99%), Mg (33.85%), Fe (27.68%), and Mn concentrations (7.20%) in ‘Lane Late’, with K and Cu concentrations unchanged (Figure 4c,d). Dv enhanced P (31.41%), S (108.28%), Cu (123.17%), and Zn concentrations (61.01%) but decreased K (10.39%), Ca (12.71%), Mg (24.72%), and Fe concentrations (27.68%), leaving Mn and B concentrations unaffected. Si specifically boosted P (42.95%), S (75.17%), and B concentrations (48.56%) while reducing K (2.89%), Ca (18.67%), Mg (27.39%), and Mn concentrations (14.89%), with Fe, Cu, and Zn concentrations showing no significant changes.

3.6. Effects of Fungal Inoculation on the Expression of Leaf Fe/Mg Transporter Genes of Citrus

The inoculation with fungal symbionts differentially regulated the expression of Fe and Mg transporter genes in both citrus cultivars, showing distinct cultivar-specific transcriptional responses (Figure 5a–d). In ‘Beni-Madonna’, Fm inoculation significantly upregulated the expression of Fe transporter genes CsFRO1 (1.22-fold), CsHA1 (0.73-fold), and CsIRT1 (0.73-fold) while downregulating CsHA2 (0.31-fold) and CsIRT2 (0.34-fold) (Figure 5a). For Mg transporter genes, Fm enhanced the expression of CsMGT2 (3.81-fold) and CsMGT8 (0.47-fold) but suppressed the expression of CsMGT6 (0.41-fold), with no effect on CsMGT5 (Figure 5b). Dv treatment showed contrasting patterns, upregulating CsFRO1 (1.46-fold) and CsHA2 (+0.27-fold) while reducing CsHA1 (0.93-fold), CsIRT1 (0.67-fold), and CsIRT2 (0.74-fold). All measured Mg transporter genes were downregulated by Dv (CsMGT2, 0.40-fold; CsMGT5, 0.99-fold; CsMGT6, 0.88-fold; CsMGT8, 0.63-fold). Si exhibited the most pronounced effects, upregulating CsFRO1 (3.08-fold), CsHA1 (0.60-fold), CsHA2 (1.03-fold), and CsIRT1 (0.71-fold) while increasing CsMGT2 (2.30-fold) and decreasing CsMGT5 (0.83-fold), CsMGT6 (0.73-fold), and CsMGT8 (0.54-fold). ‘Lane Late’ displayed fundamentally different regulatory patterns. Fm upregulated the expression of CsFRO1 (0.97-fold), CsHA2 (0.88-fold), CsIRT1 (1.54-fold), and CsIRT2 (1.26-fold) without affecting CsHA1, while enhancing CsMGT2 (0.85-fold), CsMGT5 (0.76-fold), and CsMGT8 (1.85-fold) (Figure 5c,d). Dv showed the upregulation of CsFRO1 (0.83-fold) but downregulated CsHA2 (0.80-fold), CsIRT1 (0.91-fold), and CsIRT2 (0.83-fold), and consistently suppressed all Mg transporter genes (CsMGT2, 0.85-fold; CsMGT5, 0.91-fold; CsMGT6, 0.89-fold; CsMGT8, 0.61-fold). Remarkably, Si induced the strongest upregulation across multiple genes, increasing the expression of Fe transporter genes including CsFRO1 (2.55-fold), CsHA1 (5.1-fold), CsHA2 (5.52-fold), CsIRT1 (2.16-fold), and CsIRT2 (0.96-fold), while dramatically boosting CsMGT6 (5.39-fold) and CsMGT8 (2.43-fold) despite reducing CsMGT5 (0.41-fold).

3.7. Correlation Analysis

The correlation analysis revealed distinct nutrient, hormone levels, and fungal colonization rate in the two citrus cultivars (Figure 6a,b). These correlative patterns provide important insights into the mechanistic links between fungal symbiosis and citrus plant physiological responses. In ‘Beni-Madonna’ (Figure 6a), the root fungal colonization rate showed significant positive correlations with spring shoot number, plant height, stem diameter, and hormone indices including IAA, IBA, and TZ. This coordinated response suggests that in ‘Beni-Madonna’, fungal colonization promotes growth through synchronized regulation of multiple hormonal pathways, where IAA was strongly associated with spring shoot number and plant height, and IBA was positively associated with spring shoot number. Additionally, in ‘Beni-Madonna’ (Figure 6c), Fe content showed a significantly positive correlation with CsFRO1 and CsHA2, and Mg content also exhibited a significantly positive correlation with CsMGT2. This implies a potential regulatory role of these nutrient transporters in response to fungal colonization. On the contrary, in the ‘Lane Late’ cultivar (Figure 6b), the root fungal colonization rate showed a significantly positive correlation with spring shoot number and TZ. It also exhibited a significantly negative correlation with spring shoot diameter, IAA, and DZ. This contrasting pattern indicates cultivar-specific hormonal mediation of symbiotic effects, with ‘Lane Late’ exhibiting more selective hormonal regulation centered on TZ-mediated responses. Similarly, for ‘Lane Late’ (Figure 6d), Mg content showed a highly significant negative correlation with CsMGT8, suggesting a different regulatory mechanism for magnesium transport in this cultivar. Intriguingly, a significantly positive correlation was observed between IAA and spring shoot diameter, while IP demonstrated significantly positive associations with spring shoot length, plant height, and stem diameter. Additionally, a significantly positive correlation was found between DZ and spring shoot diameter. These differential correlation networks between cultivars highlight how host genetic background determines the functional integration of symbiotic signals with endogenous growth regulatory pathways.

