1. Introduction
Xanthomonas campestris pv.
campestris (Xcc) is an important bacterial plant pathogen causing black rot disease and damaging cruciferous crops worldwide [
1]. Xcc is a gram-negative, rod-shaped bacterium, and symptoms of the infection of plants include V-shaped, dark, and necrotic lesions on leaves and blackened veins [
1,
2]. On the field, Xcc infects the host plants by penetrating the stomas and hydathodes of wounds and spreading inside the plant through the vascular system. Since the pathogen is seed-borne, it is more difficult to control and spreads more easily within the regions of cruciferous crop production [
3]. Cruciferous plants include many economically important crops worldwide such as cabbage, kale, broccoli, oilseeds, and mustard. According to the Food and Agriculture Organization of the United Nations (FAO), the estimated worldwide production reached 72.60 million tonnes in 2022. Over 56 million tonnes of cruciferous crops are produced in Asia, 8.5 million tonnes in Europe, 4.3 million tonnes in Africa, and the rest is covered by the America, Australia, and Oceania regions. Cruciferous crops are the typical crops of temperate climate zones [
4,
5]. In regions or years with favorable conditions (high humidity, higher temperatures) the black rot may cause several economic losses of crop production [
6]. Within the Xcc, 11 races have been identified based on avirulence/virulence patterns. Race 1 was identified as the most virulent and widespread of the
B. oleracea crops, representing more than 90% of black rot disease worldwide, together with race 4 [
7].
The source of contamination of Xcc, besides the infected seed, is post-harvest debris or cruciferous weeds. With favorable conditions, including higher precipitation and temperatures between 25 and 30 °C, Xcc enters the vascular system of host plants via hydathodes, or damage caused by insects, animals or human activity [
3,
8,
9]. The root system may also serve as the portal of infection [
10]. According to several studies,
X. hortorum pv.
pelargonii causes the overall wilting and gradual plant death of host plants, as it expands to the root system without any decay or soft rot symptoms [
11,
12,
13]. There are several agricultural practices that can prevent infection, including the use of Xcc-free planting material, crop rotation, and the disposal of plant material that could be the source of infection on the field [
9]. Furthermore, many studies have assessed the effect of various treatments of seeds such as hot water treatment, nanoparticles treatment, or ultraviolet doses to control black rot infection; however, such treatments may also have a negative impact on germination rate [
14,
15,
16]. Another novel approach to black rot control includes the use of bacteriophages, which seems to have promising results [
5,
17]. The application of plant-growth-promoting bacteria (PGPB) (e.g.,
Bacillus,
Pseudomonas,
Enterobacter,
Streptomyces) on rice (
Oryza sativa) not only enhanced plant growth, but also improved biocontrol against the important rice pathogen
X. oryzae pv
. oryzae. Many PGPB are applied through root systems, colonizing them and inducing defense responses against pathogen bacteria [
18,
19]. Thus, the understanding of the Xcc colonization of the vascular system of whole plants, both root and above ground parts, is essential for the development of novel approaches to black rot control [
20].
The host range of Xcc includes many important cruciferous crops such as cabbage (
B. oleracea var.
capitata), broccoli (
B. oleracea var.
italica), kale (
B. oleracea var.
sabauda; Brassica oleracea var.
sabellica), cauliflower (
B. olearceae var.
botrytis), and kohlrabi (
B. oleracea var.
gongylodes), etc. Screening for resistance genes within Brassica species confirmed the partial resistance to several races of Xcc in species
B. rapa,
B. juncea and
B. napus [
3,
21]. Even though Xcc isolates obtained from different cruciferous crops induced symptoms after the artificial inoculation of seven different Brassica species, differences in their virulence were observed [
22].
Among other modern approaches to the evaluation of plant–pathogen interactions, microscopic techniques are widely used for monitoring pathogenic bacteria infection processes. Specifically, confocal microscopy significantly improved plant–pathogen interaction research [
23]. The visualization methods of pathogenic bacteria often include methods based on fluorescence in situ hybridization (FISH) or the use of genetically modified bacteria cultures (e.g., green fluorescent protein (GFP)-expressing bacteria) [
20,
24,
25].
