Stable DNA Aptamer–Metal–Organic Framework as Horseradish Peroxidase Mimic for Ultra-Sensitive Detection of Carcinoembryonic Antigen in Serum
Abstract
:1. Introduction
2. Results and Discussion
2.1. Preparation and Characterization of CEAapt-TDN-MOF Colloid Nanorods
2.2. Horseradish Peroxidase Mimic Activity Study
2.3. Optimization of Experimental Conditions
2.4. Assay Performance Analysis
3. Conclusions
4. Materials and Methods
4.1. Instrumentation
4.2. Reagents
4.3. Synthesis of Metal–Organic Framework PCN-222 (Fe)
4.4. Preparation and Characterization of TDN Structures
4.5. Preparation of TDN-Functionalized Modified PCN-222 (Fe): CEAapt-TDN-MOF Colloid Nanorods
4.6. Preparation of DNA-AuNPs and TDN-MOFs
4.7. Construction of an Immunosensor for the Detection of CEA
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Cohen, S.M. Postsynthetic Methods for the Functionalization of Metal–Organic Frameworks. Chem. Rev. 2011, 112, 970–1000. [Google Scholar] [CrossRef]
- Evans, J.D.; Sumby, C.J.; Doonan, C.J. Post-synthetic metalation of metal–organic frameworks. Chem. Soc. Rev. 2014, 43, 5933–5951. [Google Scholar] [CrossRef] [PubMed]
- Lv, S.; Zhang, K.; Zhu, L.; Tang, D. ZIF-8-Assisted NaYF4:Yb, Tm@ZnO Converter with Exonuclease III-Powered DNA Walker for Near-Infrared Light Responsive Biosensor. Anal. Chem. 2020, 92, 1470–1476. [Google Scholar] [CrossRef] [PubMed]
- Lv, S.; Tang, Y.; Zhang, K.; Tang, D. Wet NH3-Triggered NH2-MIL-125(Ti) Structural Switch for Visible Fluorescence Immunoassay Impregnated on Paper. Anal. Chem. 2018, 90, 14121–14125. [Google Scholar] [CrossRef] [Green Version]
- Doonan, C.; Riccò, R.; Liang, K.; Bradshaw, D.; Falcaro, P. Metal–Organic Frameworks at the Biointerface: Synthetic Strategies and Applications. Acc. Chem. Res. 2017, 50, 1423–1432. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhuang, J.; Young, A.P.; Tsung, C. Integration of Biomolecules with Metal–Organic Frameworks. Small 2017, 13, 1700880. [Google Scholar] [CrossRef]
- An, H.; Li, M.; Gao, J.; Zhang, Z.; Ma, S.; Chen, Y. Incorporation of biomolecules in Metal-Organic Frameworks for advanced applications. Co-Ord. Chem. Rev. 2019, 384, 90–106. [Google Scholar] [CrossRef]
- Berezovski, M.V.; Lechmann, M.; Musheev, M.U.; Mak, T.W.; Krylov, S.N. Aptamer-Facilitated Biomarker Discovery (AptaBiD). J. Am. Chem. Soc. 2008, 130, 9137–9143. [Google Scholar] [CrossRef]
- Cui, Y.; Pattabiraman, A.; Lisko, B.; Collins, S.C.; McAlpine, M. Recognition of Patterned Molecular Ink with Phage Displayed Peptides. J. Am. Chem. Soc. 2010, 132, 1204–1205. [Google Scholar] [CrossRef]
- Furukawa, H.; Cordova, K.E.; O’Keeffe, M.; Yaghi, O.M. The Chemistry and Applications of Metal-Organic Frameworks. Science 2013, 341, 1230444. [Google Scholar] [CrossRef] [Green Version]