4. Discussion

Both ‘Beni-Madonna’ and ‘Lane Late’ navel oranges showed positive colonization responses, with Si demonstrating notably superior colonization rates. However, the two cultivars exhibited differential colonization preferences: ‘Beni-Madonna’ followed the order of Si > Dv > Fm, while ‘Lane Late’ showed the trend of Si > Fm > Dv. This is consistent with previous findings in ‘Newhall’ navel oranges by Cheng et al. [30]. Notably, the enhanced colonization capacity of Si compared to AM fungi is consistent with reports in tomato, in which this endophyte exhibits robust root colonization attributable to its flexible host recognition system [36]. It is important to emphasize that the colonization structures of AM fungi and Si are fundamentally distinct; therefore, their colonization rates should be regarded as confirmation of successful fungal establishment rather than as directly comparable measures of symbiotic effectiveness. Although the two cultivars were at different developmental stages, their consistent hierarchical responses to fungal inoculation within each genotype highlight the fundamental nature of these plant–fungal interactions. The temporal patterns suggested optimal fungal establishment in September for both cultivars, potentially related to seasonal variations in root exudation patterns or soil temperature conditions [37]. This pattern aligns with the seasonal dynamics in Dactylis glomerata and Trifolium repens [38]. Fungal colonization patterns are governed by complex interactions between environmental factors, fungal species, and host plant genotypes [39].
A key divergence between the cultivars was observed in their growth responses. Both cultivars showed significant increases in shoot number under Fm and Dv treatments, demonstrating a conserved role of AMF in promoting shoot branching, a phenomenon consistent with previous reports on AMF-enhanced cytokinin production [40]. However, the response magnitude observed in this study suggests that cultivar-specific variations in AMF-mediated signaling may contribute to the regulation of shoot development [41]. In response to limited resources, host plants strategically reallocate photoassimilates and nutrients, a well-documented phenomenon across species, to optimize growth and performance under environmental stress [42]. In contrast, ‘Lane Late’ exhibited more comprehensive growth responses than ‘Beni-Madonna’ to AMF treatments, with simultaneous increases in shoot number, length and diameter, indicating this cultivar’s superior capacity to convert mycorrhiza-mediated nutrient acquisition into aboveground growth advantages. The differential effects of Si treatment between cultivars, with ‘Beni-Madonna’ showing only shoot number enhancement while ‘Lane Late’ exhibited improvements in both shoot number and length, may reflect cultivar-specific sensitivity to endophytic fungal signals or variations in symbiotic efficiency under different growth conditions [43].
In this study, both AMF and the endophytic fungus Si improved leaf gas exchange parameters in both citrus cultivars. However, AMF treatments, particularly Dv, generally induced more pronounced improvements than Si. The superior efficacy of AMF in enhancing photosynthesis is well-documented and can be attributed to its dual role in not only improving water and nutrient (especially P) uptake, which are fundamental for photosynthetic processes, but also potentially influencing the host’s photosynthetic machinery through more systemic hormonal or molecular signals [44]. The magnitude of response varied substantially between cultivars, with ‘Beni-Madonna’ exhibiting greater enhancement of stomatal conductance. The particularly dramatic 234.62% increase in Gs with Dv treatment in ‘Beni-Madonna’ may reflect superior symbiotic compatibility or more efficient stomatal regulation. For ‘Lane Late’ navel orange in our study, all three fungal inoculations significantly increased leaf Pn and Tr. Previous application of Si on trifoliate orange also demonstrated significant improvements in Pn, Gs and Tr, with greater enhancement under drought conditions than normal water status [45]. However, the differences in the observed effects may be due to distinct mechanisms between fungal inoculation and Si treatment. These findings suggest that endophytic fungi can enhance host plant photosynthetic capacity by increasing chlorophyll content and improving nitrogen/Mg levels, thereby accelerating gas exchange processes [46]. However, our study revealed some cultivar-specific variations: no significant difference in Tr was observed between Control and Si treatments in ‘Beni-Madonna’, while Gs showed no significant response to Si in ‘Lane Late’. These differential responses may be attributed to variations in plant species sensitivity to Si or environmental factors affecting the symbiotic efficiency.
Phytohormones showed distinct response patterns to fungal inoculations. In ‘Beni-Madonna’, both Fm and Dv significantly elevated all measured hormone levels, with Dv demonstrating superior regulatory effects over Fm and Si. Additionally, a significantly (p < 0.01) positive correlation was observed between fungal colonization rate and DZ levels. Si treatment induced more selective changes, significantly increasing IAA and DZ levels and unexpectedly reducing IP levels. This aligns with Zheng et al. [47] who reported Si’s IAA-inducing capacity, potentially through production of hormone-like compounds or modulation of biosynthetic pathways [48]. The IP reduction contrasts with the findings of Rong et al. [49] in P-deficient tea plants where Si elevated IP and TZ levels, suggesting nutrient status may mediate hormonal responses. For ‘Lane Late’, all three symbionts consistently enhanced IAA, IBA, IP and TZ levels, with Fm showing the strongest overall regulation. The significant positive correlation (p < 0.01) between colonization rate and TZ highlights cultivar-specific hormonal priorities, where ‘Beni-Madonna’ associated with DZ, and ‘Lane Late’ coordinated more with TZ. Si’s contrasting effects on DZ between cultivars (increasing in ‘Beni-Madonna’ while decreasing in ‘Lane Late’) suggest complex, genotype-specific modulation of cytokinin metabolism [50]. Future studies should explore molecular basis for Si’s selective IP/DZ modulation. These results reveal that AMF generally induced broader hormonal modifications than the endophytic fungus Si, particularly in cytokinin regulation, and Dv showed exceptional efficacy in elevating IAA levels in both cultivars, along a balanced enhancement by Fm across hormone classes. These results demonstrate that AMF inoculation can simultaneously promote growth and hormonal balance in citrus, offering a promising approach to enhance yield and environmental stress resilience.