The aim of this study was to (i) monitor Xcc infection progress via the vascular systems of roots and stems at the initial growth stages, after the germination of three different cruciferous crops (cabbage, kale, and kohlrabi); (ii) quantify infection level; and (iii) identify potential significant differences in Xcc dynamics between three Brassica species and their two parts.
2. Materials and Methods
The experiment was conducted at Mendel University in Brno, Faculty of Horticulture, in Lednice, Czech Republic, in 2024 under controlled laboratory conditions. Three species from the Brassicaceae family were chosen as model crops:
- -
Cabbage (Brassica oleracea var. capitata, cultivar ‘Betti’),
- -
Kale (Brassica oleracea var. sabellica, cultivar ‘Scarlet’),
- -
Kohlrabi (Brassica oleracea var. gongylodes, cultivar ‘Ametyst’).
The seeds were sourced from Moravoseed Ltd., (Mikulov, Czech Republic). A portion of the seeds was artificially inoculated with Xcc strain 3811 (WHRI, Horticultural Research International from the University of Warwick, UK) using a vacuum according to [
26]. Following inoculation, the seeds were dried at room temperature on filter paper. Both inoculated and non-inoculated seeds (100 seeds per species and treatment) were sown in trays 12 × 15 × 5 cm and filled with perlite substrate (AGRO CS, Říkov, Czech Republic). The trays were placed in a controlled phytotron (FYTOSCOPE FS-SI-4600, PSI Ltd., Drásov, Czech Republic) environment with temperatures set at 26 °C, 80% relative humidity, and a light regime of 16 h of daylight. The light intensity consisted of 110 µmol of white light and 40 µmol of far-red light. Irrigation was carried out every 2–3 days with tap water, and plants were misted to maintain humidity.
Samples of whole plants, including roots, were collected. Sampling occurred five times: on day 7 after sowing, and then every second day (days 9, 11, 13, and 15). For each sampling, 8 randomly selected plants from both inoculated and non-inoculated groups were collected.
The harvested plants, including roots, were fixed for 6–10 h in 4% paraformaldehyde at 4 °C. Post fixation, the samples were washed with phosphate-buffered saline (PBS, pH 7.4), dehydrated using an ethanol gradient (25%, 50%, 75% ethanol in PBS), each for 30 min at room temperature, and stored at 4 °C until preparation for fluorescence in situ hybridization (FISH). Root segments, 7–10 mm long, were cut, and cross-sections were made at the base of cotyledon leaves. Further dehydration occurred using 99.8% ethanol, twice for 30 min at room temperature. Hybridization with specific probes for Xanthomonas and non-specific probes for bacteria (EUB338I, EUB338II, EUB338III) was conducted.
The sequences 5’-3’, the fluorophores’ wavelengths, and laser lines are listed in
Table 1. In addition to the probes (target region 16S), the hybridization solution contained 0.9 M sodium chloride, 0.01% sodium dodecyl sulphate (SDS), 10 mM Tris-HCl, 50% formamide, and deionized water. Hybridization was performed in darkness for 2 h at 46 °C in an incubator (Boekel Scientific, Feasterville, PA, USA). The post-hybridization solution in both steps contained 20 mM Tris-HCl, 0.01% SDS, 0.028 M NaCl, and 10 µL·mL
−1 of 0.5 M EDTA, and was applied for 20 min at 48 °C in an incubator. Roots were then washed with sterile distilled water, and 5 pieces of root segments and stem cross-sections were placed on slides and left to dry in the dark at RT for 24 h. Before observation, the samples were mounted in glycerol and covered with a coverslip.
Laser confocal microscopy was performed using an LSM 800 microscope (Carl Zeiss, Jena, Germany). The evaluation of Xcc bacterial incidence was conducted by expressing the percentage presence of bacteria in the microscopically observed samples and recording the incidence numerically. This evaluation was assessed using a scale from 0 to 5 according to [
27], as shown in
Table 2, where 0 indicates no incidence and 5 indicates Xcc bacterial incidence in over 90% area of the observed plant segments.
Table 1.
Detailed information on the probes.
Table 1.
Detailed information on the probes.