- Deng, H.; Doonan, C.J.; Furukawa, H.; Ferreira, R.B.; Towne, J.; Knobler, C.B.; Wang, B.; Yaghi, O.M. Multiple Functional Groups of Varying Ratios in Metal-Organic Frameworks. Science 2010, 327, 846–850. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; McGuirk, C.M.; d’Aquino, A.; Mason, J.A.; Mirkin, C.A. Metal-Organic Framework Nanoparticles. Adv. Mater. 2018, 30, 1800202. [Google Scholar] [CrossRef] [PubMed]
- Morris, W.; Briley, W.E.; Auyeung, E.; Cabezas, M.D.; Mirkin, C.A. Nucleic Acid-Metal Organic Framework (MOF) Na-noparticle Conjugates. J. Am. Chem. Soc. 2014, 136, 7261–7264. [Google Scholar] [CrossRef]
- Chen, W.-H.; Yu, X.; Cecconello, A.; Sohn, Y.S.; Nechushtai, R.; Willner, I. Stimuli-responsive nucleic acid-functionalized metal–organic framework nanoparticles using pH- and metal-ion-dependent DNAzymes as locks. Chem. Sci. 2017, 8, 5769–5780. [Google Scholar] [CrossRef] [Green Version]
- Kahn, J.S.; Freage, L.; Enkin, N.; Garcia, M.A.A.; Willner, I. Stimuli-Responsive DNA-Functionalized Metal-Organic Frameworks (MOFs). Adv. Mater. 2017, 29, 1602782. [Google Scholar] [CrossRef]
- Fracaroli, A.M.; Siman, P.; Nagib, D.A.; Suzuki, M.; Furukawa, H.; Toste, F.D.; Yaghi, O.M. Seven Post-synthetic Covalent Reactions in Tandem Leading to Enzyme-like Complexity within Metal–Organic Framework Crystals. J. Am. Chem. Soc. 2016, 138, 8352–8355. [Google Scholar] [CrossRef] [Green Version]
- Liang, J.; Mazur, F.; Tang, C.; Ning, X.; Chandrawati, R.; Liang, K. Peptide-induced super-assembly of biocatalytic met-al-organic frameworks for programmed enzyme cascades. Chem. Sci. 2019, 10, 7852–7858. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Qi, X.; Chang, Z.; Zhang, D.; Binder, K.J.; Shen, S.; Huang, Y.Y.S.; Bai, Y.; Wheatley, A.E.H.; Liu, H. Harnessing Sur-face-Functionalized Metal-Organic Frameworks for Selective Tumor Cell Capture. Chem. Mater. 2017, 29, 8052–8056. [Google Scholar] [CrossRef]
- Wang, S.; Morris, W.; Liu, Y.; McGuirk, C.M.; Zhou, Y.; Hupp, J.T.; Farha, O.K.; Mirkin, C.A. Surface-Specific Function-alization of Nanoscale Metal-Organic Frameworks. Angew. Chem. Int. Ed. 2015, 54, 14738–14742. [Google Scholar] [CrossRef]
- Wang, S.; McGuirk, C.M.; Ross, M.B.; Wang, S.; Chen, P.; Xing, H.; Liu, Y.; Mirkin, C.A. General and Direct Method for Preparing Oligonucleotide-Functionalized Metal–Organic Framework Nanoparticles. J. Am. Chem. Soc. 2017, 139, 9827–9830. [Google Scholar] [CrossRef] [Green Version]
- Wang, S.; Chen, Y.; Wang, S.; Li, P.; Mirkin, C.A.; Farha, O.K. DNA-Functionalized Metal-Organic Framework Nano-particles for Intracellular Delivery of Proteins. J. Am. Chem. Soc. 2019, 141, 2215–2219. [Google Scholar] [CrossRef] [Green Version]
- Wilner, O.I.; Willner, I. Functionalized DNA Nanostructures. Chem. Rev. 2012, 112, 2528–2556. [Google Scholar] [CrossRef] [PubMed]
- Lu, C.-H.; Willner, I. Stimuli-Responsive DNA-Functionalized Nano-/Microcontainers for Switchable and Controlled Release. Angew. Chem. Int. Ed. 2015, 54, 12212–12235. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.-J.; Groves, B.; Muscat, R.; Seelig, G. DNA nanotechnology from the test tube to the cell. Nat. Nanotechnol. 2015, 10, 748–760. [Google Scholar] [CrossRef] [PubMed]