In this study, AMF strains preferentially promoted macronutrient (P) and micronutrient (Zn, B, Cu, and S) accumulation in ‘Lane Late’ while enhancing Ca, Mg, and Mn in ‘Beni-Madonna’. Si uniquely improved Fe status in ‘Beni-Madonna’ without comparable effects in ‘Lane Late’. The dramatic increases in S (up to 108.28%) and B (up to 84.36%) in ‘Lane Late’ across fungal inoculations suggest cultivar-specific activation of S assimilation and B transport pathways by fungal symbionts. These nutrient responses collectively reveal distinct, cultivar-specific acquisition strategies under fungal colonization, despite being measured at different physiological stages. The P decrease in ‘Beni-Madonna’ following fungal inoculations may be due to the increased growth, resulting in dilute effects. The observed inverse changes in P and Ca across fungal inoculations suggest an antagonistic relationship [51]. In AM plants, P accumulates in specific cellular compartments, while Ca is predominantly found in the cell wall and apoplast, indicating a regulated transfer between the two elements [52]. The contrasting P-Ca relationships parallel those reported in poplar [53] but differ from Si-treated ‘Qiuxiang’ hybrid orchid [54], emphasizing the need for environment-tailored inoculant selection [55]. These mineral profiles potentially explained the superior photosynthetic activity in ‘Beni-Madonna’ (linked to elevated Ca and Mg) versus the robust growth in ‘Lane Late’ (associated with improved P, S, and Zn). Wang et al. [56] demonstrated that Fm inoculation significantly improved the uptake of nitrogen (N), P, K, Cu, and Zn in Phoebe zhennan under salt stress conditions. Cheng et al. [30] also reported that Dv specifically enhanced K, Mg, and Mn concentrations, while Si preferentially increased Fe and Zn levels in citrus fruits. The results demonstrate that host plants presented distinct nutrient prioritization strategies, activating specific transporters in response to endophytic fungal colonization [57]. This selective activation allows plants to optimize nutrient acquisition based on their immediate needs [58]. Particularly noteworthy is the inverse relationship between fungal colonization and nutrient (P, Ca, Mg, and Mn) accumulation in ‘Beni-Madonna’ versus ‘Lane Late’. Endophytes may have competed with the host plants for the limited amounts of nutrients in the pot, resulting in decreases in specific nutrients. Based on these findings, it can conclude that Fm may benefit ‘Beni-Madonna’ in Ca/Mg-limited soils, while Dv or Si inoculation may represent an effective strategy for P-limited ‘Lane Late’ orchards. Different rootstock-scion combinations and their varying combination times in this study, as well as the efficiency of nutrient transfer from the roots to the leaves, affect the functionality of endophytes, leading to differences in nutrient element levels.
The present study revealed distinct patterns of Fe transporter gene regulation in response to fungal inoculation across two citrus cultivars. In ‘Beni-Madonna’, Fm inoculation significantly upregulated CsFRO1, CsHA1, and CsIRT1 expression, while Dv treatment exhibited a more complex response, suppressing CsHA1 and CsIRT1/2 while strongly inducing CsFRO1. Si demonstrated the most comprehensive stimulatory effect, enhancing expression of all measured transporter genes (CsFRO1, CsHA1/2, and CsIRT1). These transcriptional responses correlated with physiological outcomes, as evidenced by significantly positive relationships between CsFRO1/CsHA2 expression levels and leaf Fe levels. It is consistent with observations in AMF-inoculated sunflower [59] and Azospirillum-treated cucumber [60,61], thereby confirming the established paradigm of microbially enhanced Fe acquisition. Root fungal colonization rate was significantly positively correlated with Fe levels and CsFRO1/CsHA2 expression levels, and Fe content significantly positively correlated with CsFRO1 and CsHA2 expression. This suggests that in ‘Beni-Madonna’, fungal symbiosis accelerated host CsFRO1/CsHA2 expression to increase Fe accumulation. The observed gene expression patterns align with established Fe acquisition mechanisms in plants. The induction of CsFRO1 corresponds to its well-documented role in ferric chelate reductase activity, essential for Fe3+ reduction prior to uptake [62]. The upregulation of CsIRT1 reflects its crucial function in root Fe2+ transport across plasma membranes [28], and its strain-specific induction suggests the existence of a more complex regulatory context. Notably, the differential response of CsHA1 and CsHA2 to fungal treatments suggests that fungal symbionts may modulate components of the host’s native Fe sensing machinery [63]. In ‘Lane Late’, Fm and Si treatments broadly activated the iron transporter network (CsFRO1, CsHA2, and CsIRT1/2), while Dv inoculation only significantly induced CsFRO1 expression. This cultivar-specific pattern may indicate fundamental differences in Fe homeostasis regulation, potentially involving varied sensitivity to fungal-derived iron-mobilizing signals, differential expression of upstream transcription factors (e.g., FIT homologs), and distinct Fe storage and remobilization capacities [64,65,66]. The comprehensive transcriptional activation by Si across both cultivars suggests this endophyte may employ unique signaling pathways to enhance Fe acquisition [67]. However, unlike in ‘Beni-Madonna’, the root colonization rate ‘Lane Late’ did not show a significantly positive correlation with Fe levels, and Fe levels were not significantly correlated with any Fe transporter genes, despite exhibiting significantly positive correlations with the expression of all tested Fe transporter genes. This difference may be related to the signal transduction processes and the varying grafting ages of the two varieties through their rootstock-scion combinations.
The regulation of MGTs by fungal symbionts in citrus cultivars reveals complex, cultivar-specific modulation of Mg2+ homeostasis. In ‘Beni-Madonna’, Fm inoculation significantly upregulated CsMGT2 and CsMGT8 expression, with a strong positive correlation observed between leaf Mg2+ content and CsMGT2 transcript levels, consistent with the functional role of SlMGT1-1 in tomato [19]. This suggests CsMGT2 plays a predominant role in Mg2+ acquisition and distribution in this cultivar. Interestingly, both Dv and Si treatments downregulated CsMGT5/6/8 while Si specifically enhanced CsMGT2 expression, potentially indicating a compensatory mechanism where reduced competition among transporter isoforms facilitates CsMGT2-mediated Mg2+ flux [68]. In contrast, ‘Lane Late’ exhibited distinct response patterns: Fm comprehensively upregulated CsMGT2/5/8, likely enhancing whole-plant Mg2+ accumulation, while Dv suppressed all CsMGT expression. The differential response pattern between Fm and Dv may involve fungal-derived effector molecules targeting promoter regions of specific MGT genes [69]. Si treatment in ‘Lane Late’ uniquely increased CsMGT6 expression, suggesting alternative regulatory pathways compared to ‘Beni-Madonna’. Correlation analyses uncovered contrasting associations between fungal colonization, Mg content, and Mg transporter gene expression in the two citrus cultivars. In ‘Beni-Madonna’, root colonization rates showed a positive correlation with leaf Mg but a negative correlation with CsMGT5/6 expression, suggesting that fungal symbionts may enhance Mg accumulation through mechanisms that downregulate specific transporter isoforms. Mg content was exclusively positively correlated with CsMGT2, suggesting that fungal symbionts appear to optimize Mg uptake primarily via CsMGT2 upregulation in this cultivar. In ‘Lane Late’, root colonization rates exhibited a negative correlation with Mg concentration but a positive correlation with CsMGT6/8 expression, implying that increased fungal colonization may redirect Mg allocation without necessarily improving overall tissue Mg status. Mg levels were negatively correlated with CsMGT8 only in ‘Lane Late’, potentially indicating feedback inhibition or competition among MGT isoforms. Fungal colonization may trigger alternative Mg partitioning strategies in ‘Lane Late’, where increased CsMGT6/8 expression does not translate to higher Mg accumulation, possibly due to internal redistribution (e.g., root storage vs. shoot translocation).