Probe | Sequence 5’-3’ | Target Micro-Organism | Fluoro-Phore | Ex./Em. (nm) | Laser Line | Reference |
---|
EUB 338 | GCTGCCTCCCGTAGGAGT | Bacteria | Cy3, Cy3 | 553/566 | 488/532 | [28] |
EUB 338 II | GCAGCCACCCGTAGGTGT | Bacteria | Cy3, Cy3 | 553/566 | 488/532 | [29] |
EUB 338 III | GCTGCCACCCGTAGGTGT | Bacteria | Cy3, Cy3 | 553/566 | 488/532 |
Xanth | TCATTCAATCGCGCGAAGCCCG | Xantho-monas | Cy5, Cy5 | 647/665 | 633/647 | [30] |
Statistical Analysis
Data were analyzed using the Kruskal–Wallis non-parametric test, to compare the median Xcc infection rates between time points (7, 9, 11, 13, and 15 days post-inoculation) at a p-value of 0.05. Multiple comparisons of means were performed with a two-tailed test to identify significant differences. The results were displayed in box-and-whisker plots, showing the mean, standard error (SE), and standard deviation (SD). The analyses were done using Statistica version 14 (TIBCO, Santa Clara, CA, USA).
3. Results
3.1. Control Group Analysis
Table 3 summarizes the descriptive statistics of Xcc incidence rates in the root and stem tissues of cabbage, kale, and kohlrabi under inoculated and controlled conditions. The values represent the means, medians, and ranges of incidence rates over a 15-day observation period.
In the control (non-inoculated) cabbage group, there was generally no
Xanthomonas campestris pv.
campestris (Xcc) incidence across most samples (
Table 3). In the roots of cabbage, no Xcc was detected (median = 0) across all data. Xcc was also not detected (median = 0) in the stems except on day 11, where a slight presence was observed (median = 2.0). The possible presence of bacteria was due to the natural infection of the seed endosperm.
In the kale roots, no Xcc was found across most samples (median = 0) except on day 11, where some bacteria were present (median = 2.0). In the stems, the control group showed no incidence of Xcc, with a median value of 0 throughout the sampling period, except on day 11, where some bacteria were present (median = 3.0).
The control group of kohlrabi displayed no Xcc in both roots and stems, with a consistent median value of 0 on all sampling days.
3.2. Inoculated Group Analysis
The presence of Xcc bacteria (
Table 3) in the root system of plants was confirmed through the microscopic observation of samples. It was found that both individual bacteria and larger colonies were observed on root samples of all monitored vegetable species. A higher occurrence was noted during the initial observation periods, particularly 7 and 9 days after sowing. In subsequent periods, most species did not show a higher presence of bacteria on the root surface, but rather inside the root tissues. This is related to the fact that inoculation was performed externally on the seed surface, and thus the presence of bacteria on the external tissues was likely temporary, as they subsequently moved and developed inside the plant tissues.
On the other hand, the development of Xcc bacterial colonies in the conductive tissues of the above-ground parts was observed later, as the bacterial colonies gradually developed in connection with plant growth and the formation of vascular bundles. In this case, the occurrence of bacteria in the vascular system varied among the monitored vegetables, but was more or less similar in terms of sample collection periods. There was a significantly higher presence of colonies inside the vascular bundles than on the root samples.
3.2.1. Cabbage
The presence of Xcc bacteria on the surface of the above-ground parts was not significant, with sporadic occurrences of individual bacteria rather than larger colonies, which is related to the nature and bionomics of this genus, which colonizes the internal parts of plant tissues.
The median Xcc incidence rate in cabbage roots exhibited an increasing trend over time. On day 7, the median was 3.0, rising to 4.0 by day 9 and 5.0 by day 11. However, there was a decline to 3.0 on day 13, followed by a further decrease to 2.0 on day 15. In contrast, the Xcc incidence rate in stems began at a median of 3.0 on day 7, increased to 4.0 by day 9, and remained stable until day 15, with a slight dip to 3.0 observed on day 11.