- Seeman, N.C.; Sleiman, H.F. DNA nanotechnology. Nat. Rev. Mater. 2018, 3, 17068. [Google Scholar] [CrossRef]
- Kim, J.; Jang, D.; Park, H.; Jung, S.; Kim, D.H.; Kim, W.J. Functional-DNA-Driven Dynamic Nanoconstructs for Biomol-ecule Capture and Drug Delivery. Adv. Mater. 2018, 30, e1707351. [Google Scholar] [CrossRef]
- Hammarström, S. The carcinoembryonic antigen (CEA) family: Structures, suggested functions and expression in normal and malignant tissues. Semin. Cancer Biol. 1999, 9, 67–81. [Google Scholar] [CrossRef] [PubMed]
- Feng, D.; Gu, Z.-Y.; Li, J.-R.; Jiang, H.-L.; Wei, Z.; Zhou, H.-C. Zirconium-Metalloporphyrin PCN-222: Mesoporous Met-al-Organic Frameworks with Ultrahigh Stability as Biomimetic Catalysts. Angew. Chem. Int. Ed. 2012, 51, 10307–10310. [Google Scholar] [CrossRef]
- Sun, Z.; Wu, S.; Ma, J.; Shi, H.; Wang, L.; Sheng, A.; Yin, T.; Sun, L.; Li, G. Colorimetric Sensor Array for Human Semen Identification Designed by Coupling Zirconium Metal–Organic Frameworks with DNA-Modified Gold Nanoparticles. ACS Appl. Mater. Interfaces 2019, 11, 36316–36323. [Google Scholar] [CrossRef]
- Li, M.; Ding, H.; Lin, M.; Yin, F.; Song, L.; Mao, X.; Li, F.; Ge, Z.; Wang, L.; Zuo, X.; et al. DNA Framework-Programmed Cell Capture via Topology-Engineered Receptor–Ligand Interactions. J. Am. Chem. Soc. 2019, 141, 18910–18915. [Google Scholar] [CrossRef]
- Storing Oligos: 7 Things You Should Know. Available online: https://sg.idtdna.com/pages/education/decoded/article/storing-oligos-7-things-you-should-know (accessed on 20 June 2017).
- Zou, L.; Ding, R.; Li, X.; Miao, H.; Xu, J.; Pan, G. Typical Fluorescent Sensors Exploiting Molecularly Imprinted Hydrogels for Environmentally and Medicinally Important Analytes Detection. Gels 2021, 7, 67. [Google Scholar] [CrossRef]
- Ramphal, W.; Boeding, J.R.; Van Iwaarden, M.; Schreinemakers, J.M.; Rutten, H.J.; Crolla, R.M.; Gobardhan, P.D. Serum carcinoembryonic antigen to predict recurrence in the follow-up of patients with colorectal cancer. Int. J. Biol. Markers 2019, 34, 60–68. [Google Scholar] [CrossRef]
- Kim, S.; Donahue, T.R.; Girgis, M.D. Carcinoembryonic Antigen for Diagnosis of Colorectal Cancer Recurrence. JAMA 2018, 320, 298–299. [Google Scholar] [CrossRef]
- Zhang, K.; Lv, S.; Tang, D. A 3D printing-based portable photoelectrochemical sensing device using a digital multimeter. Analyst 2019, 144, 5389–5393. [Google Scholar] [CrossRef]
- Qiu, Z.; Shu, J.; Tang, D. Bioresponsive Release System for Visual Fluorescence Detection of Carcinoembryonic Antigen from Mesoporous Silica Nanocontainers Mediated Optical Color on Quantum Dot-Enzyme-Impregnated Paper. Anal. Chem. 2017, 89, 5152–5160. [Google Scholar] [CrossRef]
- Yu, Z.; Tang, Y.; Cai, G.; Ren, R.; Tang, D. Paper Electrode-Based Flexible Pressure Sensor for Point-of-Care Immunoassay with Digital Multimeter. Anal. Chem. 2019, 91, 1222–1226. [Google Scholar] [CrossRef] [Green Version]