5. Conclusions

In this study, integrating fungal inoculation, particularly with AMF and Si, could enhance citrus by improving growth, photosynthetic efficiency, and nutrient acquisition. The cultivar-specific variations observed in response to these treatments underscore the importance of customizing fungal applications to match the unique growth strategies and nutrient needs of different citrus cultivars. ‘Beni-Madonna’ and ‘Lane Late’ cultivars showed positive responses to fungal treatments, with Si demonstrating particularly superior colonization efficiency. Fungal inoculation differentially enhanced multiple physiological parameters, including spring shoot growth, leaf gas exchange characteristics, endogenous hormone levels, and mineral nutrient acquisition. At the molecular level, Fm and Si treatments upregulated the expression of Fe transporter genes (CsFRO1 and CsIRT1) in both cultivars. Additionally, Fm inoculation enhanced the expression of Mg transporter genes (CsMGT2 and CsMGT8). However, the magnitude of these beneficial effects showed clear host genotype × fungal strain specificity. Since this study was conducted under potted conditions, with two varieties grafted in different years and within a constrained soil environment, these factors may have influenced the functionality of endophytic fungi in later stages. Future studies should focus on the specific molecular mechanisms underlying varietal responses to endophytic fungi. In addition, Si is the recommended inoculant for ‘Beni-Madonna’, whereas Fm is the preferred choice for ‘Lane Late’ navel oranges. This result under potted conditions remains to be further validated under field conditions, and whether the results apply to field environments with varying soil water and pest pressures remains to be verified. In addition, future research should involve long-term field trials to evaluate the sustained effects of fungal inoculation over multiple growing seasons and under varying environmental conditions, as well as explore its synergy with agronomic practices such as irrigation and fertilization to optimize citrus orchard management.