The statistical analysis of cabbage roots revealed significant differences in the Xcc incidence rate across the days after sowing. Notably, significant differences were observed between days 11 and 13 (
p = 0.0325) and between days 11 and 15 (
p = 0.0373). These findings indicate that the Xcc incidence rate varies significantly during the later stages of growth, where a marked decline in Xcc incidence rate was recorded (
Figure 1). The significant differences in the Xcc incidence rate for the roots of the cabbage at different days after sowing imply that the root’s susceptibility to Xcc infection changes as the plant develops. This information could be crucial for developing targeted interventions to protect the cabbage at its most vulnerable stages.
For cabbage stems, the analysis did not show any significant differences in Xcc incidence rate across the days after sowing, despite a slight drop on day 11 (
Figure 2). This suggests that the Xcc incidence rate for the stem remains relatively stable throughout the observation period, implying a consistent susceptibility to Xcc infection during the entire growth phase.
When comparing the Xcc incidence rates between the cabbage root and stem parts, significant differences were observed on days 11 (p = 0.0163), 13 (p = 0.0216), and 15 (p = 0.0367). These results indicate that the Xcc incidence rate differs between the root and stem parts at specific times, highlighting the variation in responses to bacterial spread over time. The cabbage stem appears to be a typical site for bacterial colony development.
The combined analysis emphasizes the different responses of the root and stem to Xcc infection over time. Understanding these differences could be crucial for designing more effective disease management strategies that address the specific needs and vulnerabilities of each plant part at different growth stages.
The regression analysis of cabbage roots showed a negative correlation (Xcc incidence rate = 4.94 − 0.14 × Days after sowing) between the Xcc incidence rate and the number of days after sowing, suggesting a slight decrease in the Xcc incidence rate over time. Although the p-value of 0.0551 is close to 0.05, it is not statistically significant, implying that the decline in the Xcc incidence rate is not strong enough to be conclusive.
For cabbage stems, the regression analysis (Xcc incidence rate = 3.02 + 0.06 × Days after sowing) showed a very weak positive relationship between the Xcc incidence rate and the number of days after sowing, but this relationship was not significant (p = 0.5086), implying the same effect as in root samples.
3.2.2. Kale
Kale roots showed a consistent increase in Xcc incidence. The median began at 3.0 on day 7, increased to 5.0 by day 9, and stayed at this level until day 11. A decrease was noted on day 13, where the median was 2.0, but it rose again to 4.0 by day 15. The median Xcc incidence rate in kale stems was 4.0 on day 7 and remained stable until day 15, reaching 5.0.
The Kruskal–Wallis analysis for kale roots revealed a statistically significant difference in the Xcc incidence rate across the different days after sowing (
p = 0.0055). This indicates that the Xcc incidence rate in the roots of the kale plant is likely changing significantly over time. Pairwise comparisons showed significant differences between days 9 and 11 (
p = 0.0127) and days 11 and 13 (
p = 0.0373), with day 13 showing a higher Xcc incidence rate (
Figure 3).
In contrast, the stem part showed no significant difference in the Xcc incidence rate (
Figure 4) across the days after sowing, suggesting that the Xcc incidence rate in the stem remained relatively stable over time.
The aggregate analysis comparing roots and stems across days revealed significant differences at specific time points. On day 13, there was a significant difference in the Xcc incidence rate between root and stem (p = 0.0163), with the roots having a higher Xcc rate. Similarly, on day 15, the root samples exhibited a significantly higher Xcc rate than the stem samples (p = 0.0472).
The regression analysis of kale root samples (Xcc incidence rate = 4.85 − 0.11 × Days after sowing) showed no significant relationship between days after sowing and Xcc incidence rate (p = 0.1362), indicating no meaningful trend. The regression equation for kale stems (Xcc incidence rate = 3.28 + 0.08 × Days after sowing) similarly showed no significant relationship.
3.2.3. Kohlrabi
The Xcc incidence rate in kohlrabi roots remained relatively stable, with the median fluctuating between 3.0 and 5.0. On day 7, the median was 3.0 and remained steady until day 13, after which it increased to 5.0. The Xcc incidence rate in kohlrabi stems followed a similar pattern, with a median of 3.0 on day 7, rising to 4.0 on day 9, and reaching 5.0 on day 11, before decreasing to 3.0 again on day 15.