- Yu, Z.; Cai, G.; Tong, P.; Tang, D. Saw-Toothed Microstructure-Based Flexible Pressure Sensor as the Signal Readout for Point-of-Care Immunoassay. ACS Sensors 2019, 4, 2272–2276. [Google Scholar] [CrossRef]
- Gao, Z.; Shao, S.; Gao, W.; Tang, D.; Tang, D.; Zou, S.; Kim, M.J.; Xia, X. Morphology-Invariant Metallic Nanoparticles with Tunable Plasmonic Properties. ACS Nano 2021, 15, 2428–2438. [Google Scholar] [CrossRef]
- Yu, Z.; Cai, G.; Liu, X.; Tang, D. Platinum Nanozyme-Triggered Pressure-Based Immunoassay Using a Three-Dimensional Polypyrrole Foam-Based Flexible Pressure Sensor. ACS Appl. Mater. Interfaces 2020, 12, 40133–40140. [Google Scholar] [CrossRef]
- Huang, L.; Yu, Z.; Chen, J.; Tang, D. Pressure-Based Bioassay Perceived by a Flexible Pressure Sensor with Synergistic Enhancement of the Photothermal Effect. ACS Appl. Bio Mater. 2020, 3, 9156–9163. [Google Scholar] [CrossRef]






| DNA | Sequence (from 5′ to 3′) |
|---|---|
| Strand A | 5′-H2PO3-TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGCGAGGGTC CAATAC-3′ |
| Strand B | 5′-H2PO3-TCAACTGCCTGGTGATAAAACGACACTACGTGGGAATCTACTATGGCGG CTCTTC-3′ |
| Strand C | 5′-H2PO3-TTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGTATTGGACCC TCGCAT-3′ |
| Strand D | 5′-ATACCAGCTTATTCAATTTTTTTTACATTCCTAAGTCTGAAACATTACAGCTTGC TACACGAGAAGAGCCGCCATAGTA-3 |
| Strand E | 5′-TTTTTTTTTTTTTTTTTTTTTACATTCCTAAGTCTGAAACATTACAGCTTGC TACACGAGAAGAGCCGCCATAGTA-3′ |
| Strand F | 5′-TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGCGAGGGTC CAATAC-3′ |
| Strand G | 5′-TCAACTGCCTGGTGATAAAACGACACTACGTGGGAATCTACTATGGCGG CTCTTC-3′ |
| Strand H | 5′-TTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGTATTGGACCC TCGCAT-3′ |
| Strand I | 5′-SH-AAAAAAAAAAAAAAAAAAAAAAA-3′ |
| Strand J | 5′-H2PO3-TTTTTTTATACCAGCTTATTCAA-3′ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sha, L.; Zhu, M.; Lin, F.; Yu, X.; Dong, L.; Wu, L.; Ding, R.; Wu, S.; Xu, J. Stable DNA Aptamer–Metal–Organic Framework as Horseradish Peroxidase Mimic for Ultra-Sensitive Detection of Carcinoembryonic Antigen in Serum. Gels 2021, 7, 181. https://doi.org/10.3390/gels7040181
Sha L, Zhu M, Lin F, Yu X, Dong L, Wu L, Ding R, Wu S, Xu J. Stable DNA Aptamer–Metal–Organic Framework as Horseradish Peroxidase Mimic for Ultra-Sensitive Detection of Carcinoembryonic Antigen in Serum. Gels. 2021; 7(4):181. https://doi.org/10.3390/gels7040181
Chicago/Turabian StyleSha, Lingjun, Mingcong Zhu, Fuqing Lin, Xiaomeng Yu, Langjian Dong, Licheng Wu, Rong Ding, Shuai Wu, and Jingjing Xu. 2021. "Stable DNA Aptamer–Metal–Organic Framework as Horseradish Peroxidase Mimic for Ultra-Sensitive Detection of Carcinoembryonic Antigen in Serum" Gels 7, no. 4: 181. https://doi.org/10.3390/gels7040181
APA StyleSha, L., Zhu, M., Lin, F., Yu, X., Dong, L., Wu, L., Ding, R., Wu, S., & Xu, J. (2021). Stable DNA Aptamer–Metal–Organic Framework as Horseradish Peroxidase Mimic for Ultra-Sensitive Detection of Carcinoembryonic Antigen in Serum. Gels, 7(4), 181. https://doi.org/10.3390/gels7040181