Author Contributions

Conceptualization, Q.-S.W.; Data curation, Z.-Y.R. and Y.-X.W.; Investigation, Z.-Y.R. and Y.L.; Methodology, Z.-Y.R. and Y.-X.W.; Resources, Y.-N.Z. and Q.-S.W.; Supervision, Q.-S.W.; Writing—original draft, Y.-X.W.; Writing—review & editing, Y.-N.Z. and Q.-S.W. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Hubei Agricultural Science and Technology Innovation Action Project (Hubei Nongfa [2018] No. 1).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare that there are not any potential conflicts of interest.

References

  1. Lu, X.M.; Zhao, C.Y.; Shi, H.; Liao, Y.C.; Xu, F.; Du, H.J.; Xiao, H.; Zheng, J.K. Nutrients and bioactives in citrus fruits: Different citrus varieties, fruit parts, and growth stages. Crit. Rev. Food Sci. 2023, 63, 2018–2041. [Google Scholar] [CrossRef]
  2. Liu, S.S.; Qian, M.F. Introduction and efficient cultivation techniques of the new citrus variety ‘Beni-Madonna’. Jiangxi Agric. 2020, 10, 11–12. [Google Scholar]
  3. Hu, Y.P. Comparison and Analysis of Fruit Quality of ‘Lant Late’ and ‘Newhall’ Navel Orange. Master’s Thesis, Huazhong Agricultural University, Wuhan, China, 2024. [Google Scholar]
  4. Singh, R.; Singh, G.S. Traditional agriculture: A climate-smart approach for sustainable food production. Energy Ecol. Environ. 2017, 2, 296–316. [Google Scholar] [CrossRef]
  5. Shafqat, W.; Naqvi, S.A.; Maqbool, R.; Haider, M.S.; Jaskani, M.J.; Khan, I.A. Climate change and citrus. In Citrus-Research, Development and Biotechnology; Khan, M.S., Khan, I.A., Eds.; IntechOpen: London, UK, 2021; pp. 147–164. [Google Scholar]
  6. Hyde, K.D.; Soytong, K. The fungal endophyte dilemma. Fungal Divers. 2008, 33, 173. [Google Scholar]
  7. Smith, S.E.; Jakobsen, I.; Grønlund, M.; Smith, F.A. Roles of arbuscular mycorrhizas in plant phosphorus nutrition: Interactions between pathways of phosphorus uptake in arbuscular mycorrhizal roots have important implications for understanding and manipulating plant phosphorus acquisition. Plant Physiol. 2011, 156, 1050–1057. [Google Scholar] [CrossRef]
  8. Basu, S.; Rabara, R.C.; Negi, S. AMF: The future prospect for sustainable agriculture. Physiol. Mol. Plant Pathol. 2018, 102, 36–45. [Google Scholar] [CrossRef]
  9. Khaliq, A.; Perveen, S.; Alamer, K.H.; Zia Ul Haq, M.; Rafique, Z.; Alsudays, I.M.; Althobaiti, A.T.; Saleh, M.A.; Hussain, S.; Attia, H. Arbuscular mycorrhizal fungi symbiosis to enhance plant-soil interaction. Sustainability 2022, 14, 7840. [Google Scholar] [CrossRef]
  10. Battini, F.; Grønlund, M.; Agnolucci, M.; Giovannetti, M.; Jakobsen, I. Facilitation of phosphorus uptake in maize plants by mycorrhizosphere bacteria. Sci. Rep. 2017, 7, 4686. [Google Scholar] [CrossRef]
  11. Wang, D.; Wu, W.J.; Tian, X.; Xiang, N.; Hashem, A.; Abd_Allah, E.F.; Wu, Q.S.; Zou, Y.N. AMF improves response to waterlogging stress in cucumber. Rhizosphere 2024, 30, 100891. [Google Scholar] [CrossRef]
  12. Cheng, H.Q.; Zou, Y.N.; Wu, Q.S.; Kuča, K. Arbuscular mycorrhizal fungi alleviate drought stress in trifoliate orange by regulating H+-ATPase activity and gene expression. Front. Plant Sci. 2021, 12, 659694. [Google Scholar] [CrossRef] [PubMed]
  13. Huang, G.M.; Zou, Y.N.; Wu, Q.S.; Xu, Y.J.; Kuča, K. Mycorrhizal roles in plant growth, gas exchange, root morphology, and nutrient uptake of walnuts. Plant Soil Environ. 2020, 66, 295–302. [Google Scholar] [CrossRef]
  14. Smith, S.E.; Dickson, S.; Smith, F.A. Nutrient transfer in arbuscular mycorrhizas: How are fungal and plant processes integrated? Funct. Plant Biol. 2001, 28, 685–696. [Google Scholar] [CrossRef]
  15. Lanfranco, L.; Fiorilli, V.; Gutjahr, C. Partner communication and role of nutrients in the arbuscular mycorrhizal symbiosis. New Phytol. 2018, 220, 1031–1046. [Google Scholar] [CrossRef]
  16. Zou, Y.N.; Xu, Y.J.; Liu, R.C.; Huang, G.M.; Kuča, K.; Srivastava, A.K.; Hashem, A.; Abd_Allah, E.F.; Wu, Q.S. Two different strategies of Diversispora spurca-inoculated walnut seedlings to improve leaf P acquisition at low and moderate P levels. Front. Plant Sci. 2023, 14, 1140467. [Google Scholar] [CrossRef] [PubMed]
  17. Weber, S.E.; Bascompte, J.; Kahmen, A.; Niklaus, P.A. Plant choice between arbuscular mycorrhizal fungal species results in increased plant P acquisition. PLoS ONE 2024, 19, e0292811. [Google Scholar] [CrossRef]
  18. Rahman, M.A.; Parvin, M.; Das, U.; Ela, E.J.; Lee, S.H.; Lee, K.W.; Kabir, A.H. Arbuscular mycorrhizal symbiosis mitigates iron (Fe)-deficiency retardation in Alfalfa (Medicago sativa L.) through the enhancement of Fe accumulation and sulfur-assisted antioxidant defense. Int. J. Mol. Sci. 2020, 21, 2219. [Google Scholar] [CrossRef]
  19. Liu, J.J.; Fang, L.; Pei, W.X.; Li, F.Y.; Zhao, J.R. Effects of magnesium application on the arbuscular mycorrhizal symbiosis in tomato. Symbiosis 2023, 89, 73–82. [Google Scholar] [CrossRef]
  20. Kandalgaonkar, K.N.; Barvkar, V.T. Intricate phytohormonal orchestration mediates mycorrhizal symbiosis and stress tolerance. Mycorrhiza 2025, 35, 1–20. [Google Scholar] [CrossRef]
  21. Liu, R.C.; Yang, L.; Zou, Y.N.; Wu, Q.S. Root-associated endophytic fungi modulate endogenous auxin and cytokinin levels to improve plant biomass and root morphology of trifoliate orange. Hortic. Plant J. 2022, 9, 463–472. [Google Scholar] [CrossRef]
  22. Varma, A.; Sree, K.S.; Arora, M.; Bajaj, R.; Prasad, R.; Kharkwal, A.C. Functions of novel symbiotic fungus-Piriformospora indica. Proc. Indian Natl. Sci. Acad. 2014, 80, 429–441. [Google Scholar] [CrossRef]
  23. Verma, S.; Varma, A.; Rexer, K.H.; Hassel, A.; Kost, G.; Sarbhoy, A.; Franken, P. Piriformospora indica, gen. et sp. nov., a new root-colonizing fungus. Mycologia 1998, 90, 896–903. [Google Scholar] [CrossRef]
  24. Wan, Y.X.; Kapoor, R.; da Silva, F.S.B.; Abd-Allah, E.F.; Kuča, K.; Hashem, A.; Wu, Q.S. Elucidating the mechanism regarding enhanced tolerance in plants to abiotic stress by Serendipita indica. Plant Growth Regul. 2024, 103, 271–281. [Google Scholar] [CrossRef]
  25. Saleem, S.; Sekara, A.; Pokluda, R. Serendipita indica—A review from agricultural point of view. Plants 2022, 11, 3417. [Google Scholar] [CrossRef] [PubMed]
  26. Shukla, J.; Mohd, S.; Kushwaha, A.S.; Narayan, S.; Saxena, P.N.; Bahadur, L.; Kumar, M. Endophytic fungus Serendipita indica reduces arsenic mobilization from root to fruit in colonized tomato plant. Environ. Pollut. 2022, 298, 118830. [Google Scholar] [CrossRef]