The statistical evaluation of kohlrabi root samples (
Figure 5) showed no significant difference in the Xcc incidence rate across the days after sowing, indicating that the Xcc incidence rate in kohlrabi roots remained consistent over time, despite a non-significant increase.
In the stem part, a statistically significant difference in the Xcc incidence rate was observed across the days after sowing (
p = 0.0372). Pairwise comparisons showed a significant difference between days 7 and 11 (
p = 0.0109), with day 11 showing a higher Xcc incidence rate (
Figure 6).
The aggregate analysis comparing roots and stems across days revealed a significant difference on day 11 (p = 0.0163), with a higher Xcc incidence rate in stems, while no significant differences were detected on other days.
The regression analysis of kohlrabi roots yielded the following equation: Xcc incidence rate = 1.46 + 0.18 × Days after sowing, showing a weak positive linear relationship (p = 0.0080). However, the weak correlation (r2 = 0.2682) indicates that this trend only explains a small proportion of the variation in the Xcc incidence rate. In the stem samples, the regression equation for the Xcc incidence rate = 3.45 + 0.05 × Days after sowing showed a very weak positive relationship, but this was not statistically significant (p = 0.3979).
3.3. Comparison of Species
In general, kale exhibited the highest median Xcc incidence rates throughout the observation period, particularly in the roots, where the incidence rate reached 5.0 by day 9 and remained stable until day 11. In contrast, cabbage and kohlrabi showed more fluctuations, with cabbage experiencing a significant drop in infection on day 13.
The inoculation impact on stems was more consistent across species, with kale again showing the highest levels of Xcc incidence rate, particularly from day 9 onwards, where the median value remained stable at 5.0. Cabbage stems displayed slightly lower infection levels, while kohlrabi exhibited the lowest and most fluctuating rates, especially after day 13.
In summary, the results indicate the clear progress of Xcc incidence rates in all three Brassica species, with kale displaying the most significant and consistent infection rates. The control group remained unaffected by Xcc, with only minor traces detected in a few samples, suggesting minimal natural contamination.
3.4. Microscopic Observations
3.4.1. Roots
Evidence shows that contact between the host root and
Xanthomonas campestris pv.
campestris can occur even at this early developmental stage, as visible in the root radicula of the cabbage (
Figure 7A). A notable presence of several Xcc bacteria is observed in this region of the root tip.
Figure 7B illustrates the abundant colonization of Xcc on the kohlrabi root. Their presence is detectable within both the epidermis (ep) and the endodermis (ed) during the microscopic observation of the root surface layers. The inner tissue of the cabbage root, as shown in
Figure 7C, reveals a significantly high density of Xcc bacteria. Smaller colonies (a) and individual bacterial cells (b) are distinctly visible throughout the examined sample area.
Figure 7D indicates the presence of Xcc bacteria within the epidermis of the cabbage root, suggesting that the developing adventitious root may become infected by these bacteria right from the onset of its growth. The surface occurrence of Xcc is likely linked to prior inoculation and the presence of bacterial colonies within the growth substrate.
Similarly, in the case of kale, a high occurrence of Xcc was observed on the roots, as shown in
Figure 7E, which highlights the presence of Xcc bacterial colonies.
Figure 7F illustrates that the amount of bacteria adhered to the rhizodermis was substantial. The bacteria frequently covered the entire observed root sample continuously.
3.4.2. Stems
Figure 8A highlights regions with a low occurrence of stomata, such as the junction between the cabbage stem and leaf petiole, where yellow-highlighted areas of Xcc presence can be observed within the stomatal openings. This observation is related to one of the pathways through which the bacteria penetrate the plant.
A significant presence of Xcc in the transverse section of the kale stem is depicted in
Figure 8B. Highly abundant colonies of Xcc (a) form continuous yellow regions, which are also observable in the longitudinal section of the xylem, particularly in areas where the edges of xylem vessels appear light (b). In
Figure 8C, a longitudinal section of the cabbage stem reveals visible lines of Xcc bacteria (a) migrating within vessel members.
Figure 8D presents an emerging colony of Xcc (a) on the inner wall of the xylem in kohlrabi. As the colony develops, it progressively obstructs the vascular bundle, transitioning to a state illustrated lower in the figure (b), where fully yellow areas of the colonies are apparent. This condition symptomatically leads to the wilting of the affected plant segment. The further progression of this condition is clearly demonstrated in
Figure 8E, where the xylem bundles of the cabbage are entirely populated by Xcc bacteria, resulting in a cessation of their essential role in supplying the plant with water and nutrients.
In samples of kohlrabi with an exceedingly high bacterial presence, numerous bacterial cells are observed not only in the xylem but also in the phloem (a), as shown in
Figure 8F. The released xylem cells exhibit the continuous presence of bacteria on the yellow-highlighted walls (b).
4. Discussion
The results of this study indicate that the progression of Xcc infection differs across the three Brassica species, as well as between the root and stem tissues. Initially, a higher bacterial presence was observed on the root surfaces, particularly in the first week after sowing. This can be attributed to the external inoculation of seeds, which led to temporary colonization on the root surfaces. However, over time, Xcc bacteria moved internally into the root tissues, where the infection persisted. In contrast, the stems exhibited slower development of bacterial colonies, as Xcc spread gradually into the vascular tissues, likely in response to plant growth and the formation of vascular bundles.
The temporal and spatial differences in bacterial colonization observed in the roots and stems of cabbage, kale, and kohlrabi reflect not only the physiological distinctions between these plant parts, but also highlight the adaptive strategies of Xcc in establishing systemic infections. These results suggest that the internal movement of bacteria, particularly into the vascular tissues, is critical for disease development, with roots serving as an initial colonization point and stems becoming a later target as the infection progresses. Infections start at a specific site and increase or change as time progresses, like in our study where Xcc initially colonized the root surfaces before moving internally. Similar developments of Xcc have been observed in the study of [
20], and studies involving various pathogens like
Erwinia amylovora or
Ralstonia spp. [
28,
29].
Regarding the differences in bacterial colonization between three selected vegetable species according to the results of this study, higher bacterial colonization was observed in kale compared to cabbage or kohlrabi. Several research studies of black rot resistance genome sources in Brassica species confirmed race specific resistance in various Brassica species (e.g.,
B. juncea,
B. napus,
B. rapa) [
3,
21]. Generally, the species from the
Brassica oleracea group (including all three species evaluated in this study) belong to the most vulnerable crops to most virulent races 1 and 4 of Xcc causing black rot; however, some resistant varieties already exist in this group as well [
30,
31,
32]. A host–isolate relationship, expressed as a higher appearance of symptoms caused by natural Xcc isolates obtained from the given crop, was observed in kale, kohlrabi and cauliflower [
22]. Interestingly, no host–isolate relationship was observed for the natural isolate from cabbage-caused infection in all six
Brassica oleracea vegetable crops. The isolate used in this study (HRI-W 3811), originally isolated from cabbage, caused bacterial infection in all three studied vegetable crops, confirming no host–isolate relationship. Contrary to the results of our study, no significant differences were observed in the symptoms appearing on six vegetable crops artificially infected by a Xcc isolate obtained from cabbage in the study of [
22].
Our study demonstrates the most rapid development of Xcc infection levels in kale. This can be linked to the higher sensitivity of this particular vegetable species and/or the cultivar used. Many studies, including ours [
15,
21], have documented the importance of cultivar-level sensitivity to Xcc. Fluctuations in the Xcc incidence rate in cabbage and kohlrabi plants could be influenced by the different speeds of plant development. More intense growth may limit the severity of infection.
The slight infection observed in the control variant is likely due to latent seed infection. Xcc is known for being seed-borne, meaning the pathogen can remain inactive inside the seeds and only manifest under favorable conditions, such as during plant growth. Xcc can survive in seeds without visible symptoms and become active when environmental conditions like moisture and temperature promote its growth. Seed contamination with Xcc is considered the primary source of field infections, which is why seed disinfection methods are recommended to minimize the risk of latent infection. This phenomenon has been repeatedly confirmed in various Brassicaceae species, where infected seeds lead to the spread of the pathogen into plant tissues early in the growth stages [
33,
34,
35].