  27. Cao, J.L.; He, W.X.; Zou, Y.N.; Wu, Q.S. An endophytic fungus, Piriformospora indica, enhances drought tolerance of trifoliate orange by modulating the antioxidant defense system and composition of fatty acids. Tree Physiol. 2023, 43, 452–466. [Google Scholar] [CrossRef]
  28. Rong, Z.Y.; Lei, A.Q.; Wu, Q.S.; Srivastava, A.K.; Hashem, A.; Abd_Allah, E.F.; Yang, T. Serendipita indica promotes P acquisition and growth in tea seedlings under P deficit conditions by increasing cytokinins and indoleacetic acid and phosphate transporter gene expression. Front. Plant Sci. 2023, 14, 1146182. [Google Scholar] [CrossRef]
  29. Zheng, F.L.; Tan, Z.P.; Zhang, Y.; Xu, X.H.; Hashem, A.; Debnath, A.; Wu, Q.S. Enhancing walnut growth and drought tolerance through Serendipita indica: Focus on mitochondrial antioxidant defense. Plant Growth Regul. 2024, 104, 1697–1706. [Google Scholar] [CrossRef]
  30. Cheng, X.F.; Xie, M.M.; Li, Y.; Liu, B.Y.; Liu, C.Y.; Wu, Q.S.; Kuča, K. Effects of field inoculation with arbuscular mycorrhizal fungi and endophytic fungi on fruit quality and soil properties of Newhall navel orange. Appl. Soil Ecol. 2022, 170, 104308. [Google Scholar] [CrossRef]
  31. Yang, L.; Cao, J.L.; Zou, Y.N.; Wu, Q.S.; Kuča, K. Piriformospora indica: A root endophytic fungus and its roles in plants. Not. Bot. Horti Agrobot. 2020, 48, 1–13. [Google Scholar] [CrossRef]
  32. Phillips, J.M.; Hayman, W.D. Improved procedures for clearing roots and staining parasitic and vesicular-arbuscular mycorrhizal fungi for rapid assessment of infection. Trans. Br. Mycol. Soc. 1970, 55, 158–161. [Google Scholar] [CrossRef]
  33. Martínez-Cuenca, M.R.; Forner-Giner, M.Á.; Iglesias, D.J.; Primo-Millo, E.; Legaz, F. Strategy I responses to Fe-deficiency of two citrus rootstocks differing in their tolerance to iron chlorosis. Sci. Hortic. 2013, 153, 56–63. [Google Scholar] [CrossRef]
  34. Liu, X.; Guo, L.X.; Luo, L.J.; Liu, Y.Z.; Peng, S.A. Identifcation of the magnesium transport (MGT) family in Poncirus trifoliata and functional characterization of PtrMGT5 in magnesium deficiency stress. Plant Mol. Biol. 2019, 101, 551–560. [Google Scholar] [CrossRef]
  35. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  36. Heidarianpour, M.B.; Aliasgharzad, N.; Olsson, P.A. Positive effects of co-inoculation with Rhizophagus irregularis and Serendipita indica on tomato growth under saline conditions, and their individual colonization estimated by signature lipids. Mycorrhiza 2020, 30, 455–466. [Google Scholar] [CrossRef] [PubMed]
  37. Dumbrell, A.J. Arbuscular mycorrhizal fungi throughout the year: Using massively parallel pyrosequencing to quantify spatiotemporal seasonal dynamics. In Molecular Microbial Ecology of the Rhizosphere, 1st ed.; Buscot, F., Varma, A., Eds.; Wiley-Blackwell: Hoboken, NJ, USA, 2013; Volume 1, pp. 1113–1122. [Google Scholar]
  38. Xin, G.; Ye, S.P.; Wu, E.N.; Wang, Y.T.; Sugawara, K. Seasonal dynamics in arbuscular mycorrhizal fungal colonization and spore numbers in the rhizosphere of Dactylis glomerata L. and Trifolium repens L. Pak. J. Bot. 2012, 44, 2087–2092. [Google Scholar]
  39. Deng, X.X.; Cao, W.X.; Wang, S.L.; Wang, W.H.; Liu, W.T. Diversity and seasonal dynamics of culturable endophytic fungi from two Salix species roots in alpine shrub grassland. Chin. J. Ggrassl. 2023, 45, 89–98. [Google Scholar]
  40. Xu, L.; Wu, C.; Oelmüller, R.; Zhang, W. Role of phytohormones in Piriformospora indica-induced growth promotion and stress tolerance in plants: More questions than answers. Front. Microbiol. 2018, 9, 1646. [Google Scholar] [CrossRef] [PubMed]
  41. Shi, Y.S.; Lai, C.W.; Liu, L.; Zhou, Y.Y.; Xie, J. Research on biochemical defense strategies of plants in response to abiotic stress. J. Org. Chem. Res. 2023, 11, 346–355. [Google Scholar] [CrossRef]
  42. Lehmann, A.; Rillig, M.C. Arbuscular mycorrhizal contribution to copper, manganese and iron nutrient concentrations in crops-a meta-analysis. Soil Biol. Biochem. 2015, 81, 147–158. [Google Scholar] [CrossRef]
  43. Christian, N.; Perlin, M.H. Plant-endophyte communication: Scaling from molecular mechanisms to ecological outcomes. Mycologia 2024, 116, 227–250. [Google Scholar] [CrossRef]
  44. Smith, S.E.; Smith, F.A. Roles of arbuscular mycorrhizas in plant nutrition and growth: New paradigms from cellular to ecosystem scales. Annu. Rev. Plant Biol. 2011, 62, 227–250. [Google Scholar] [CrossRef]
  45. Wan, Y.X.; Liang, S.M.; Wu, Q.S.; Hashem, A.; Abd_Allah, E.F.; Zou, Y.N. Serendipita indica accelerates chlorophyll synthesis pathway and photosynthetic efficiency in trifoliate orange subjected to water deficit. Sci. Hortic. 2024, 338, 113667. [Google Scholar] [CrossRef]
  46. Mathur, S.; Tomar, R.S.; Jajoo, A. Arbuscular mycorrhizal fungi (AMF) protects photosynthetic apparatus of wheat under drought stress. Photosynth. Res. 2019, 139, 227–238. [Google Scholar] [CrossRef]
  47. Zheng, M.J.; Zhong, S.P.; Wang, W.J.; Tang, Z.Z.; Bu, T.L.; Li, Q.F. Serendipita indica promotes the growth of tartary buckwheat by stimulating hormone synthesis, metabolite production, and increasing systemic resistance. J. Fungi 2023, 9, 1114. [Google Scholar] [CrossRef] [PubMed]
  48. Oelmüller, R.; Sherameti, I.; Tripathi, S.; Varma, A. Piriformospora indica, a cultivable root endophyte with multiple biotechnological applications. Symbiosis 2009, 49, 1–17. [Google Scholar] [CrossRef]
  49. Rong, Z.Y.; Zhang, Z.Z.; Alqahtani, M.D.; Wu, Q.S.; Gao, X.B. Serendipita indica is a biostimulant that improves tea growth at low P levels by modulating P acquisition and hormone levels. Rhizosphere 2023, 28, 100796. [Google Scholar] [CrossRef]
  50. He, L.; Li, C.Y.; Liu, R.J. Indirect interactions between arbuscular mycorrhizal fungi and Spodoptera exigua alter photosynthesis and plant endogenous hormones. Mycorrhiza 2017, 27, 525–535. [Google Scholar] [CrossRef] [PubMed]
  51. Jakobsen, S.T. Interaction between plant nutrients: IV. Interaction between calcium and phosphate. Acta Agric. Scand. Sect. B Soil Plant Sci. 1993, 43, 6–10. [Google Scholar] [CrossRef]
  52. Lee, Y.J. Subcellular distribution of P and Ca in arbuscular mycorrhizal plant: An X-ray microanalytical study. J. Appl. Biol. Chem. 2004, 47, 189–193. [Google Scholar]
  53. Wu, F.; Zhang, H.Q.; Fang, F.R.; Wu, N.; Zhang, Y.X.; Tang, M. Effects of nitrogen and exogenous Rhizophagus irregularis on the nutrient status, photosynthesis and leaf anatomy of Populus × canadensis ‘Neva’. J. Plant Growth Regul. 2017, 36, 824–835. [Google Scholar] [CrossRef]