The findings from the microscopic analysis of cabbage and kohlrabi roots and stems provide significant insights into the early interactions between Xcc and host plant tissues. Observations indicate that even at the radicle stage, Xcc establishes contact with the host root, suggesting that infection can initiate early in root development. The rapid development of *Xcc* bacterial presence was also reported by [
26], where a short-term experiment lasting a few weeks demonstrated the substantial impact of the bacteria on the health status of cabbage seedlings. This also aligns with previous studies that have demonstrated the early colonization of roots by pathogens, emphasizing the importance of understanding these interactions for effective disease management [
36].
The notable presence of Xcc in both the epidermis and endodermis of kohlrabi roots reinforces the notion that bacterial colonization occurs not only superficially but also within deeper tissues. This intracellular colonization may enhance the pathogen’s ability to evade initial plant defense mechanisms and highlights a potential route for systemic infection, corroborating findings from similar studies that highlighted the role of bacterial movement through plant tissues [
37].
The high density of Xcc observed in the inner tissues of cabbage roots indicates the significant proliferation of the pathogen. Smaller colonies and individual bacteria are clearly visible, suggesting active multiplication within the host tissue. Such bacterial densities can lead to severe pathogenesis, as previously reported by [
38], which noted that relatively soon, an overwhelming bacterial presence could lead to tissue necrosis and plant wilting. The findings in this study substantiate these conclusions by demonstrating that high bacterial concentrations hinder the physiological functions of vascular tissues.
Further observations suggest that Xcc can infect adventitious roots from the outset of their development. This early-stage infection could have serious implications for plant health and productivity, especially if not detected early. From this perspective, appropriate protective measures should include novel treatment applications, such as nanoparticles [
16] and bacteriophages [
17], implemented during the very early stages of canopy establishment.
In the stem parts, the findings illustrate the various pathways of Xcc entry. The presence of Xcc within stomatal openings and the extensive colonization observed in the transverse and longitudinal sections of the kale stem indicate that the bacteria adeptly exploit natural openings to infiltrate vascular tissues. The continuous colonization leading to the occlusion of xylem vessels and culminating in the wilting of plant segments, aligns with the literature documenting the devastating effects of Xcc infections on crop water and nutrient transport systems [
38].
The observation of bacterial cells in both the xylem and phloem of kohlrabi underscores the ability of Xcc to navigate critical vascular systems. This dual presence could facilitate widespread systemic infection throughout the plant, corroborating previous findings that highlight the extensive damage caused by Xcc in susceptible crops [
39].
5. Conclusions
This study provides valuable insights into the infection dynamics of Xanthomonas campestris pv. campestris in Brassica species, focusing on cabbage, kale, and kohlrabi. The development of Xcc infection varied between plant species and tissues, with roots generally showing earlier colonization due to initial seed inoculation. Root infection progressed internally after an initial surface colonization, while stem infection developed more gradually, aligning with the formation of vascular tissues. Kale exhibited the highest incidence rates, particularly in the roots, compared to cabbage and kohlrabi, which demonstrated more fluctuations.
Microscopic analysis revealed the presence of Xcc in both the epidermis and deeper root tissues, particularly the endodermis, suggesting early intracellular colonization. This highlights the ability of Xcc to evade plant defenses and spread systemically, contributing to disease development. The high bacterial density observed in cabbage roots and the colonization of both xylem and phloem in kohlrabi emphasize the pathogen’s ability to disrupt vascular functions, leading to tissue necrosis and plant wilting.
This study further identified significant differences in infection dynamics between the root and stem tissues, with the roots serving as the initial colonization point and stems becoming a target later. The observed infection in adventitious roots underscores the risk of early-stage infections, while stem colonization through natural openings like stomata demonstrates Xcc’s adaptability. These findings enhance our understanding of Xcc’s infection strategies and offer critical insights for improving disease management in Brassica crops.
The onset of Xcc infection is rapid, regardless of the vegetable species. Under optimal conditions for the pathogen, significant plant damage can occur as early as one week post infection. Therefore, preventive measures play a crucial role in managing Xcc, and available direct protection methods should be implemented at the earliest opportunity. Effective preventive measures include seed treatment as a tool for protecting crops in their early stages. Direct protection approaches may involve the exploitation of bacteriophages and the general use of biocontrol methods.