  54. Lü, X.T.; Huang, X.P.; Wang, Y.; Wang, C.S.; Cheng, F.X. Study on the symbiotic effect of Piriformis indica and hybrid orchid. Southeast Hortic. 2020, 8, 20–24. [Google Scholar]
  55. Amir, H.; Gensous, S.; Cavaloc, Y.; Wantiez, L. Phosphorus fertilization of an ultramafic soil reduced effects of arbuscular mycorrhizal fungi but not mycorrhizal colonization. J. Soil Sci. Plant Nutr. 2021, 21, 3544–3554. [Google Scholar] [CrossRef]
  56. Wang, J.H.; Sui, J.K.; Cui, L.J.; Shi, K.M. Effects of AMF on the growth and physiological characteristics of Phoebe zhennan under salt stress. J. Central South Univ. For. Technol. 2023, 43, 51–58. [Google Scholar]
  57. Upadhayay, V.K.; Singh, J.; Khan, A.; Lohani, S.; Singh, A.V. Mycorrhizal mediated micronutrients transportation in food-based plants: A biofortification strategy. In Mycorrhizosphere and Pedogenesis; Varma, A., Choudhary, D.K., Eds.; Springer: Singapore, 2019; pp. 1–24. [Google Scholar]
  58. Rui, W.; Mao, Z.; Li, Z. The roles of phosphorus and nitrogen nutrient transporters in the arbuscular mycorrhizal symbiosis. Int. J. Mol. Sci. 2022, 23, 11027. [Google Scholar] [CrossRef]
  59. Kabir, A.H.; Debnath, T.; Das, U.; Prity, S.A.; Haque, A.; Rahman, M.M.; Parvez, M.S. Arbuscular mycorrhizal fungi alleviate Fe-deficiency symptoms in sunflower by increasing iron uptake and its availability along with antioxidant defense. Plant Physiol. Biochem. 2020, 150, 254–262. [Google Scholar] [CrossRef]
  60. Pii, Y.; Borruso, L.; Brusetti, L.; Crecchio, C.; Cesco, S.; Mimmo, T. The interaction between iron nutrition, plant species and soil type shapes the rhizosphere microbiome. Plant Physiol. Biochem. 2016, 99, 39–48. [Google Scholar] [CrossRef]
  61. Zhou, C.; Guo, J.S.; Zhu, L.; Xiao, X.; Xie, Y.; Zhu, J.; Ma, Z.Y.; Wang, J.F. Paenibacillus polymyxa BFKC01 enhances plant iron absorption via improved root systems and activated iron acquisition mechanisms. Plant Physiol. Biochem. 2016, 105, 162–173. [Google Scholar] [CrossRef]
  62. Urwat, U.; Ahmad, S.M.; Masi, A.; Ganai, N.A.; Murtaza, I.; Khan, I.; Zargar, S.M. Fe and Zn stress induced gene expression analysis unraveled mechanisms of mineral homeostasis in common bean (Phaseolus vulgaris L.). Sci. Rep. 2021, 11, 24026. [Google Scholar] [CrossRef] [PubMed]
  63. Santi, S.; Cesco, S.; Varanini, Z.; Pinton, R. Two plasma membrane H+-ATPase genes are differentially expressed in iron-deficient cucumber plants. Plant Physiol. Biochem. 2005, 43, 287–292. [Google Scholar] [CrossRef] [PubMed]
  64. Schmidt, W. Iron homeostasis in plants: Sensing and signaling pathways. J. Plant Nutr. 2003, 26, 2211–2230. [Google Scholar] [CrossRef]
  65. Zulfiqar, U.; Albadrani, G.M.; Hussain, S. Mechanisms of Iron uptake and homeostasis in plants: Implications for biofortification in cereal grains. In Mineral Biofortification in Crop Plants for Ensuring Food Security; Hasanuzzaman, M., Tahir, M.S., Tanveer, M., Shah, A.N., Eds.; Springer: Singapore, 2023; pp. 121–137. [Google Scholar]
  66. Li, S.Z.; Ma, S.A.; Song, Z.Z.; Li, Y.; Liu, X.Q.; Yang, W.Z.; Wang, T.Y.; Zhou, X.J.; Chen, R.M. Regulatory mechanisms of iron homeostasis in maize mediated by ZmFIT. Crop J. 2024, 12, 1426–1436. [Google Scholar] [CrossRef]
  67. Briat, J.F. Iron dynamics in plants. Adv. Bot. Res. 2007, 46, 137–180. [Google Scholar]
  68. Tang, L.; Xiao, L.D.; Huang, Y.F.; Xiao, B.; Gong, C.M. Cloning and magnesium transport function analysis of CsMGTs genes in tea plants (Camellia sinensis). J. Tea Sci. 2021, 41, 761–776. [Google Scholar]
  69. Betz, R.; Heidt, S.; Figueira-Galán, D.; Hartmann, M.; Langner, T.; Requena, N. Alternative splicing regulation in plants by SP7-like effectors from symbiotic arbuscular mycorrhizal fungi. Nat. Commun. 2024, 15, 7107. [Google Scholar] [CrossRef]
Horticulturae 11 01321 g001
Figure 1. Effects of root-associated endophytic fungi inoculation on spring shoot number, length, diameter, plant height, and stem diameter in ‘Beni-Madonna’ (a–e) and ‘Lane Late’ (f–j) navel orange. Values represent means ± SD (n = 5). Different letters above the bars indicate significant (p < 0.05) differences based on Duncan’s multiple range test. Abbreviations: Control, non-inoculated treatment; Fm, Funneliformis mosseae; Dv, Diversispora versiformis; Si, Serendipita indica.
Figure 1. Effects of root-associated endophytic fungi inoculation on spring shoot number, length, diameter, plant height, and stem diameter in ‘Beni-Madonna’ (a–e) and ‘Lane Late’ (f–j) navel orange. Values represent means ± SD (n = 5). Different letters above the bars indicate significant (p < 0.05) differences based on Duncan’s multiple range test. Abbreviations: Control, non-inoculated treatment; Fm, Funneliformis mosseae; Dv, Diversispora versiformis; Si, Serendipita indica.
Horticulturae 11 01321 g001
Horticulturae 11 01321 g002
Figure 2. Effects of root-associated endophytic fungi inoculation on Pn, Gs, and Tr in ‘Beni-Madonna’ (a–c) and ‘Lane Late’ (d–f) navel orange. Values represent means ± SD (n = 5). Different letters above the bars indicate significant (p < 0.05) differences based on Duncan’s multiple range test. Abbreviations: Control, non-inoculated treatment; Fm, Funneliformis mosseae; Dv, Diversispora versiformis; Si, Serendipita indica; Pn, net photosynthetic rate; Gs, stomatal conductance; Tr, transpiration rate.
Figure 2. Effects of root-associated endophytic fungi inoculation on Pn, Gs, and Tr in ‘Beni-Madonna’ (a–c) and ‘Lane Late’ (d–f) navel orange. Values represent means ± SD (n = 5). Different letters above the bars indicate significant (p < 0.05) differences based on Duncan’s multiple range test. Abbreviations: Control, non-inoculated treatment; Fm, Funneliformis mosseae; Dv, Diversispora versiformis; Si, Serendipita indica; Pn, net photosynthetic rate; Gs, stomatal conductance; Tr, transpiration rate.
Horticulturae 11 01321 g002
Horticulturae 11 01321 g003
Figure 3. Effects of root-associated endophytic fungi inoculation on TZ, IAA, IBA, IP, and DZ levels in leaves of ‘Beni-Madonna’ (a) and ‘Lane Late’ (b) navel orange. Values represent means ± SD (n = 5). Different letters above the bars indicate significant (p < 0.05) differences based on Duncan’s multiple range test. Abbreviations: Control, non-inoculated treatment; Fm, Funneliformis mosseae; Dv, Diversispora versiformis; Si, Serendipita indica; TZ, trans-zeatin; IAA, indole-3-acetic acid; IBA, indole-3-butyric acid; IP, isopentenyladenine; DZ, dihydrozeatin.
Figure 3. Effects of root-associated endophytic fungi inoculation on TZ, IAA, IBA, IP, and DZ levels in leaves of ‘Beni-Madonna’ (a) and ‘Lane Late’ (b) navel orange. Values represent means ± SD (n = 5). Different letters above the bars indicate significant (p < 0.05) differences based on Duncan’s multiple range test. Abbreviations: Control, non-inoculated treatment; Fm, Funneliformis mosseae; Dv, Diversispora versiformis; Si, Serendipita indica; TZ, trans-zeatin; IAA, indole-3-acetic acid; IBA, indole-3-butyric acid; IP, isopentenyladenine; DZ, dihydrozeatin.
Horticulturae 11 01321 g003
Horticulturae 11 01321 g004
Figure 4. Effects of root-associated endophytic fungi inoculation on mineral element concentrations in leaves of ‘Beni-Madonna’ (a,b) and ‘Lane Late’ (c,d) navel orange. Values represent means ± SD (n = 5). Different letters above the bars indicate significant (p < 0.05) differences based on Duncan’s multiple range test. Abbreviation: Control, non-inoculated treatment; Fm, Funneliformis mosseae; Dv, Diversispora versiformis; Si, Serendipita indica.
Figure 4. Effects of root-associated endophytic fungi inoculation on mineral element concentrations in leaves of ‘Beni-Madonna’ (a,b) and ‘Lane Late’ (c,d) navel orange. Values represent means ± SD (n = 5). Different letters above the bars indicate significant (p < 0.05) differences based on Duncan’s multiple range test. Abbreviation: Control, non-inoculated treatment; Fm, Funneliformis mosseae; Dv, Diversispora versiformis; Si, Serendipita indica.
Horticulturae 11 01321 g004
Horticulturae 11 01321 g005
Figure 5. Effects of root-associated endophytic fungi inoculation on the expression of Fe (CsFRO1, CsHA1, CsHA2, CsIRT1, and CsIRT2) and Mg (CsMGT2, CsMGT5, CsMGT6, and CsMGT8) transporter genes mineral element concentrations in leaves of ‘Beni-Madonna’ (a,b) and ‘Lane Late’ (c,d) navel orange. Values represent means ± SD (n = 5). Different letters above the bars indicate significant differences (p < 0.05) based on Duncan’s multiple range test. Abbreviations: Control, non-inoculated treatment; Fm, Funneliformis mosseae; Dv, Diversispora versiformis; Si, Serendipita indica.
Figure 5. Effects of root-associated endophytic fungi inoculation on the expression of Fe (CsFRO1, CsHA1, CsHA2, CsIRT1, and CsIRT2) and Mg (CsMGT2, CsMGT5, CsMGT6, and CsMGT8) transporter genes mineral element concentrations in leaves of ‘Beni-Madonna’ (a,b) and ‘Lane Late’ (c,d) navel orange. Values represent means ± SD (n = 5). Different letters above the bars indicate significant differences (p < 0.05) based on Duncan’s multiple range test. Abbreviations: Control, non-inoculated treatment; Fm, Funneliformis mosseae; Dv, Diversispora versiformis; Si, Serendipita indica.
Horticulturae 11 01321 g005
Horticulturae 11 01321 g006
Figure 6. Correlation heatmaps. Here, (a,b) show correlations of root colonization, shoot growth, plant performance, and hormones in ‘Beni-Madonna’ and ‘Lane Late’, respectively; (c,d) indicated correlations between Fe/Mg contents and their transport genes in ‘Beni-Madonna’ and ‘Lane Late’, respectively.
Figure 6. Correlation heatmaps. Here, (a,b) show correlations of root colonization, shoot growth, plant performance, and hormones in ‘Beni-Madonna’ and ‘Lane Late’, respectively; (c,d) indicated correlations between Fe/Mg contents and their transport genes in ‘Beni-Madonna’ and ‘Lane Late’, respectively.
Horticulturae 11 01321 g006
Table 1. Primer sequences used for qRT-PCR analysis of Fe/Mg transporter genes.
Table 1. Primer sequences used for qRT-PCR analysis of Fe/Mg transporter genes.
Gene NameAccession NumberSequence of Forward Prime (5′→3′)Sequence of Reverse Primer (5′→3′)
CsFRO1Cs3g01120GATCGATTTCTGCGGTTCTGAACTCAGGGCATTGTATCGT
CsHA1Cs7g07300GATTGATCAGTCTGCCCTCACCACTGCCTCTATTTCACCT
CsHA2Cs5g04360ACCCTTGAGAAAACAGCTCAAAGACCAACTTCTTGACCGT
CsIRT1Cs2g10720ACCCTTGAGAAAACAGCTCAAAGACCAACTTCTTGACCGT
CsIRT2Cs_ont_8g000350CAGGCAGGATTCAACTTTGGTCATAGCCCGTCACTGAAAA
CsMGT2Cs7g11510AACAAAGGCTGGACTCTTCAGCAATTTCTGAGCTCCACTG
CsMGT5Cs3g06130ACGACAACGAAGATATGGCTGATGGGATGCTTTAGGGACA
CsMGT6Cs9g08150ATGACTAGGTTGACTGCTCGCCAATTAGCAGCACCTGAAC
CsMGT8Cs8g03920CAGTTCACAGCACAGTAAGCGTCTACATACTCCCTCAGCG
β-ActinCs1g05000CCGACCGTATGAGCAAGGAAATTCCTGTGGACAATGGATGGA
Table 2. Effects of root-associated endophytic fungi inoculation on fungal colonization rates (%) in roots of four-year-old ‘Beni-Madonna’ and two-year old ‘Lane Late’ navel orange at different stages.
Table 2. Effects of root-associated endophytic fungi inoculation on fungal colonization rates (%) in roots of four-year-old ‘Beni-Madonna’ and two-year old ‘Lane Late’ navel orange at different stages.
CultivarsTreatmentsMarchJuneSeptemberDecember
Beni-MadonnaControl3.1 ± 0.2 d3.2 ± 0. 6 c3.6 ± 0.6 c3.4 ± 0.7 c
Fm20.6 ± 1. 9 c23.3 ± 4.3 b26.3 ± 4.3 b21.4 ± 2.9 b
Dv26.9 ± 5.5 b26.1 ± 2.8 b27. 8 ± 5.41 b26.8 ± 1.9 b
Si51.5 ± 5.6 a56.6 ± 10.5 a61.3 ± 9.6 a52.8 ± 9.6 a
Lane LateControl2.8 ± 0.4 d3.2 ± 0.3 d3.5 ± 0.4 d3.1 ± 0.6 d
Fm24.9 ± 2.9 b26.9 ± 3.5 b32.0 ± 5.2 b23.1 ± 2.7 b
Dv18.3 ± 2.4 c18.9 ± 2.1 c21.9 ± 2.6 c17.4 ± 2.2 c
Si55.4 ± 7.4 a56.2 ± 8.7 a62.4 ± 12.0 a55.6 ± 7.9 a
Note: Data (means ± SD, n = 5) followed by different letters at a month in a variety indicate significant (p < 0.05) differences, as determined by Duncan’s multiple range test. Abbreviation: Control, non-inoculated treatment; Fm, Funneliformis mosseae; Dv, Diversispora versiformis; Si, Serendipita indica.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wan, Y.-X.; Lü, Y.; Rong, Z.-Y.; Zou, Y.-N.; Wu, Q.-S. Host Genotype Shapes Fungal Symbiont-Mediated Nutrient and Growth Benefits in Citrus. Horticulturae 2025, 11, 1321. https://doi.org/10.3390/horticulturae11111321

AMA Style

Wan Y-X, Lü Y, Rong Z-Y, Zou Y-N, Wu Q-S. Host Genotype Shapes Fungal Symbiont-Mediated Nutrient and Growth Benefits in Citrus. Horticulturae. 2025; 11(11):1321. https://doi.org/10.3390/horticulturae11111321

Chicago/Turabian Style

Wan, Yu-Xi, Yang Lü, Zi-Yi Rong, Ying-Ning Zou, and Qiang-Sheng Wu. 2025. "Host Genotype Shapes Fungal Symbiont-Mediated Nutrient and Growth Benefits in Citrus" Horticulturae 11, no. 11: 1321. https://doi.org/10.3390/horticulturae11111321

APA Style

Wan, Y.-X., Lü, Y., Rong, Z.-Y., Zou, Y.-N., & Wu, Q.-S. (2025). Host Genotype Shapes Fungal Symbiont-Mediated Nutrient and Growth Benefits in Citrus. Horticulturae, 11(11), 1321. https://doi.org/10.3390/horticulturae11111321

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop