Next Article in Journal
Infection Process and Genome Assembly Provide Insights into the Pathogenic Mechanism of Destructive Mycoparasite Calcarisporium cordycipiticola with Host Specificity
Next Article in Special Issue
Educational Session at the “Trends in Medical Mycology” (TIMM) 2021 Congress Teaching Medical Mycology to Students of Medicine
Previous Article in Journal
Improved Mineral Acquisition, Sugars Metabolism and Redox Status after Mycorrhizal Inoculation Are the Basis for Tolerance to Vanadium Stress in C3 and C4 Grasses
 
 
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Conference Report

10th Trends in Medical Mycology Held on 8 to 11 October 2021, Aberdeen, Scotland, Organized by the European Confederation of Medical Mycology (ECMM)

1
Excellence Center for Medical Mycology (ECMM), Department I of Internal Medicine, Faculty of Medicine and University Hospital Cologne, University of Cologne, 50923 Cologne, Germany
2
Cologne Excellence Cluster on Cellular Stress Responses in Aging-Associated Diseases (CECAD), Chair Translational Research, Faculty of Medicine and University Hospital Cologne, University of Cologne, 50923 Cologne, Germany
3
Clinical Trials Centre Cologne (ZKS Köln), Faculty of Medicine and University Hospital Cologne, University of Cologne, 50923 Cologne, Germany
4
Partner Site Bonn-Cologne, German Centre for Infection Research (DZIF), 50923 Cologne, Germany
5
Medical Research Council Centre for Medical Mycology, University of Exeter, Geoffrey Pope Building, Stocker Road, Exeter EX4 4QD, UK
6
Division of Infectious Diseases, Department of Internal Medicine, Medical University of Graz, 8036 Graz, Austria
7
Division of Infectious Diseases and Global Public Health, University of California San Diego, San Diego, CA 92092, USA
*
Author to whom correspondence should be addressed.
J. Fungi 2021, 7(11), 916; https://doi.org/10.3390/jof7110916
Received: 8 October 2021 / Accepted: 8 October 2021 / Published: 28 October 2021
(This article belongs to the Special Issue 10th Trends in Medical Mycology)

Introduction to the Scientific Programme

Plenary Sessions:
No session will be held in parallel to these sessions.
Plenary sessions are indicated by the prefix: PS
Symposia:
Each day, symposia will convene renowned speakers from several continents, who will cover a wide range of recent developments in their fields.
Symposia are indicated by the prefix: S
A part of the symposia includes a selected submitted abstract.
Quiz the Expert Sessions:
The audience will actively participate in these small sessions.
Meet the expert sessions are indicated by the prefix: Q
Poster Sessions:
All poster boards are situated on the exhibition floor of the congress centre and in the online platform. The poster exhibition is open to all participants during the entire congress. The numbers on the poster boards correspond with the abstract numbers in this abstract supplement.
All authors of odd poster numbers must be present at their poster on Saturday 9 October, from 11:00 to 12:00. All authors of even poster numbers must be present at their poster on Sunday 10 October, from 11:00 to 12:00.
All posters are indicated by the prefix: P

PS1.2 Highlights of Clinical Trials in Medical Mycology

Emeritus George Petrikkos
Objectives: Invasive fungal infections (IFIs) are associated with high all-cause mortality (ACM) despite the discovery of newer and less toxic antifungals, compared to the old conventional Amphotericin B (AmB), since the last 50 years. On the other hand limited clinical trials have been conducted for the treatment and prevention of the most common IFIs like invasive candidiasis and invasive aspergillosis and none for mucormycosis and other rare IFIs.
The objective of this presentation is to highlights the most important Randomized Clinical Trials (RCTs), regarding treatment of invasive candidiasis and aspergillosis, which are the most common IFIs clinical trials in medical mycology.
Materials & Methods: Rewew of the literature, of the last 20 years, in PubMed, for the most important RCTs, regarding treatment of invasive candidiasis and aspergillosis, which are the most common IFIs.
Results: Invasive candidiasis phase 3 trials with azoles and candins showed ACM 10–18% at day 30 and invasive aspergillosis phase 3 trials azoles showed ACM ~20% at 6-wks; ~30% at 12-wks.
IFI mortality improved with lipid-AmB, second generation mold active azoles and the candins.
Clinical trial patients are highly selected (e.g., patients who have complicated medical conditions are not eligible for trials) -real world mortality estimated to be higher at 30–95%.
Limited choice of antifungal drugs likely to be one of the drivers of high mortality. Only three main classes of antifungal drugs—much less than for antibiotics or antivirals, polyenes, azoles and candins have been discovered and the last new class of antifungal drug approved 20 years ago.
Antifungal clinical trials in mycology have always been difficult to recruit patients due to the relatively small number of patients with the specific invasive fungal infection (orphan population). Clinical trials in orphan populations require a global search for eligible patients, with a high number of sites (many will enroll zero patients) to offset low enrollment rates. Drugs to treat life-threatening rare diseases have been approved based on small data sets that support the substantial evidence of effectiveness required for approval of all drugs.
Clinical trials in IFIs are logistically complex, take a long time to conduct and require many resources (people and money)-enrollment costs are very high @ $100–200,000/patient.
Phase 3 RCTs in invasive candidiasis and invasive aspergillosis have historically required ~300–600 patients—however, the recruitment rates per site are very low invasive candidiasis 1.9 patients/site/year invasive aspergillosis 1.5 patients/site/year.
The most important RCTs, regarding treatment of invasive candidiasis and aspergillosis, which are the most common IFIs, are shown on the following tables.
Invasive Candidiasis—Randomized Clinical Trials.
StudyPatients EnrolledYearsReference
ISAVU vs. CASPO4502006–2015Kullberg
MICA vs. CASPO5952004–2006Pappas
ANID vs. FLUCO2612003–2004Reboli
MICA vs. AmB5312003–2004Kuse
VORI vs. AmB/FLUCO4221998–2003Kullberg
CASPO vs. AmB2391997–2001Mora-Duarte
FLUCO vs. AmB/FLUCO2361995–1999Rex
More recently, clinical trials are being conducted in patients with limited or no treatment options-which increases the scarcity of patients who are eligible for the trials. These logistical challenges discourage sponsors and investors to develop new antifungal drugs.
Conclusions: Clinical trials in IFIs have historically been difficult to conduct-over the last few years it has become harder to enroll patients who are eligible/suitable for clinical trials; we anticipate this trend to continue.
Drugs to treat life-threatening rare diseases have been approved based on small data sets that support the substantial evidence of effectiveness required for approval of all drugs.

PS2.1 Immune Recognition of Fungi: The Writing on the Wall

Neil Gow
Department of Biosciences, University of Exeter, Exeter EX4 4PY, UK
Objectives: The cell wall of a fungus is an exoskeleton composed of unique molecules that are unique to fungal cells and which are used by the immune system to induce antifungal responses. Immune surveillance and defence against potential fungal pathogens is based on the recognition of this suite of molecules in the fungal cell wall that are recognised by pattern recognition receptors of the innate immune system. Differences in the cell wall composition of different fungi and or the same fungus organisms growing in different morphologies and in differing environments generates a moving target for immune recognition.
Materials & Methods: We have used a variety of microscopic and imaging tools combined with, genetic and immunological methods to generate a new spatially accurate model of the cell wall and to explore how dynamic changes in the wall influence immune surveillance.
Results: We show that immune relevant epitopes can be diffuse or clustered, superficial or buried in the cell wall and they changed during batch culture and between yeast, hypha and other cellular morphologies. The immune reactivity of different fungal cell surfaces was not necessarily related to the phylogenetic relationship between organisms, or the relative virulence of different strains. These experiments demonstrate that the fungal cell surface is ordered, complex and dynamically changing, making immune recognition a challenging process requiring the concerted action of multiple receptors operating singly and in combination.
Conclusions: My presentation will focus on this work that demonstrates that describes recent advances that have generated a scaler model of the cell wall and show it behaves as an ordered and dynamically changing organelle that makes immune recognition a challenging process. Immune recognition requires the concerted action of multiple receptors operating singly and in combination.
References
  • Yadav, B.; Mora-Montes, H.M.; Wagener, J.; Cunningham, I.; West, L.; Haynes, K.; Brown, A.J.P.; Gow, N.R.R. Differences in fungal immune recognition by monocytes and macrophages: N-mannan can be a shield or activator of immune recognition. Cell Surf. 2020, 6, 100042, https://doi.org/10.1016/j.tcsw.2020.100042.
  • Lenardon, M.D.; Sood, P.; Dorfmueller, H.; Brown, A.P.J.; Gow, N.A.R. Scalar nanostructure of the Candida albicans cell wall; a molecular, cellular and ultrastructural analysis and interpretation. Cell Surf. 2020, 6, 100047, https://doi.org/10.1016/j.tcsw.2020.100047.

PS2.2 Aspergillus fumigatus Cell Wall

Isabel Valsecchi
The fungal cell wall is a dynamic cellular compartment that must sense and adapt to different environmental stresses and opportunities.
In the case of Aspergillus fumigatus, this organelle consists mainly of polysaccharides, but also contains amylodogenic proteins, enzymes, pigments, as well as glycoproteins and GPI-anchored proteins, which together build the protection of fungal cells.
During the asexual life cycle of A. fumigatus, the different morphotypes maintain certain cell wall components, changing them in quantity, while others are specific to conidia or mycelium. In conidia, for example, we find that the hydrophobin RodA and the pigment DHN-melanin disappear in swollen conidia. On the other hand, the polysaccharide galactosaminogalactan is only present in hyphae and in the extracellular matrix, but is not present in conidia. The fibrillar core of polysaccharides consisting of branched β-(1,3) glucan cross-linked to chitin, galactomannan and β-(1,3)(1,4) glucan and embedded with α-(1,3) glucan polymers, is present in all morphotypes.
The composition and structures of some of these cell wall components will be described, as well as some techniques used for studying them.

PS3.1 Influenza

Paul Verweij
Radboud University Medical Center
Severe influenza has emerged as risk to develop invasive pulmonary aspergillosis. The frequency of influenza associated pulmonary aspergillosis (IAPA) ranges, but may affect up to 1 in 5 patients that are admitted to the ICU with influenza. Predisposing host factors vary, but up to one third of patients have no underlying disease. In addition to alveolar disease, patients may present with invasive Aspergillus tracheobronchitis (IATB) where the infection is confined to the airways. Mortality rates are around 50%, but may be as high as 90% in IATB patients. Influenza was found to be an independent risk factor to develop IAPA and lytic effects of the virus on lung epithelium and subsequent immune dysregulation are believed to contribute to host susceptibility. A recent study indicated that IAPA was already present at ICU admission in 70% of patients (early IAPA), while the remainder of cases develop later on during ICU admission (late IAPA). A preventive strategy involving posaconazole prophylaxis failed due to early IAPA cases, but posaconazole may help to prevent late IAPA. Management of early IAPA is very challenging and might require empiric antifungal therapy in hospitals with high IAPA prevalence combined with a diagnostic work-up, with de-escalation in those patients in which negative Aspergillus tests.

PS5.2 Tasting the Commensal Candida albicans in the Oral Mucosa

Salomé LeibundGut-Landmann
As part of the human microbiota, Candida albicans colonizes the mucosal surfaces of the human body. Commensalism results from the equilibrium between fungal growth and persistence on the host surface and the antifungal response preventing fungal overgrowth. The cytokine IL-17 is critical for controlling fungal load and preventing disease as illustrated by individuals with rare genetic defects in the IL-17 pathway that suffer from chronic mucocutaneous candidiasis. Stable maintenance of stable fungal commensalism requires long-lasting IL-17 production in vicinity of the epithelium. In my talk I will provide evidence that this is conferred by tissue resident memory (TRM) Th17 cells persisting in the C. albicans-colonized tissue and that TRM cells are sufficient for regulating the fungal load, without eliminating the fungus. While C. albicans can resist homeostatic levels of IL-17 to survive in barrier tissues, commensal growth of the fungus also depends upon fungus-intrinsic parameters. Natural isolates differ in their potential to stably colonize epithelial tissues.
In the second part of my talk, I will report on the identification of determinants of fungal commensalism. Our transcriptomic profiling of C. albicans in the oral mucosa of experimentally infected mice identified differentially expressed genes that are overexpressed in the commensal strain 101 in comparison to the highly virulent strain SC5314. Overexpression of one of the identified genes in strain SC5314 was sufficient to enhance persistence, and vice versa repression of this gene in strain 101 impaired fungal colonization in our experimental model. Together, my talk will highlight the multifaceted fungal and host mechanisms of regulation that allow C. albicans to establish commensalism at the epithelial host interface.

S01.1 Coccidioidomycosis: Diagnostics

Derek Bays and George R. Thompson
Abstract: Coccidioidomycosis is the disease caused by the dimorphic fungus, Coccidioides immitis and posadasii. Coccidioides spp. is endemic to the Southwest of the United States, Mexico, and regions of South America, but the endemic region is expanding with climate change. Despite increasing incidence since the 1990s, diagnosis remains challenging with approximately 3-week delays in diagnosis even in endemic areas. The main stay of diagnosis remains serologic with immunodiffusion, complement fixation serology, and enzyme-linked immunosorbent assays (EIA) being the most used compared to newer lateral flow assay (LFA). Beyond the LFA, there are additional novel strategies to diagnose coccidioidomycosis including PCR, antibody profiles, and metabolite profiles. This review will focus on the current and future diagnostics for coccidioidomycosis while exploring their test performances.

S01.2 Novel Non-Culture Diagnostics for Talaromycosis

Thuy Le
Talaromycosis caused by the dimorphic fungus Talaromyces marneffei is a leading cause of opportunistic infection and death in people with advanced HIV disease in Southeast Asia and southern China. The mortality on antifungal therapy in both HIV and non-HIV infected patients is as high as 30%. The current diagnosis relies on cultures of the pathogen which takes up to 14 days and is at best 70% sensitive. Late diagnosis increases mortality from 24% to 50%. This talk presents new data on the comparative performance of several novel non-culture-based assays for rapid diagnosis, including results of a ribosomal 5.8S real-time PCR assay, homebrew and commercial forms of the Mp1p enzyme immunoassays (EIAs), and a 4D1-monoclonal antibody (MAb)-based and Mp1p MAb-based point-of-care lateral flow assays (LFAs) current under development. The real-time PCR and antigen-detection assays show substantially higher sensitivity compared to blood cultures without sacrifices in specificity and represent highly-promising modalities for rapid diagnosis. The point-of-care LFAs in particular may be useful as a screening tool for pre-clinical asymptomatic infections.

S01.3 Histoplasmosis

Alessandro Pasqualotto
Histoplasma capsulatum is a major killer in AIDS patients. Histoplasmosis is endemic in the Americas, and in many countries the disease leads to more deaths in AIDS than tuberculosis. Despite that, histoplasmosis is neglected in most parts of the world, in which patients have limited access to modern diagnostic and treatment modalities. This talk will review diagnostic strategies for histoplasmosis, with an emphasis on the detection of Histoplasma antigen in urine samples. In order to improve the prognosis of patients with histoplasmosis, there is an urgent need to improve access to diagnostics, particularly in the developing world.

S01.4 Molecular Diagnosis of Sporotrichosis from Patients with Subcutaneous Lesions of Antioquia (Colombia) 1976–2021

Erika Andrea Sánchez Cifuentes 1, Juan Guillermo McEwen Ochoa 1,2, Martha Eugenia Úran Jiménez 1, Laura Carolina Alvarez Acevedo 1,3 and Maria del Pilar Jiménez Álzate 1
1 Medical Mycology Group, School of Medicine, University of Antioquia
2 Cellular & Molecular Biology Unit, Corporación para las investigaciones Biológicas
3 Dermatological Research Center CIDERM, School of Medicine, University of Antioquia
Objectives: Detect by chitinase PCR and Species-Specific PCR (SS PCR) the DNA of Sporothrix spp. in fresh tissue and Formalin Fixed Paraffin Embedded (FFPE) tissue from patients with sporotrichosis in Antioquia between 1976 and 2021.
Materials & Methods: Fresh tissue samples were taken by biopsy from 20 patients who arrived at the Medical Mycology Group, School of Medicine, University of Antioquia, with suspected sporotrichosis. Samples were cultured at room temperature and BHI supplemented, at 37 °C in 5% CO2. DNA extraction from fresh tissue was performed using the Mini Kit (Qiagen).
We selected 73 tissue samples from biopsy of patients with histopathological diagnosis between 1976 and 2021, distributed as follows: 52 samples of spotrichosis and 25 samples with other subcutaneous infectious diseases: histoplasmosis, chromoblastomycosis, leishmaniasis, paracoccidioidomycosis, cryptococcosis and necrotizing granulomatous tuberculosis, stored at the Dermatology Department at the Hospital San Vicente Fundación (HSVF). DNA extraction from FFPE tissue was performed using the DNA FFPE tissue kit (Qiagen).
Chitinase PCR was performed amplifying a 206 bp sequence of the chitinase gene. For species identification, species-specific primers were used, which amplify a 331 bp sequence for S schenckii s.str and 243 bp sequence for S. globosa of the calmodulin gen. For the SS PCR in tissue, a nested PCR was implemented using the primers CAL1 and CAL2 for the external sequence and the species-specific primers for the internal sequences.
Results: From the 20 samples of fresh tissue, 11 had positive culture for Sporothrix spp. and were positive for chitinase PCR. However, it was necessary to perform a second run using the product of the first PCR as sample, to increase the sensitivity of this PCR. It was not possible to isolate the fungus by culture from 3 samples due to bacterial contamination, however the chitinase nested PCR result for these three patients was positive. In 6 patients, both, the culture and the chitinase nested PCR were negative.
Nested SS PCR was applied to DNAs of positive chitinase nested PCR of fresh tissue samples. The results of these nested SS PCR were confirmed by the identification of species from the isolates recovered in culture. All were identified as S. schenckii s.str and there was 100% agreement with the results of nested SS PCR in tissue.
Of the 52 FFPE tissue samples with histopathological diagnosis of sporotrichosis, 25 were adequate for PCR and 30.7% (n: 16) of these were positive by chitinase nested PCR. All control tissues were negative for chitinase nested PCR.
Conclusions: Chitinase nested PCR has a good performance when applied to fresh and good quality paraffin tissue samples. However, PCR positivity decreased in samples stored in paraffin for more than 15 years. In fresh tissue samples, the chitinase nested PCR had 100% agreement with the culture results, as did the nested SS PCR. These two PCRs could be implemented as a diagnostic method that offers faster results in comparison to culture with the advantage of knowing directly from the sample the Sporothrix species that cause the disease.

S01.5 Ex-Vivo and In-Vivo Production of Ros and Cytokine Profile of Laser-Irradiated Murine Neutrophiles in Infection by Paracoccidioides brasiliensis

Bruno José Nascimento Gomes, Lauana Aparecida Santos, Nayara Andrade Dias, Vitor Roberto Souza and Eva Burger
Federal University of Alfenas
Introduction: Paracoccidioidomycosis (PCM) is a severe granulomatous disease, which can affect any organ in the body. The etiologic agents of the disease are thermodimorphic fungi of the Paracoccidioides brasiliensis complex. Protective immunity in this disease is mainly excerted by the action of macrophages activated by cytokines produced by T lymphocytes, normally Th1 and Th17. PCM is characterized by the presence of an inflammatory infiltrate of polymorphonuclear/neutrophil leukocytes (PMNs), capable of combating fungi via the production of reactive oxygen specimens (EROS) and pro-inflammatory cytokines. PMNs from mice susceptible to infection produce less EROS, having less fungicidal capacity compared to resistant mouse cells. Stimulation of PMNs with low-level LASER therapy (LLLT) was able to increase the fungicidal capacity of these cells against Candida albicans and P. brasiliensis, making PMNs metabolically more active.
Objectives: Within this context, our objective was to evaluate the generation of EROS and cytokines by mature PMNs, obtained from subcutaneous air pouch exudate of P. brasiliensis-infected mice, treated or not with LLLT and cultured ex vivo and in vitro.
Materials & Methods: Female Swiss mice were inoculated in subcutaneous pouches with a suspension of 5 × 106/mL yeast cells. The animals of the ex vivo experiments were irradiated with LLLT at alternate days, for seven days, and then the PMNs were collected for cultivation in RPMI medium. For the in vitro experiments, PMNs were collected from the air pouch, cultured in RPMI medium and irradiated with LLLT, in such a way that the LASER touched the bottom of the 12-well plate so that the radius struck perpendicularly to the its surface. In both experiments, the production of EROS was evaluated by luminol chemiluminescence assay, the mitochondrial activity by the MTT reduction method and the quantification of viable fungal cells through the counting of colony-forming units. The production of hydrogen peroxide and catalase activity were also measured. The concentration of IL-4, IL-6, IL-10, IL-12, IL-17 and Kc cytokines, was determined by capture ELISA tests, based on the use of specific monoclonal antibody pairs for each cytokine.
Results: The cells irradiated with LLLT, in both, ex vivo and in vitro experiments, showed higher mitochondrial activity and EROS production, including hydrogen peroxide, and lower viable fungal cell counts than those of the non-irradiated controls. In the in vitro experiments, there was an increase in the levels of IL-4 and KC in the treated groups, while there was no significant increase in the other cytokines. On the other hand, in the ex vivo model, LLLT promoted an increase in the production of IL-4, IL-6, IL-12 and IL-17 cytokines and a decrease in the concentrations of IL-10 and KC. The overall results indicate a possible immunomodulatory effect of LASER therapy, as well as an enhancement of the antifungal activity.
Conclusions: The overall results suggest that lasertherapy can increase the metabolism of PMN, rendering these cells more competent in their fungicidal activity, as LLLT was also able to modulate the expression of pro-inflammatory and anti-inflammatory cytokines.

S02.1 Strategies to Change Public Perceptions of Fungal Disease

Lorna Barnes
Objectives: The MRC Centre for Medical Mycology has created a strategic plan to engage the public with the work of the Centre. An overarching aim of this strategy is to challenge and change public perceptions of fungal disease—from highlighting the scale and impact of fungal pathogens, to understanding the impacts on those who are most at risk from them.
Materials & Methods: The Centre will use a range of engagement methods, from the creation of digital resources for young people, to Patient and Public Involvement in research projects, to collaboration with other disciplines, including making interdisciplinary projects with artists. Activities will take place a local, regional, and national level.
Results/Conclusions: The MRC CMM is at the start of the public engagement delivery plan, and will evaluate its impact over the next five years.

S02.3 Engaging Public and Politics in Low Middle-Income Countries

Bright Ocansey
Globally, little attention is given to medical mycology particularly in low middle-income countries (LMIC). The major underlying factor for this phenomenon is low awareness among relevant stakeholders including the healthcare workers, researchers, policy makers and the general public. Efforts to increase awareness broadly is critical to attract the required attention to improve diagnosis and treatment of serious fungal infections and also encourage research and training in medical mycology.
Although there have been some efforts to improve awareness about medical mycology in some LMIC, the LIFE and GAFFI burden-estimate project has in recent times has particularly stimulated a heightened enthusiasm on the African continent. One of the outcomes is the sprouting network of professional and academic groups or societies to undertake awareness creation including public engagement activities. There are quite a number of such existing societies and groups in LMIC and new ones coming out to champion this course. There are public engagement activities undertaken by these organizations/institutions in few LMIC. Examples; FIKI Ghana/Ghana Medical Mycology Group: Fungal Monday/Riddle, fungal infections talk, SMS, aspergillosis lecture, media briefings; GAFFI: advocacy works, provide financial support for sensitization programmes in LMICs especially Africa through its ambassadors. Provide free leaflets for distribution to create awareness; Asian Fungal Working Group/ISHAM: medical mycology training network conferences, educational programmes; Pan-African Mycology Working Group: replicate activities of AFWG and push for political will; Medical Mycology Society of Nigeria: sensitization programmes, national conference-media briefing, Fungal Disease Awareness Week (FDAW) walk; Ugandan Association of Medical Mycology/Fungal Interest Group of Uganda: collaborative research engagements; Pulmonary Mycoses Centre: clinical and laboratory mycology training.
Recent avenues for major public engagements are the mucormycosis and COVID-19 in India. This saw airing on major international and local news platforms.
Generally, there is an insufficient political will across most LMIC in improving the status quo regarding diagnosis and treatment of fungal infections as well as research and education in medical mycology. The major contributing factor is the scarcity of local or sub-regional epidemiological data to make a strong case for the buy in of state institutions or agencies that are mostly politically influenced. This makes it extremely difficult to sway stakeholders from a present practice that relatively snubs fungal infections to the integration of fungal infections into health systems. These obstacles can be categorized into “rare vs. common” and “expensive vs. cheap (cost-benefit)”. Some case studies or examples are; Pulmonary TB vs. Chronic fungal lung infections (chronic forms of aspergillosis, histoplasmosis, mucormycosis etc.); TB vs. Histoplasmosis in HIV/AIDS; Candida sepsis vs. bacterial sepsis, target therapy vs. empirical therapy, fungal culture vs. bacterial culture, special stains vs. routine stains.
In conclusion, conscious efforts including trials and pilot programmes with affirmative results are critical to improve the status quo.

S02.4 Onsite Trainings to Improve Outcomes of People Living with HIV (PLHIV) in Sub-Saharan African Countries

Aude Sturny Leclère 1, Dea Garcia-Hermoso 1,2, Alexandre Alanio 1,4, Stéphane Bretagne 1,2,4, Olivier Lortholary 1,2,3 and Angela Loyse 5
  • 1 Molecular Mycology Unit, Institut Pasteur
  • 2 National Reference Center for Invasive Mycoses, Institut Pasteur
  • 3 Necker Pasteur Center for Infectious Diseases and Tropical Medicine, Hôpital Necker Enfants Malades, AP-HP
  • 4 Laboratoire de Parasitologie-Mycologie, Hôpital Saint-Louis, groupe Hospitalier Lariboisière, Saint-Louis
  • 5 Institute of Infection and Immunity, St. George’s University of London
Objectives: Across the world, fungal pathogens are omnipresent in the environment. They affect over a billion people and kill more than 1.5 million people. This figure represents the same incidence than tuberculosis prevalence (1.4 million people died from TB in 2019) and three times more than the incidence for malaria (estimated number of deaths was 409,000 in 2019). Fungal opportunist pathogens occur as a consequence of many conditions, the most important being HIV infection high mortality rates. Globally, in 2019 there were 38 million people living with HIV (PLHIV) with 25.7 million of them located in Africa, highlighting the high numbers exposed to fungal pathogens in Africa. Few fungal diseases are recognized by WHO as neglected pathologies but the few listed represent a minority compared to the diversity of fungi responsible for disease worldwide. Specific issues limit studies in medical mycology in resource limited settings: lack of proper diagnostic procedures; absence of equipment in laboratories; limited clinician experience; poor access to antifungal medicines; lack of surveillance systems, and absence of mandatory reporting. Many of these factors impact the management of PLHIV with fungal disease, including time from presentation to care to diagnosis.
Materials & Methods: Our approach has been to organize onsite trainings for frontline healthcare workers (HCWs) alongside didactic mycology courses. Indeed, proper training is mandatory to improve the management of PLHIV with fungal disease and should allow accurate measurement of fungal burden. Only then can the clinical trials implemented in Sub-Saharan African countries be of sustained benefit for PLHIV and frontline HCWs in resource limited settings.
Results: We thus implemented two mycology courses in 2017 and 2018 in Senegal and South Africa. Through clinical cases discussions and practical sessions, we reviewed, in under2 weeks, sampling processes, direct exams, rapid diagnostic tests (RDTs), specific cultures and elements of molecular biology. The students were technicians, nurses, clinicians, scientists and students. We also organised 5 trainings focused on Cryptococcal Meningitis (and other common causes of HIV-related central nervous system infection) using the “train the trainer” model within the DREAMM (Driving Reduced AIDS Meningo-Encephalitis Mortality) project for frontline HCWs in Cameroon, Malawi and Tanzania which led to improved diagnosis procedures over time. We should soon be able to present data from the DREAMM project, including mortality data pre- and post- implementation of the DREAMM intervention which included these key on-site trainings.
Conclusions: Didactic trainings and onsite sessions including medical mycology should be made a priority to improve the diagnosis of fungal pathogens and above all for appropriate management of PLHIV in order to save lives.

S02.5 Mucormycosis in Covid19 Pandemic: Another Foe Joining Hands with SARS-CoV-2 in India

Jagdish Chander, Surinder Singhal, Nidhi Singla, Rajpal Punia and Varsha Gupta
Government Medical College Hospital
Objective: Covid19 pandemic has been creating havoc worldwide with over 3 million deaths reported so far all over the world. The impaired lung function creates a state of immuno-compromization among the affected individuals, paving a way for opportunistic infections. Recently, India saw a major epidemic of mucormycosis among SARS-CoV-2 affected patients. India being the diabetic hub of the world with extensive use of steroids for treatment further complicated the situation. We also experienced an outbreak of mucormycosis among patients coming to our institute. Mucormycosis is one of the angioinvasive, rapidly fatal necrotizing fungal infection caused by various species of phylum Glomeromycota. The most common presenting species belong to genera Rhizopus, Lichtheimia, Apophysomyces, Saksenaea and Mucor. Hereby, we present the epidemiological and demographic analysis of the patients of mucormycosis from a tertiary care institute in North India, during the brief period of two and half months i.e., 1 April 2021 to 15 June 2021.
Material and Methods: The present study was conducted on various clinical samples namely biopsy tissue from nasal cavity in rhino-orbital infection, necrotic tissue from cutaneous infection and sputum/BAL in case of pulmonary involvement and were processed in Department of Microbiology as per the standard mycological protocol. Fungal etiology was established by direct KOH/CFW examination and fungal culture was put on Sabouraud’s dextrose agar. The morphological identification of fungal isolates was done by LCB preparation and whenever needed, slide culture was also put up.
Results: During the time period, a total of 67 cases were reported from the clinical cases. Maximum cases were of rhino-orbital mucormycosis (63) followed by pulmonary mucormycosis (4). Two patients had mixed infection (both aspergillosis and mucormycosis). Fifty patients gave history of positive COVID infection. Out of 67, 63 patients were diabetic. Male: female was 39:28. Maximum patients were seen in age group 46–60 year old (30) followed by 31–45 year age and more than 60 year age (both 17 each) and 16 to 30 year (3). Most of the patients were not vaccinated. Only 6 were vaccinated with only one having received two doses. Five of the patients had taken only first dose of vaccine. Most of the patients were from surrounding states (50) with 18 from Chandigarh. All patients were positive on direct KOH/CFW wet mount examination for aseptate fungal hyphae. Culture grew R. arrhizus (63) followed by R. homothallicus (2), R. microsporus (1) and Lichtheimia corymbifera (1). All patients were treated with liposomal amphotericin B, along with surgical debridement.
Conclusions: Co-infections, that too, like mucormycosis can have a great psychological impact on patient as well as the family members. As always, early diagnosis and quick treatment is again the key to treat this disease with severe morbidity and mortality. SARS-CoV-2 infection, treatment with steroids, diabetes mellitus is a triad posing greater risk for mucormycosis.

S03.1 IFI in Patients Receiving Biologics and Targeted Therapies: Which Drugs and Clinical Situations Really Increases the Risk?

Jose Aguado
Currently invasive fungal infection (IFI) is not limited exclusively to patients with neutropenia or receiving corticosteroids or immunosuppressant drugs. Over recent years, the advent of biologic and targeted therapies has introduced new risk groups for IFI. In this presentation, we will overview of the current evidence stating which of these drugs is involved in the development of IFI and what are the preventive or management measures in these patients.
Biologics and targeted therapies associated with increased risk of invasive candidiasis.
Invasive candidiasis is a relatively infrequent complication of the use of biologics and targeted therapies. However, the use of biologics in combination with other immunosuppressants, including corticosteroids, can result in invasive candidiasis in settings where the risk associated with single-agent biologic or targeted therapy is low. An increased risk of mucocutaneous, but not invasive, candidiasis is seen in association with the use of anti-IL-17 agents. It has been previously noted that individuals with functional deficiencies in or antibodies against IL-17 are at risk of developing chronic mucocutaneous candidiasis, suggesting that this pathway plays an important role in the defense against candida infection. Infrequent cases of candidemia and esophageal candidiasis have been reported in association with the use of TNF-α inhibitors. The small increased risk of invasive candidiasis in patients taking all these drugs does not warrant anti-Candida prophylaxis.
Biologics and targeted therapies associated with increased risk of cryptococcosis.
Cryptococcosis has been reported with the use of biologics including TNF-α inhibitors, BTK inhibitors and many others. Patients receiving agents that impair either CD4+ T cells or macrophages are particularly in high risk. The precise risk attributable to each biologic therapy is unclear given that many patients are also receiving cytotoxic chemotherapy or steroids, many are immunosuppressed due to malignancy, and because cryptococcosis also occurs in immunocompetent hosts. No specific prophylaxis against Cryptococcus is indicated with any of these agents.
Biologics and targeted therapies associated with increased risk of invasive mould infection.
Invasive mould infection (IMI) is an uncommon complication of biologic and targeted therapies in most settings. Patients with hematological malignancies, particularly those who have received ibrutinib and multiple previous lines of treatment and have relapsed or refractory disease, appear to be at increased risk. This may be at least partially related to immune deficits associated with the underlying condition, as is the case with chronic lymphocytic leukaemia. The concomitant use of other immunosuppressive agents, such as corticosteroids or conventional chemotherapy, in addition to disease- or therapy-related neutropenia, also significantly increases the risk of IMI. Although the risk of IMI associated with ibrutinib therapy is moderate (<10% in most published studies), a high degree of suspicion should be maintained, particularly during the first six months of therapy when IMI risk is highest. Routine anti-mould prophylaxis is not recommended, but prophylaxis can be considered in patients with other risk factors for IMI, such as a history of relapsed or refractory underlying hematological malignancy.
Biologics and targeted therapies associated with increased risk of Pneumocystis jirovecii pneumonia.
It is difficult to precisely attribute risk of PJP to many biologics due to coexisting risk factors such as malignancy, transplants or steroid use, the impact of prophylaxis, and the novelty of many agents. This review will discuss the biologics with the strongest evidence of risk for PJP. Idelalisib is a phosphatidylinositol 3-kinase (PI3K) that significantly increases the risk of PJP and prophylaxis is universally recommended, although precise risk estimates are lacking.
In summary, although the overall incidence of IFI in patients receiving biologic or targeted therapies is low, awareness of these potentially serious complications of therapy is essential.

S03.2 Is Antifungal Prophylaxis Necessary?

Malgorzata Mikulska
Antifungal prophylaxis is a well-known strategy to prevent fungal diseases (IFD) in populations which are at high risk for IFD. In order to establish the utility of antifungal prophylaxis, several issues need to be addressed.
First, the rate of IFD in a given population, established both as number of patients among those at risk and as a rate, i.e., a number of IFD for, typically, 1000-patient at-risk day. This is because in case of a very prolong at-risk period, the evaluation of cost-effectiveness changes significantly compared to a short period of at-risk time. Moreover, the increased risk of IFD usually does not depend exclusively on the administered treatment with biologics or targeted therapies, but is also influenced by the underlying disease, past or concomitant treatments and past or current immune deficits. Genetic predisposition plays also its role, although its evaluation in not feasible in most settings. Second, the clinical impact, in terms of morbidity and mortality, of the IFD or IFDs most frequently diagnosed in specific population. If the mortality and morbidity are not increased when IFD is promptly diagnosed and treated, and if such a prompt and reliable diagnosis and treatment are widely available, the early diagnostic strategy, either symptom-triggered or as screening and pre-emptive therapy, might be preferred. Third, the availability of active and feasible prophylactic options among the antifungals. The feasibility of prophylaxis will depend also on the length of at-risk period and the setting in which the patient is treated, since non-oral antifungals can usually be used only in some settings—either in hospital-admitted patients or in those with frequent clinical visits in whom intermittent administration can be proposed. Fourth, the toxicity of antifungal prophylaxis should be considered. The number of patients needed to harm (NNH, the number of patients experiencing side effects of prophylactic treatment), can provide a useful tool to evaluated the overall benefit when confronted with the number need to treat (NNT) to prevent one IFD. This evaluation will be also influenced by the length of at-risk period. In addition to direct toxicity, the impact of drug interactions, particularly with targeted therapies, should be carefully considered for the main class of antifungals used as prophylaxis, such as azoles. Finally, the clinical data form randomized and observational trials on the documented clinical benefit of prophylaxis are fundamental. They reflect the final benefit, which is influenced also by the real-life feasibility, tolerability and, in case of observational trials, also availability of the treatment.
So far, few biologics and certain targeted therapies, mainly administered in a well-known settings at high risk for IFDs such as acute myeloid leukemia or GvHD, have been associated with an increased risk of IFD. As azoles are currently the only oral option for antifungal prophylaxis, the problem of drug interactions with targeted agents is particularly challenging. Currently, there are not data from large randomized trials that support the use of antifungal prophylaxis specifically in patients treated with biologics or targeted agents. Therefore, careful clinical evaluation based on the aforementioned issues and expert advice remain the bases for difficult daily clinical decisions.

S03.3 Biologic and Targeted Therapies for the Treatment of IFI

Elham Khatamzas
Objectives: Adjunctive modulation of host immune responses has recently become an increasingly attractive therapeutic strategy for the high number of challenging invasive fungal infections. Single case reports have provided promising first results where restoration of host immunity has led to control of infection. Animal and pre-clinical studies have provided insight into the complex fungi-host interaction and immunology.
Therapies under evaluation include cytokines, immune cell transfusions of innate and engineered T cells, monoclonal antibodies as well as checkpoint inhibitory agents. These need to be further studied in future clinical trials of defined patient populations with complex IFIs in order to expand our therapeutic armamentarium.

S03.4 Immune Dysregulation in Psoriasis Patients with Skin or Mucosal Candidiasis during IL-17 or IL-(12)/23 Inhibitor Therapy

Mariolina Bruno 1,*, Linda Davidson1,*, Hans Koenen 2, Juul van den Reek 3, Bram van Cranenbroek 2, Elke de Jong 3, Frank van de Veerdonk 1, Bart-Jan Kullberg 1 and Mihai Netea 1
  • 1 Radboud University Medical Center Center for Infectious Diseases (RCI), Department of Internal Medicine, Radboud University Medical Center, Nijmegen, the Netherlands
  • 2 Laboratory for Medical Immunology, Radboud University Medical Center, The Netherlands
  • 3 Department of Dermatology, Radboud University Medical Center, Nijmegen, The Netherlands
Introduction: Psoriasis is a common chronic inflammatory skin disease. Moderate-to-severe forms are often treated with targeted biologics. Biologics that block the T-helper (Th)17 pathway can be very effective, but the same pathway is known to be crucial for antifungal host defense. Clinical data suggest an increase in candidiasis incidence during interleukin (IL)-17 inhibitor therapy, but a comprehensive description of the effects of this biological therapy on anti-fungal host defense is missing.
Objectives: To investigate the innate and adaptive host immune response in psoriasis patients who developed candidiasis during treatment with biologics targeting the Th17 pathway: IL-17, IL-23 and IL-12/23 inhibitors.
Methods & Materials: Anti-fungal immune responses were studied in a case-series of 22 psoriasis patients with a history of skin and/or mucosal candidiasis during treatment with IL-17 or IL-(12)/23 inhibitors. Patients have been stratified according to biologic type in either IL-17 inhibitors (secukinumab, ixekizumab, brodalumab) or IL-(12)/23 inhibitors (ustekinumab, guselkumab). Healthy subjects served as a reference control group. Immunophenotype was characterized via whole blood flow cytometry. Immunological tests were performed in primary immune cells isolated from peripheral blood to characterize potential immune defects. The main parameters compared between patients and healthy controls were the cell counts of immune cell populations and cytokine production profiles. Regarding the latter, both innate and adaptive host immune response in terms of cytokine production upon different in vitro stimulations were investigated.
Results: Psoriasis patients with IL-17 as well as with IL-(12)/23 inhibitor therapy showed lower NK cell counts and higher B cell counts than controls, but a specific significantly lower count of CD4+ Th1 and Th1Th17 was only found in patients treated with IL-17 inhibitors as compared to controls. As compared to healthy controls, peripheral blood mononuclear cells (PBMC) from these patients stimulated with Candida (C.) albicans conidia showed significantly lower IL-6 and IL-1β production, while the release of TNF and reactive oxygen species was similar between patients and controls. The production of IFN-γ in response to C. albicans hyphae after 7 days was significantly decreased in patients receiving therapy, as well as IL-10 production in response to various stimuli. Finally, in response to stimulation with the polarizing cytokines IL-1β and IL-23, the Th17 cytokine response was significantly lower in patients, as compared to controls.
Conclusions: In this exploratory immunological study, psoriasis patients who developed skin and/or mucosal candidiasis during treatment with IL-17 or IL-(12)/23 inhibitors showed both innate and adaptive immune response defects. Compared to healthy controls, lymphocyte counts were altered and IL-6, IL-1β and IFN-γ production was decreased in response to C. albicans. These defects might contribute to susceptibility to candidiasis in psoriasis patients treated with biologics targeting the Th17 pathway.

S04.2 Opelconazole (PC945): A Novel Inhaled Azole in Late-Stage Clinical Development for Invasive Pulmonary Aspergillosis

Lance Berman
The incidence of fungal infections and diseases has increased substantially over the past two decades and invasive forms are a leading cause of morbidity and mortality, especially among immune-suppressed patients. Aspergillosis results in a range of disorders either directly from the infection, or by triggering an allergic response, with the respiratory system most commonly affected.
Invasive aspergillosis (IA) occurs in 4% of patients undergoing remission induction chemotherapy for hematological malignancies, in 9% of allogeneic hematological stem cell transplant recipients [Van de Peppel 2018] and in 2–8% of lung transplant recipients [Samanta 2020, Baker 2020, Ullmann 2018], despite the use of antifungal prophylaxis in these patient groups. Aspergillus is a particularly important opportunistic infection in lung transplant recipients [Pasupneti 2017, Husain 2019] with invasive disease occurring in 2–8% of patients in the first-year post-transplant [Samanta 2020, Baker 2020, Ullmann 2018].
Currently available antifungal therapies have important limitations such as route of administration or dosing forms, treatment-limiting side effects and drug-drug interactions [Ullmann 2018, Husain 2016]. These pose a significant challenge in patients with an underlying malignancy or in recipients of a solid organ transplant. In lung transplant recipients the anastomotic site is particularly vulnerable to aspergillus infection due to disruption of blood supply and the presence of sutures. Even when treatment for IA includes the most recently approved systemic antifungals, success rates remain low (≤50%) and overall mortality remains high (up to 40%).
There are therefore limited therapeutic options for patients with invasive pulmonary aspergillus disease particularly for those who do not respond to initial therapy or in whom antifungals that are approved for the treatment of invasive aspergillosis are contraindicated.
A potent, effective inhaled anti-fungal agent with prolonged lung tissue residence and minimal systemic update would be a valuable adjunct to current therapeutic options. To date, treatment using inhaled antifungal agents has been limited to repurposing available systemic medicines. Opelconazole is a novel triazole antifungal agent which was specifically designed for inhaled use and which is being developed as an inhaled treatment for pulmonary fungal disease. The profile of opelconazole has been assessed in a range of in vitro and in vivo studies demonstrating that it has potent antifungal activity against A. fumigatus, C. albicans and a range of other fungi [Colley T et al., 2017; Colley et al., 2019]. Following inhaled delivery, local concentrations of opelconazole in the lung are high, while systemic bioavailability is minimal. This profile should allow opelconazole to provide effective antifungal activity in the respiratory tract while limiting the potential for systemic side effects.
Opelconazole has been supplied to patients with serious or life-threatening pulmonary aspergillosis who have not responded to available mold-active therapies under a Special Needs program regulated in the United Kingdom by the Medicines and Healthcare products Regulatory Agency. Successful outcomes in the first two patients who developed invasive pulmonary aspergillosis due to infections with A. fumigatus complex shortly after lung transplantation have been reported [Pagani 2020]. Available data from the program indicate that opelconazole was generally well tolerated with no drug-drug interactions reported in the 11 patients who received opelconazole as treatment and in the 12th patient who received it as prophylaxis. Favorable responses at 3 months were observed in 9 out of the 11 patients who received opelconazole as treatment.

S04.4 NP339—A Novel Peptide Antifungal

Deborah O’Neil
NP339 is a broad-spectrum, membrane-acting, novel peptide antifungal. It is rapidly fungicidal, agnostic to target pathogen drug resistance status and furthermore, possesses a mechanism of action which mitigates the development of drug resistance in target pathogens. NP339’s exquisite specificity to fungal cell membranes means that it is not cytotoxicity against eukaryotic host cells. These, and a number of other differentiating characteristics of NP339 render it a promising, novel antifungal candidate. NP339 is currently in development by NovaBiotics as both an intravenous therapy for disseminated fungal disease and in inhaled form for respiratory fungal infection.

S05.1 Global Epidemiology of Dermatophytosis: What Is Changing, What Is Remarkable?

Rudramurthy Shivaprakash
Dermatomycoses are among the most frequent forms of human infections, affecting more than 20–25% of the world’s population. Trichophyton species are the primary causative agents, with 70–90% prevalence for onychomycosis cases and 53.1–86% in tinea infection. Trichophyton rubrum is the key etiological agent, followed by T. mentagrophytes, Microsporum canis, M. gypseum. In western countries, T. rubrum and M. canis act as a significant cause of dermatophytosis. In contrast, southern and East European countries show the prevalence of M. canis and T. mentagrophytes. Previously, T. rubrum (anthropophilic) was the most common etiology agent responsible for dermatophytosis in India. But nowadays, the T. mentagrophytes complex is the primary etiology accountable for the ongoing epidemic. Presently, epidemiology has considerably changed due to increasing recalcitrant/relapse/recurrent and chronic patients due to widespread and atypical clinical presentation of lesions, treatment failure, and resistance to the antifungals (class-azoles, and allylamines), especially in India and neighbouring countries. Clinical strains of T. rubrum and T. interdigitale documented only 1% terbinafine resistance in Switzerland with point mutation at Leu393, Phe397, Phe415, and His440in squalene epoxidase gene. The present prevalence of T. rubrum resistance to terbinafine in Europe contrasts with that of resistant T. mentagrophytes isolates in India (30–70%). Phe397 is the most common mutation reported for terbinafine resistance in dermatophytes. The primary factor for contributing resistance in India is irrational or over-the-counter usage of antifungals agents without proper prescription. Although steroids initially improve the itching and redness caused due to dermatophytic infection, they did not wholly eradicate the fungi at the lesion site and are considered as a cause of atypical presentation. Several studies reported steroid-modified tinea cases due to frequent over-the-counter drugs (FDC cream) without prescription ranging from 42% to 81.3%. Increase in the incidence of terbinafine resistance in certain regions has compelled the performance of antifungal susceptibility testing for successful therapy. But the clinical breakpoints and epidemiologic cut-off values are not currently available for dermatophytes to help with the interpretation of these results. Clinical trials and pharmacokinetic and pharmacodynamics studies are urgently needed to address the issues of recurrence or clinical failures while treating dermatophytosis.

S05.2 How to Determine MICs for My Dermatophyte Strain: Protocoles, Tips, and Trics

Sevtap Arikan Akdagli
Dermatophytes are pathogenic fungi that have high affinity for keratinized tissue and cause infections in hair, skin and nails. Dermatophytosis is a worldwide public health problem. Further, deep dermatophytosis may be observed in immunosuppressed individuals and in patients with primary immunodeficiencies. In addition to considerable clinical significance of dermatophytosis in terms of global incidence, antifungal resistance has recently drawn attention as an emerging problem in some dermatophyte strains. Resistance to terbinafine and/or azoles have so far been reported for isolates belonging to species of Trichophyton (T. rubrum, T. interdigitale. T. mentagrophytes, T. indotineae sp. nov. related to the T. mentagrophytes/interdigitale complex) and Microsporum (M. canis). The observation of emerging antifungal resistance has further augmented the necessity for the utility of in vitro antifungal susceptibility tests for clinical guidance in recalcitrant cases of dermatophytosis, in particular. Reference CLSI and EUCAST microdilution methodologies are available for testing antifungal drugs against dermatophytes. Following a multicenter project that was initiated in 2003, a modified CLSI M38-A reference method for testing dermatophytes was included in CLSI M38-A2 document that was published in 2008. This was recently followed by documentation of EUCAST reference method E.Def 11.0 in 2021 for microconidia forming dermatophytes. Moreover, EUCAST tentative epidemiological cut-off values were determined for itraconazole, terbinafine, and voriconazole against T. interdigitale and T. rubrum. While both CLSI and EUCAST reference methods follow microdilution test principles, differences in the test parameters do exist as summarized in the Table.
Given the fact that the ability of dermatophytes in forming biofilms may also contribute to antifungal resistance, in vitro and ex vivo (nail fragments, hair strands) models have also been studied for exploring the antibiofilm activities of antifungal drugs for dermatophytes. Ex vivo biofilm models provide a novel and exciting approach for assessment of activity of antifungal drugs against dermatophyte biofilms. Wide variability of experimental parameters used in in vitro and ex vivo biofilm models suggest the need for methodological standardization.
Utility of reference methods for antifungal susceptibility testing of dermatophytes will aid in further clarification of the extent of antifungal resistance and guidance of treatment particularly in refractory cases of dermatophytosis.
Test Parameter CLSI M38EUCAST E.Def 11.0
Glucose concentration in susceptibility testing medium (RPMI 1640 with L-glutamine and without sodium bicarbonate, pH = 7) 0.2%2%
Cycloheximide and chloramphenicol supplementation of the inoculum #x2212;+
Inoculum type and concentrationConidia
1−3 × 103 cfu/mL
Microconidia
1−2.5 × 105 cfu/mL
Microdilution plates96-well U-shaped96-well flat-bottom
Incubation period and temperature for the microdilution plates4 days at 35 °C5 days at 25−28 °C
MIC reading methodVisualSpectrophotometric
MIC reading endpointMIC-1 (80% inhibition)
(Terbinafine, azoles, ciclopirox olamine, and griseofulvin)
MIC-2 (50% optic density reduction)
(Terbinafine, azoles, and amorolfine)

S05.4 Malassezia: Epidemiology and Host-Response Studies

Dora Edith Corzo Leon
Abstract: The genus Malassezia, is a group of lipophilic yeasts, and part of the normal human mycobiota. They colonise several regions of the body, mainly sebum-rich skin areas such as the scalp and thorax. This group of fungi can cause a variety of infections (pityriasis versicolour, folliculitis and fungaemia) and has been associated with non-infective inflammatory diseases such as seborrheic dermatitis and atopic eczema. A global description of clinical and epidemiological characteristics of infections caused by Malassezia species in the past 12 years will be done in this talk.
Most Malassezia species are unable to synthesise fatty acids and degrade carbohydrates. Hence the acquisition of lipids and carbohydrates is dependent upon the acquisition of exogenous fatty acids via a large repertoire of lipolytic enzymes. Lipases hydrolyse sebum triglycerides from the host skin to release fatty acids. Oleic acid (OA) and arachidonic acid are the fatty acids released by phospholipase and lipase activity and have an irritating/inflammatory effect on skin facilitating Malassezia sympodialis to directly interact with skin cells. The exogenously acquired fatty acids also contribute to the formation of a thick cell wall in Malassezia sp. characterised by a unique lipid-rich outer layer, which contributes to triggering the immune response against this group of fungi. Human antimicrobial peptides specifically β-defensins, RNase7, and S100A7 are key in the skin’s protective mechanisms. A description of host response to Malassezia sympodialis using two different skin environments (oily and non-oily) on an ex-vivo human skin model will be done and it will be compared to other models and clinical findings. Host:pathogen interactions analysed by SEM, histology, gene expression, immunoassays and proteomics will be showed.
Atopic eczema (AE) is a chronic inflammatory disease affecting up to 20% of children and 3% of adults. Multiple factors have been associated with the origin of AE such as impairment of skin barrier function, genetic, and environmental factors. The mechanisms linking Malassezia sp. to AE pathogenesis is the observation that allergens produced by Malassezia sp. induce specific IgE antibodies and autoreactive T-cells that can cross-react with skin cells. M. sympodialis encodes 13 allergens, some of these allergens are highly similar to human proteins and have been specifically linked to cross-reactive immune responses (Mala S 11 and Mala S 13). These allergens (specifically Mala S 1 and Mala S 7) are carried inside extracellular nanovesicles, which are produced by an endosomal mechanism and are thought to be released into the skin environment to elicit specific immune responses in AE individuals. New preliminary evidence on cross-reactivity of Mala S 1 allergen with skin will be showed.

S05.5 Evaluation of the Multiplex Real-Time PCR DermaGenius® Assay for the Detection of Dermatophytes in Hair Samples from Senegal

Mouhamadou Ndiaye 1,2, Rosalie Sacheli 3,4, Khadim Diongue 1,2, Caroline Adjetey 3, Rajae Darfouf 3,4, Mame Cheikh Seck 1,2, Aida Sadikh Badiane 1,2, Mamadou Alpha Diallo Diallo 2, Thérése Dieng 1, Marie-Pierre Hayette 3,4 and Daouda Ndiaye 1,2
  • 1 University Cheikh Anta Diop
  • 2 Laboratory of Parasitology, University Hospital of Aristide Le Dantec
  • 3 Department of Clinical Microbiology, Center for Interdisciplinary Research on Medicines (CIRM), University Hospital of Liege
  • 4 National Reference Center for Mycosis, University Hospital of Liege
Objectives: For the successful treatment of dermatophytoses, there is a need for accurate and rapid diagnostic methods. A lot of recent literature has focused on the detection of dermatophytes directly on sample material such as nails, hair and skin scrapings. Molecular tools offer the ability to rapidly diagnose dermatophytosis within 48 h. This study aimed to compare the results of a commercial real-time PCR (real-time PCR) assay DermaGenius®(DG) complete version with those of conventional diagnostic methods (direct microscopy and culture).
Materials & Methods: A total of 129 hair samples were collected in Dakar (Senegal) from patients suspected of dermatophytosis. Hair samples were tested prospectively using microscopy, culture and PCR. Samples were prepared for microscopy using 20% potassium hydroxide and lactophenol cotton blue and cultured using Glucose peptone agar plate supplemented with chloramphenicol and Cycloheximide and Glucose peptone agar plate supplemented with chloramphenicol.The DG assay was performed according to manufacturer’s instructions. The DNA extracts were analysed using the Rotor-Gene® (QIAGEN®) real-time PCR cycler. Dermatophytes species and were differentiated by melting curve analysis. The agreement between different laboratory methods in measuring the same variable was estimated by Cohen’s kappa test (K). Sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV), accuracy of different laboratory methods was determined.
Results: Out of the 129 cases, 30 (23.26%) were male and 99 (76.74%) female. Patient’s age varied from 1 to 80 years along with a mean age at 23.64 ± 17.61 years. Of the 129 patients clinically suspected of TC, 46.41% (56/129) were positive and 56.59% were negative (73/129) in culture. Dermatophytes were detected by DG PCR in 52.71% (68/129). This study shows that DG PCR has 89.3% sensitivity, 75.3% specificity, 81.4% accuracy, 73.3% positive predictive value (PPV) and 90.2% negative predictive value (NPV). The DG PCR assay was more sensitive than culture for dermatophytes detection in patients (p < 0.05). The kappa coefficient in case of discrepancies between the two methods was good (k = 0.62). The dermatophytes isolated by culture were T. soudanense in 35 (27.13%) cases and 51 (39.53%) by DG PCR, followed by M. audouinii in 18 (13.95%) in DG PCR vs. 17(13.18%) cases in culture.Two mixed infections T. soudanense/M. audouinii (5/129 cases) and T. soudanense/M. canis (1/129 cases) were only detected in DG PCR.
Conclusions: DG PCR showed excellent performance characteristics for the detection of dermatophytes and is significantly faster than cultures techniques, which makes it very promising for routine diagnostics of dermatophytosis in Africa particularly in Senegal. It can help the clinician in initiating prompt and appropriate antifungal therapy. This technique is not only rapid but also simple and cheap in comparison to other molecular methodes for the detection of dermatophytes.

S06.1 How do Antibiotics Promote Susceptibility to Healthcare-Associated Fungal Infections?

Rebecca Drummond
Antibiotics are recognized to modulate the immune system, potentially leading to abrogated antimicrobial immunity and/or altered host homeostasis. This occurs either through direct antibiotic effects on immune cell function, and/or through indirect systemic effects that are dysbiosis-driven. Antibiotic pre-exposure is a modifiable iatrogenic risk factor for the most common human nosocomial fungal infection, invasive candidiasis. Yet, the mechanisms underlying antibiotic-induced susceptibility to invasive fungal disease remain elusive. In this talk, I will present our data where we show that antibiotic pre-exposure, particularly with vancomycin, enhances susceptibility to invasive candidiasis in mice. The susceptibility maps to impaired lymphocyte-dependent IL-17A- and GM-CSF-mediated antifungal immunity within the gastrointestinal tract, which leads to non-inflammatory escape of bacteria and systemic bacterial co-infection and can be ameliorated by IL-17A or GM-CSF immunotherapy. Antibiotic pre-exposure was associated with increased risk of invasive candidiasis and subsequent death after invasive candidiasis in a large health record patient database. Our work highlights the importance of antibiotic stewardship in protecting vulnerable patients from life-threatening infections and provides mechanistic and potential therapeutic insights into a controllable iatrogenic risk factor for invasive candidiasis.

S06.2 Human Genetic Determinism of Fungal Diseases

Anne Puel
It has been estimated that there are at least 1.5 million fungal species, mostly present in the environment, but only a few of these fungi cause human disease. Most fungal diseases are self-healing and benign, but some are chronic or life-threatening. Acquired and inherited defects of immunity, including breaches of mucocutaneous barriers and circulating leukocyte deficiencies, account for most severe modern-day mycoses. Other types of infection typically accompany these fungal infections. More rarely, severe fungal diseases can strike otherwise healthy individuals. Historical reports of fungi causing chronic peripheral infections (e.g., affecting the nails, skin, hair), and invasive diseases (e.g., brain, lungs, liver), in otherwise healthy patients, can be traced back to the mid-20th century. These fungi typically cause endemic, but not epidemic diseases, are more likely to underlie sporadic than familial cases, and only threaten a small proportion of infected individuals. The basis of this ‘idiosyncratic’ susceptibility has long remained unexplained, but it has recently become apparent that ‘idiopathic’ fungal diseases, in children, teenagers, and even adults, may be caused by single-gene inborn errors of immunity (IEIs). The study of these unusual IEIs has led to the identification of molecules and cells playing a crucial role in human host defenses against certain fungi at particular anatomic sites. A picture is emerging of inborn errors of IL-17 immunity selectively underlying chronic mucocutaneous candidiasis, with little inter-individual variability, and of inborn errors of CARD9 immunity underlying various life-threatening invasive fungal diseases, differing between patients.

S06.4 Serum Proteins, Crucial Factors for Human Physiology that Are Exploited by Candida Species to Promote Pathogenicity

Sophie Austermeier 2, Sophia Hitzler 1, Marina Pekmezovic 2, Ann-Kristin Kaune 2, Bernhard Hube 2 and Mark Gresnigt 1
  • 1 Junior Research Group Adaptive Pathogenicity Strategies, Leibniz Institute For Natural Product Research And Infection Biology—Hans Knöll Institute
  • 2 Department of Microbial Pathogenicity Mechanisms, Leibniz Institute For Natural Product Research And Infection Biology—Hans Knöll Institute
Objectives: Serum proteins play vital roles in human physiology and coping with microbial infections. Nevertheless, opportunistic pathogens evolved elegant strategies to deal with environmental changes and threats imposed by the host, contributing to their success in causing infections. Yeasts of the genus Candida that colonize a variety of mucosal surfaces are no exception. Their constant interaction with the host in commensal niches may have driven co-evolution with the host and the capacity to exploit host proteins. We are studying the adaptive pathogenicity strategies of Candida species. Specifically our objective is to discover mechanisms by which these fungi exploit serum proteins.
Materials & Methods: To investigate how serum proteins play a role during the pathogenesis of Candida infections, we introduced these proteins in in vitro infection models to study Candida pathogenicity mechanisms during interactions with epithelium, organ tissue, and cells of the innate immune system.
Results: Albumin is the most abundant protein in human blood, but is also present in mucosal tissues. The high affinity of albumin to hydrophobic molecules, makes it a trap for hydrophobic microbial toxins, including the toxin candidalysin that is essential for full C. albicans virulence. Yet, we also observed that Candida species can exploit albumin, which contributes to their capacity to cause infection and escape neutrophil-mediated killing.
1-antitrypsin (AAT) is an acute-phase protein controlling inflammatory responses and preventing immunopathology. However, C. albicans increases filamentation in the presence of AAT. At physiological serum concentrations, this contributes to fungal escape from monocytes and macrophages.
Conclusions: While serum proteins are key players in human physiology, they are often disregarded in infection biology. Nevertheless, evidence is amassing that these proteins play vital roles in the pathophysiology of opportunistic fungal infections. Understanding these complex interactions provides key insights in the pathogenesis of candidiasis that could be exploited for novel diagnostic and therapeutic strategies.

S06.5 Increased Efficacy of IL-18/Posaconazole Combination in a Neutropenic Animal Model of Pulmonary Invasive Aspergillosis by an Azole Resistant A. fumigatus Isolate

Panagiota-Christina Georgiou 1, Maria-Ioanna Beredaki 1, Anastasia Tsiavou 1, Spyros Pournaras 1, Panagiotis Tsirigotis 2 and Joseph Meletiadis 1,3
  • 1 National and Kapodistrian University of Athens, Medical School
  • 2 Hematology Unit of B-Educational Pathology Clinic, Attikon University Hospital
  • 3 Department of Medical Microbiology and Infectious Diseases, Erasmus Medical Centre
Objectives: Aspergillus fumigatus is an ubiquitous airborne saprophytic fungus that can cause invasive pulmonary aspergillosis, a life-threatening infection for immunocompromised patients. Posaconazole, an extended-spectrum triazole, is extensively used for prophylaxis of aspergillus diseases in neutropenic patients with acute myeloid leukemia. Given the emergence of azole resistance in A. fumigatus new prophylactic regimens are required. Triggering host defense against A. fumigatus with cytokines is a new approach that has not been fully studied. We have previously shown that IL-18 increased survival of mice infected with azole-susceptible A. fumigatus isolate (Georgiou et al, ECCMID2021). In the present study, we investigated the efficacy of IL-18 alone and in combination with posaconazole in an animal neutropenic model of invasive pulmonary aspergillosis by an azole-resistant A. fumigatus isolate.
Materials & Methods: Six weeks old female CD-1 mice rendered neutropenic with cyclophoshamide (150 mg/kg i.p. −4, −1, 4 and 8 days of infection) were infected intranasally with 6 × 106 CFU/mL of A. fumigatus (resistant to posaconazole strain v79-63 with EUCAST MIC >16 mg/L) conidia in PBS/Tween 20 under light anesthesia (isoflurane). Mouse cytokine IL-18 at the optimal concentration 10 ng/mouse based on previous studies (Georgiou et al, ECCMID2021) was given daily intranasally (50 μL/dose) to groups of 10 animals at −2 d till + 7 d, alone or in combination with posaconazole 16 mg/kg/day. Placebo group was treated with saline. Animals were also treated with ceftazidime 50 mg/kg/day as antibacterial prophylaxis. Survival was recorded until 15 d. Survival curves were compared using Log-rank (Mantel-Cox) test. The effect of IL-18 and posaconazole monotherapy and combination therapy on fungal burden in lungs was assessed in 3 animals treated for 3 d when animals were euthanized, lungs were excised and homogenized and CFUs were determined with quantitative cultures. Differences in CFU were assessed with one-way ANOVA followed by Dunnett’s test.
Results: The survival rates in each group were 20% in control group, 56% in IL-18 group, 56% in posaconazole group and 80% for combination group. Log-rank (Mantel-Cox) test showed statistically significant differences (p = 0.044) with a significantly higher survival rate found with the combination therapy but not with monotherapy regimens compared to placebo. The mean ± SEM log10CFU/lung were 4.23 ± 0.53 in combination group, 4.82 ± 0.44 in IL-18 group, 5.2 ± 0.48 in posaconazole group and 6.1 ± 0.08 in placebo which a significantly difference found between the combination and placebo group (p < 0.05).
Conclusions: A significant antifungal effect was found for the combination of IL-18 with posaconazole in prolonging survival and reducing fungal burden in lungs of neutropenic animal model. Further studies are required to explore the role of IL-18 against invasive pulmonary aspergillosis in neutropenic patients.

S07.2 Antifungal Prophylaxis: Who, with What and How Long?

Shmuel Shoham
Purpose of presentation: This presentation reviews the role of antifungal prophylaxis in solid organ transplant recipients with focus on utilizing epidemiology and diagnostic assays to assist in selection of the right drug, for the right patient at the right time.
Overview: Invasive candidiasis and aspergillosis are the two most important fungal infections in the early post-transplant period. Prophylaxis to prevent those infections is routinely used in liver, pancreas, lung and small intestine transplant recipients. It is also used to prevent coccidioidomycosis in all recipients living in areas endemic for that infection, regardless of organ type. Prophylaxis efforts focus on balancing the risks of infections with the risks of antifungal therapy (e.g., drug toxicity, drug interactions, development of fungal resistance and cost). There are three broad prophylaxis strategies: (1) Universal prophylaxis, in which all recipients of an organ receive an antifungal, (2) Targeted antifungal prophylaxis, in which clinical and laboratory characteristics are used to identify patients for prophylaxis and (3) Preemptive prophylaxis/therapy, in which microbiologic assays are used to initiate antifungals at the earliest stages of infection.
Organ specific approaches:
Liver transplant: The two main approaches are universal prophylaxis with an anticandidal agent (usually fluconazole) and targeted prophylaxis based on risk factors for invasive candidiasis and/or aspergillosis. Risk factors for candidiasis include: renal failure requiring dialysis, Candida species colonization, MELD score ≥30, re-transplantation, living donor, transfusion of ≥40 units of cellular blood products during transplant, choledochojejunostomy, biliary leaks and need for re-operation. Such patients generally receive 14–28 days of anticandidal prophylaxis (e.g., fluconazole unless also at risk for aspergillosis or high prevalence of fluconazole resistance). Risk factors for invasive aspergillosis include fulminant hepatic failure, renal failure requiring dialysis, higher doses of steroids within a month of transplant, re-transplant, multi-visceral transplantation, biopsy-proven rejection requiring T cell depleting therapy and re-operation. Such patients generally receive 14–21 days of mold active antifungal therapy (e.g., echinocandin or lipid formulation amphotericin B). The role of prophylaxis with mold active azoles is evolving in liver transplant recipients.
Pancreas transplant: The two main approaches are universal prophylaxis with an anticandidal agent and targeted prophylaxis based on risk factors for invasive candidiasis. Risks for candidiasis include enteric drainage, vascular thrombosis, and post-perfusion pancreatitis. Patients typically receive 4 weeks of therapy (with fluconazole unless high prevalence of resistance).
Lung transplant: The predominant pathogens of concern are filamentous fungi, particularly Aspergillus species. Of note, the risk for invasive candidiasis can be significant in the first 30 days. The three main approaches are universal prophylaxis with a mold active antifungal agent (e.g., mold active azole or lipid formulation of amphotericin B), targeted prophylaxis based on risk factors for invasive aspergillosis and a preemptive approach based on protocolized bronchoalveolar lavage studies (culture and galactomannan) done at routine intervals. Risk factors taken into consideration for targeted antifungal prophylaxis include presence of Aspergillus species in airway cultures (especially in those with bronchiectasis), single-lung transplant, airway ischemia, CMV, use of a T cell depleting agent and acquired hypogammaglobulinemia. Prophylaxis is generally for 4–6 months. When a preemptive strategy is used prophylaxis/treatment is usually for 3–4 months.
Other situations: For recipients of small bowel transplant, anticandidal prophylaxis is used for 4 weeks or until the anastomosis has healed and rejection is not present. For any transplant recipient living in areas endemic for coccidioidomycosis an azole is typically used for the first 6–12 months after transplant, although some continue for life in lung transplant recipients.

S07.4 Side-Effects and Completion Rates of Universal vs. Targeted Antifungal Prophylaxis among Lung Transplant Recipients 2010–2019

Cornelia Geisler Crone 1, Signe Marie Wullf 1, Jannik Helweg-Larsen 2, Pia Bredahl 4, Maiken Cavling Arendrup 5,6,7, Michael Perch 3,7, Marie Helleberg 1,2
  • 1 Centre of Excellence for Health, Immunity and Infections (CHIP), Rigshospitalet
  • 2 Department of Infectious Diseases, Rigshospitalet
  • 3 Department of Cardiology, Section for lung transplantation
  • 4 Department of Thoracic Aneasthesiology and Intensive Care, Rigshospitalet
  • 5 Unit of Mycology, Statens Serum Institut
  • 6 Department of Clinical Microbiology, Rigshospitalet
  • 7 Department of Clinical Medicine, University of Copenhagen
Objectives: In lung transplant recipients, it is unclear if invasive fungal infections (IFI) are best prevented by universal or targeted antifungal prophylaxis. The Danish guideline for prevention of IFI in these patients was changed from universal to targeted antifungal prophylaxis in 2016. We examined side-effects and rates of completion of antifungal prophylaxis before and after this change.
Materials & Methods: Retrospective study of all adult lung transplant recipients at Copenhagen University Hospital during 2010 to 2019. Standard IFI prophylaxis 12 weeks after transplantation was voriconazole for all patients in 2010–2016. In 2017–2019 targeted prophylaxis with posaconazole and inhaled amphotericin B was used for high risk patients only. Failure to complete prophylaxis was defined as recieving <9 of the intented 12 weeks of prophylaxis. Liver and kidney toxicity was graded according to Common Terminology Criteria for Adverse Events (CTCAE) criteria (grades 0–4 according to degree of elevation). Grade ≥2 adverse events were classified as high. Lung biopsies were evaluated for acute rejection (grade ≥A2). Calcineurin-inhibitor (CNI) plasma-concentrations were evaluated for off-target episodes. High and low episodes were defined as ≥2 concecutive samples 20% above or below target range limits, respectively. Low CNI episodes were considered related to discontinuation of voriconazole if occurring 0–14 days from discontinuation. Acute rejections were classified as related to low CNI if they occurred 0–30 days from low CNI. Grade ≥2 kidney toxicity was considered related to high CNI if it occurred between two days prior to high CNI to 7 days after.
Results: We included 295 patients. Universal and targeted antifungal prophylaxis was used in 183 of 193 (94.8%) recipients during 2010–2016 and in 6 of 102 (5.6%) recipients during 2017–2019 (Table). The underlying diseases were comparable in the two periods, with emphysema as the main disease (46%). The rates of single lung transplantation were 13% in the universal vs. 5% in the targeted prophylaxis period (p = 0.048). Among the 183 patients receiving voriconazole prophylaxis, 114 (62%) failed to complete prophylaxis, 82 (72%) of these due to hepatic toxicity (Figure). From day 0–120 after transplantation in the universal prophylaxis and targeted periodes, respectively, 56% and 11% had ≥1 episode of grade ≥2 ALT increase, 5% and 13% had ≥1 episode of grade ≥2 increased creatinine related to high CNI plasma-concentration level, and 50% and 7% had acute rejection related to low CNI plasma-concentration (Table). Among patients from the universal prophylaxis period 45% had a low CNI plasma-concentration episode related to discontinuation of voriconazole.
Conclusions: Premature discontinuation rates of voriconazole prophylaxis were high, mainly due to hepatic side-effects. Episodes of low concentrations of immunosuppressives and acute rejections were more frequent during the period with universal- vs. targeted antifungal prophylaxis and a large proportion of low CNI episodes were related to discontinuation of voriconazole. This underlines the challenges related to the use of triazole prophylaxis in the lung transplant population and the importance of frequent dose adjustment of CNI.

S07.5 Risk Factors for and Outcomes of Invasive Aspergillosis Following Kidney Transplantation in the United States

Daniel Friedman 1,2, Bradley Johnson 2, Walter Kremers 2, Paschalis Vergidis 1,2
  • 1 Division of Infectious Diseases, Department of Medicine, Mayo Clinic
  • 2 William J. Liebig Center for Transplantation and Clinical Regeneration, Mayo Clinic
Objectives: Kidney transplant (KTx) recipients are at increased risk of invasive aspergillosis (IA). The goal of this study was to determine risk factors for IA using a national database and assess its association with mortality and graft loss following KTx.
Materials & Methods: We performed a retrospective analysis using the United States Renal Data System (USRDS) database, which collects data from of Centers for Medicare & Medicaid Services (CMS) and the United Network for Organ Sharing (UNOS). We included patients who received KTx between 1986 and 2017 with follow-up until December 2018. Patients with IA were identified using ICD codes and matched 1:4 with controls by time and center of transplant. Characteristics of patients with IA were compared to those of patients without IA using chi-square and t-tests. Using logistic regression, we compared cases to matched controls to identify factors associated with increased odds of IA. We calculated the impact of IA on mortality and graft failure using Cox regression, Kaplan-Meier estimates and log-rank test.
Results: We matched 380 KTx recipients with IA to 1520 non-infected controls. The mean age at transplant was 53.7 years, and 59.5% of patients were male. The main indications for KTx were diabetic nephropathy (n = 560, 29.5%), glomerular disease (n = 394, 20.7%), polycystic kidney disease (n = 201, 10.6%) and hypertensive nephropathy (n = 111, 5.8%). One thousand fifty-four (55.4%) received a cadaveric allograft.
The median time to diagnosis of IA following KTx was 2.1 years (IQR, 0.5–7.9 years). Patients with IA were older (55.5 vs. 53.2 years, p < 0.01), had a longer time on dialysis pre-transplant (3.7 vs. 1.6 years, p < 0.01), and were more likely to have received a cadaveric allograft (74.2% vs. 50.8%, p < 0.01). Patients with IA were more likely to be Black (21.3% vs. 15.6%, p < 0.01) or American Indian (2.4% vs. 0.3%, p < 0.01) and were less likely to be White (69.5% vs. 78.2%, p < 0.01). The indication for KTx was more commonly diabetic nephropathy in those with IA (36.3% vs. 27.8%, p < 0.01) and less commonly polycystic kidney disease (5.8% vs. 11.8%, p < 0.01). We compared 31 comorbidities that are included in the Elixhauser comorbidity index (ECI). There were no significant differences between cases or controls for any comorbidities or for the mean composite ECI.
Within the study period, 607 patients (31.9%) died. One-year mortality was higher in patients with IA (aHR = 6.00, 95% CI [4.21–8.56], p < 0.01). Allograft failure occurred in 410 patients (21.6%). One-year graft failure was also higher in patients with IA (aHR = 4.76, 95% CI [2.61–8.67], p < 0.01).
Conclusions: Factors associated with increased odds of developing IA included older age, being American Indian, and longer time on dialysis pre-transplant. The latter highlights the importance of timely transplantation to mitigate the risk of IA post-transplant, particularly in patients with diabetic nephropathy or older age. The inequality of IA amongst the various races emphasizes the differing barriers to and social determinants of health faced. To decrease IA-related mortality and graft loss post-transplant, an individualized approach to antifungal prophylaxis is important, especially in centers with diverse transplant populations.

S08.3 Prevalence of Chronic Pulmonary Aspergillosis in Patients with Tuberculosis

Felix Bongomin
Abstract: Pulmonary tuberculosis (PTB) is the most important risk factor and the differential diagnosis of chronic pulmonary aspergillosis (CPA), especially in tuberculosis endemic areas. However, there is a striking overlap in both the clinical and radiological presentation of these two diseases. After PTB treatment, residual cavities remain in 20 to 40% of the patient’s lungs. From published studies, in patients with CPA, treated PTB is the primary underlying respiratory condition in 17–93% of cases.
The importance of treated PTB in the pathogenesis of CPA was demonstrated in the mid to late 1960s by a large cohort study at over 50 clinics in the Great Britain. In this study, the prevalence of CPA increased from 14% at the end of TB therapy to 22% 3 years later. Several recent studies have been published describing the incidence of CPA in various situations, particularly as a co-infection with PTB, as a differential diagnosis of smear negative TB, as a consequence of TB, and in many cases years after TB. This talk will focus on these new insights.
Keywords: chronic pulmonary aspergillosis; pulmonary tuberculosis; incidence; prevalence

S08.4 Prevalence of Chronic Pulmonary Aspergillosis among Active Pulmonary Tuberculosis Patients with Persisting Symptoms in Uganda

Martha Namusobya 1, Felix Bongomin 2, John Mukisa 3, David Denning 4, Shailendra Prasad 5, Christine Sekaggya-Wiltshire 1
  • 1 Infectious Diseases Institute
  • 2 Department of Medical Microbiology, Gulu University Medical School
  • 3 College of Health Sciences, Makerere University
  • 4 Manchester Fungal Infection Group, University of Manchester
  • 5 University of Minnesota
Objectives: Treated pulmonary tuberculosis (PTB) is the most important risk factor for chronic pulmonary aspergillosis (CPA) with a significant impact on their health-related quality of life. However, recent evidence suggests CPA may occur before or during active PTB treatment. This study aimed at determining the prevalence and associated factors of CPA among PTB patients with persistent sysptoms despite treatment.
Materials and Methods: We conducted a prospective, observational cohort study on drug sensitive PTB patients with persisting pulmonary symptoms after 2 months of anti-TB treatment at the TB Treatment Unit, Mulago National Referral Hospital, Kampala, Uganda. Patients characteristics were documented using a semi-structured questionnaire. Sputum samples were collected for all patients and high volume culture performed. Serum Aspergillus IgG/IgM lateral flow assay (LFA) was performed and visually read. CPA was defined based on (1) Persisting pulmonary symptoms of cough or hemoptysis following PTB treatment with a total symptom duration >3 months; (2) Chest X-ray (CXR) showing cavities, infiltrates, fungal ball, peri-cavitary fibrosis, or pleural thickening; and (3) evidence of Aspergillus infection (positive sputum culture or an Aspergillus LFA).
Results: We enrolled a total of 83 patients, 51 (61.5%) were male. The median age was 31.5 years (range: 18–69). Twenty-seven (32.5%) participants were HIV positive. Twenty-three (27.7%) sputum sampes grew Aspergillus niger and 4 (4.8%) grew A. fumigatus. Only 10 (12%) participants tested positive on the Aspergillus IgG/IgM LFA. On CXR, 5 (6.0%) participants had a fungal ball, 29 (34.9%) had cavities and 34 (41%) had pleural thickening. Overall, The prevalence of CPA was 28.9% (n = 24). CPA was independently associated with prior PTB (adjusted odds ratio (aOR): 16.7 (95%CI: 2.6–106.5, p = 0.003), age >32 years (aOR: 0.1, 95% CI: 0.02–0.58, p = 0.01) and far advanced CXR changes (aOR: 10.9, 95%CI: 2.6–45.7, p < 0.001). The sensitivity, specificity, positive predictive value and negative predictive value of the Aspergillus LFA were 37.5%, 98.3%, 79.5%, and 90%, respectively.
Conclusions: CPA is highly prevalent among active PTB patients with persistent respiratory symptoms, especially those with history of prior PTB treatment and those with adavanced CXR changes. A. niger is a common species of Aspergillus in our setting. Aspergillus IgG/IgM LFA is highly specific but less sensitive for the diagnosis of CPA in Uganda. We recommend routine screening for CPA among these subset of patients.

S08.5 CPAepi: A Study to Investigate Epidemiological Characteristics of Aspergillus spp. Isolated from CPA Patients

Juan Carlos Soto Debran 1, Ioannis Tommos 2, Aleksandra Barac 3,4, Helmut J. F. Salzer 5, Eva Van Braeckel 6, Oxana Munteanu 7, Fabian Leo 8, Danila Seidel 9, Josep Meletiadis 10, Christophe Hennequin 11 and Ana Alastruey-Izquierdo 1
  • 1 Micology Reference labortory, Instituto De Salud Carlos Iii
  • 2 2nd Pulmonary Medicine Department, “Attikon” University General Hospital, Medical School, National and Kapodistrian University of Athens
  • 3 Faculty of Medicine, University of Belgrade
  • 4 Clinic for Infectious and Tropical Diseases, Clinical Centre of Serbia
  • 5 Department of Pulmonology, Kepler University Hospital
  • 6 Ghent University Hospital
  • 7 Department of Pneumology & Allergology, State University of Medicine and Pharmacy “Nicolae Testemitanu”
  • 8 Department of Pulmonary Medicine, ELK Thorax Center
  • 9 Department I of Internal Medicine, University Hospital Cologne
  • 10 Clinical Microbiology Laboratory, “Attikon” University General Hospital, Medical School, National and Kapodistrian University of Athens
  • 11 Service de Parasitologie—Mycologie, Hôpital Saint-Antoine
Objectives: Chronic pulmonary aspergillosis (CPA) is a severe fungal pulmonary infection with a high morbidity and mortality. Information on the Aspergillus species and resistance pattern is of crucial importance in the management of CPA patients. However, a very limited number of studies reported 2–54% azole resistance rates. We present the epidemiology and antifungal susceptibility profile of Aspergillus species collected from CPA patients via CPAnet.
Methonds & Materials: Seventy six Aspergillus strains isolated from CPA patients were collected from seven European centers and sent to the Mycology Reference Laboratory of the National Centre for Microbiology in Spain. Isolates were sub-cultured and identified by means of ITS, BenA and/or calmodulin sequencing. Antifungal susceptibility profiles according to the EUCAST E.Def 9.3.2 method were determined for amphotericin B (AMB), itraconazole, voriconazole, posaconazole, isavuconazole, terbinafine, anidulafungin, caspofungin and micafungin. EUCAST clinical species-specific breakpoints were used to define resistance. For species with no breakpoints, ECOFFs were used to detect non-wild type phenotypes.
Results: Aspergillus fumigatus complex was present in 78.7% of all isolates (n = 59), followed by A. niger complex (n = 7; 9.3%), A. flavus complex (n = 6; 8%), A. nidulans complex (n = 2; 2.7%), and A. terreus complex (n = 1; 1.3%). Resistance in A. fumigatus complex to itraconazole, isavuconazole, posaconazole and AMB was 5% and 9% to voriconazole. In A. flavus complex, 17% of the isolates were resistant to itraconazole and isavuconazole while non-wild type were resistant to voriconazole and posaconazole. All isolates from A. nidulans complex were resistant to isavuconazole. Non-wild type isolates were found to be resistant for itraconazole (29%), voriconazole (29%) and posaconazole (43%) in A. niger complex. Echinocandins showed low MICs to all isolates tested but three strains that showed elevated MICs.
Conclusions: Aspergillus fumigatus was the most frequent species, but species from other complexes including cryptic species represent over 40% of the isolates. Resistance to azoles was present in A. fumigatus, A. flavus and A. nidulans complexes and to AMB in A. fumigatus complex. Treatment and outcome data are required to gain insight into potential mechanisms of resistance, and to evaluate the clinical impact of these findings.

S09.1 Distribution and Antifungal Susceptibility of Yeasts Causing Invasive Fungal Diseases in China: An Update from the CHIF-NET Study

Yao Wang
Peking Union Medical CollegeHospital, China
The CHIF-NET study is a laboratory-based, nationwide multicenter study of invasive yeast infections in China, which was initiated in August 2009. A total of 87 hospitals had participated in this program for a period of tensurveillance years.All Candida, Cryptococcus, and otheryeast strains recovered from blood; other sterile body fluids, includingascitic fluid and peritoneal dialysate fluid; pus; and tissue from patientswith invasive yeast infections were included in this study. Yeast strains from bronchoalveolar lavage (BAL) fluid samples, centralvenous catheter (CVC) tips, and the gastrointestinal tracts (e.g., biliarytract fluid [aseptically collected]) of patients with invasive infections weretested; however, yeast strains from urine and the genital tract and othersconsidered colonizers were excluded. Isolates of the same species and ofthe same susceptible or resistant biotype profile from the same site of agiven patient that were recovered at a different time were considered duplicatesand also excluded. All isolates were forwarded to a central laboratory(Department of Clinical Laboratory, Peking Union Medical CollegeHospital) for study.
Isolates collected from 2010 and 2011 were identified by DNA sequencing of the fungal rDNA internal transcribed spacer region supplemented with D1/D2 domain of the 28S rRNA gene. From 2012, species identification was carried by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS). For any isolates with no identification or uncertain identification results to species level by MALDI-TOF MS, rDNA sequencing was performed as ‘gold standard’. Susceptibility to fluconazole and voriconazole was determined using the Clinical and Laboratory Standards Institute (CLSI) disk diffusion method for isolates collected from 2010 to 2014. From 2015, the in vitro susceptibility to nine antifungal agents, including fluconazole, voriconazole, itraconazole, posaconazole, caspofungin, micafungin, anidulafungin, amphotericin B and 5-flucytosine, was determined using Sensititre YeastOneTM YO10 methodology (Thermo Scientific, Cleveland, OH, USA) following manufacturer’s instructions.
In this presentation, we’ll report the distribution and antifungal susceptibility of yeasts causing invasive fungal diseases in China, anupdate from the CHIF-NET Study.

S09.2 A Global Team Effort—FungiScope

Danila Seidel
FungiScope grew from a registry collecting clinical cases of emerging fungal infections initiated at the University Hospital of Cologne in 2003 by the European Confederation of Medical Mycology (ECMM) and The International Society for Human & Animal Mycology (ISHAM) to a global network with partners in currently 85 countries. Today, the registry includes also Aspergillus-related infections. Scientists and clinicians from around the world merge their expertise to improve clinical management and eventually outcome of patients with fungal infections. With their shared ambition, the network has a record of accomplishment of several publications on the epidemiology and treatment of fungal infections. Registry data were incorporated in the current global guideline on diagnosis and management of mucormycosis and infections caused by rare yeasts. During the pandemic, COVID-19 associated aspergillosis and mucormycosis came into focus. In this presentation, you will be updated on the latest findings and ongoing studies within the network. You will hear about the clinical impact of super rare fungal infections that clinicians might see once in their life and about the current struggle with COVID-19 associated fungal infections among others.

S09.3 FUNGINOS—The Fungal Infection Network of Switzerland

Nina Khanna
The Fungal Infection Network of Switzerland (FUNGINOS) is a registered association with seat in Lausanne. This national hospital network was founded by infectious diseases specialists in 2005. FUNGINOS has developed a research network of infectious diseases specialists, clinical microbiologists and physicians of other specialties from all five universities and two tertiary care university-affiliated hospitals with expertise in conducting clinical, epidemiological, diagnostic, and microbiological studies on invasive fungal infections. Aim of the FUNGINOS association is to promote clinical and basic research on the epidemiology, diagnosis, treatment, and prevention of invasive fungal infections. The ultimate goal is to promote good clinical practice and medical education as well as to improve management and outcome of patients suffering from these life-threatening complications.
The present talk will give an overview of recent ongoing and published research work of FUNGINOS.

S09.4 Update from ECMM and International Registries: FungiScope Candida/CandiReg

Philipp Köhler
Objectives: Invasive Candida infections (ICI) are among the most frequent bloodstream infections. They are associated with high morbidity and mortality. Due to medical progress, the number of critically ill patients at risk for ICI are continuously rising. The emergence of the multidrug-resistant species C. auris, has caused outbreaks worldwide and led to clinical alerts in United States and European healthcare facilities. The ECMM Candida Registry (FungiScope Candia/CandiReg) was founded in January 2018, triggered by the C. auris outbreaks in Spain and the United Kingdom. The main objective is to overcome the lack of knowledge on epidemiology, clinical course and molecular characteristics of invasive Candida infections and to function as a platform for international multicentre studies and surveillance of multinational C. auris outbreaks.
Materials & Methods: The platform is an international non-interventional multicentre registry project. The registry was founded in January 2018 and is ongoing without a defined endpoint. Treating physicians and medical microbiologists alike are invited to participate in the collection of clinical data and fungal isolates from cases of candidemia and tissue-invasive candidiasis. CandiReg uses an electronic case report form (eCRF) using the online electronic data capture platform www.clinicalsurveys.net. Case registration is on a voluntary basis. Target groups are patients with invasive candidiasis or candidemia.
Results: The ECMM Candida Registry (FungiScope Candia/CandiReg) serves as platform for international cooperation and studies on attributable mortality, Candida-reactive T cells, evaluations of guideline adherence, and the third multicentre ECMM study on incremental costs associated with nosocomial invasive candidiasis in Europe, CANDIDA III was initiated taking advantage of this platform. The CANDIDA III study focuses on evaluating the attributable mortality and costs as well as diagnostic and therapeutic approaches (including prolonged hospital stay for completion of parenteral antifungal treatment) of nosocomial invasive candidiasis in Europe. As a secondary objective, it will evaluate the antifungal resistance among Candida spp. causing invasive disease across Europe. The study will use a matched case-control design, which will allow the implementation of health economic analysis on the incremental costs associated with invasive Candida infections.
Conclusions: The platform can be used for future multinational surveillance studies on invasive candidemia in Europe. With this registry, we collect real-life data with long-term observations. The registry will provide controlled or uncontrolled level II evidence and is ready in case of an outbreak situation. In conclusion, the CandiReg platform promotes international collaboration, increases the quality of available evidence on invasive Candida infection and can contribute to improvement of patient management.

S09.6 CPAnet: An International Chronic Pulmonary Aspergillosis Registry

Eva Van Braeckel
Chronic pulmonary aspergillosis (CPA) is a chronic fungal infection of the lung associated with high morbidity and mortality. The international CPA Research Network (CPAnet) was founded in 2017, followed by the creation of its multinational and multicenter CPAnet registry launched in 2018.
The CPAnet registry is a web-based registry, approved by the Institutional Review Board and Ethics Committee (EC) of the University Hospital Cologne, Germany, as well as by the local ECs of the other participating centers. As of February 2020, the CPAnet registry was awarded a Clinical Research Collaboration (CRC) by the European Respiratory Society (ERS).
The aim of this registry is to increase awareness in pulmonologists and infectious diseases specialists worldwide, to improve CPA knowledge and patient care, and to allow for future clinical and epidemiological research. An interim analysis of the data will be presented to lift a tip from the veil of the wealth of structured information embedded within the CPAnet registry. Additional clinical sites and reference centers are highly welcomed to join this clinical research collaboration ([email protected]).
In the near future, this registry will indefinitely allow for multicentric clinical and epidemiological research on CPA of crucial importance, aiming to fill the lack of previous evidence on disease management.

S10.1 Diagnosis of Candida: Culture, β-Glucan and Mannan

Elizabeth Johnson
For the purposes of this presentation I use ‘Candida’ in the widest sense to include all those unrelated yeast species which taxonomically are now more accurately classified in different genera but which were previously in the taxonomic grouping known as ‘Candida’. Whilst the diagnosis of Candida infection is arguably one of the most straightforward in medical mycology, the need for more rapid diagnosis of candidaemia to improve the prognosis, especially in the face of sepsis, has driven biomarker development as an adjunct to, and ideally to pre-empt, culture results. Moreover biomarker detection is useful in conditions where blood culture is often not revealing such as endocarditis, chronic candidosis, CSF analysis in cerebral candidosis; and is also useful in prognosis.
Undoubtedly culture of blood, other sterile fluid or tissue remains the gold standard, with candidaemia a proven diagnosis. Blood culture techniques have improved over the years and have the advantage that they yield an organism. Identification methods for yeast have dramatically improved from the days of phenotypic and biochemical analysis, with rapid proteomic techniques using MALDI-ToF facilitating identification in as little as 20 min. Species identification is extremely helpful in predicting the likely susceptibility but isolation in culture also allows specific susceptibility testing.
Two biomarkers, β-D-glucan and mannan, have been employed on blood and CSF to detect the presence of Candida. The most sensitive is β-D-glucan detection, however this is a cell wall component of many, in fact the majority of clinically relevant fungal species, so it lacks specificity. A positive result is an indication of the presence of β-glucan which may be from a fungal source, including Candida infection, but may also be due to gut leakage of dietary β-glucans, contamination from cellulose membranes and dressings, gram negative bacteraemia, the administration of filtered blood products such as IVIg and even some antibiotic batches. A positive result is thus more useful in a patient where there is a high index of suspicion and no accompanying likely alternative source of β-glucan. Sensitivity and specificity reports therefore vary quite widely depending on the patient group.
Mannan is a cell wall component of many yeasts, but has a greater specificity than β-glucan. The issue with this biomarker is its propensity for positivity in patients merely colonised with yeast so it is an unreliable marker of infection. Nevertheless it has a place in confirming the CSF diagnosis of cerebral candidosis, chronic candidosis in the presence of hepato-splenic abscesses and Candida endocarditis in the presence of vegetations and a high Candida antibody titre, and can be a helpful prognostic marker in these conditions.
A major issue with biomarker testing has been turn-around-times as the benefit of a result designed to pre-empt culture is lost if the result takes several days to be returned to the clinician. In many laboratories, biomarkers are same-day tests and even during the massive pandemic-associated surveillance biomarker increase we maintained testing within 24 h. Many laboratory information management systems (LIMS) including ours, allow remote access so distant laboratories can access results on their patients as soon as they are authorised. A more recent UK development is the National Pathology Exchange (NPex) with the ambition to connect all UK labs through a single exchange hub, thus enabling test requests and pathology results to be sent digitally from and to any laboratory in a matter of seconds, whilst specimens are sent by an overnight tracked transport system. Setting this up takes a bit more effort and IT expertise on both sides but several of our major users are now connected.

S10.2 The Role of PCR and T2 MR

Cornelia Lass-Flörl
Objectives: Mortality rates due to invasive candidiasis (IC) remain unacceptably high, in part because the poor sensitivity and slow turn-around time of cultures delay the initiation of antifungal treatment. Cultures are negative in ~50% of invasive candidiasis.
Materials & Methods: Based on a literature research, data are emerging for the performance of nonculture tests such as mannan/antimannan, Candida albicans germ tube antibody, 1,3-β-D-glucan, PCR, and the T2Candida panel in diagnosing both candidemia and deep-seated candidiasis. For tests to be useful, the pretest likelihood of invasive candidiasis and test performance for the most common disease manifestation in a given patient must be understand.
Results: Several PCR assays, including commercially available kits, have been developed for the detection of Candida spp. The high sensitivity makes these assays appealing tools for the early diagnosis of IC. Depending on the method used for DNA extraction, free DNA or intact pathogen cells are detected. This difference can be relevant for patients under antifungal therapy as this may specifically affect the outcome of molecular tests that detect only intact cells. On the other hand, the interpretation of positive results from assays detecting free DNA can be challenging. Thus, the position of Candida PCR assays in the diagnostic algorithm of IC is not easy to establish. As published data show, Candida PCR has a higher sensitivity than blood culture but shows the best efficacy when used in conjunction with blood cultures and/or additional tests.
The T2Candida system was recently licensed by the US FDA and was designated as superior to conventional blood culture systems for the detection of candidemia. In detecting the five most commonly recovered medically important Candida spp. (Candida albicans, Candida tropicalis, Candida parapsilosis, Candida glabrata, and Candida krusei), the T2Candida system utilizes a T2 magnetic resonance technology coupled with pathogen-derived nucleic acid amplification to identify the five target pathogens within 2 to 5 h from the time of initiation of the assay. Studies in adults have demonstrated a more rapid time to detection, in comparison with that of conventional blood cultures. Blood cultures can detect 1 CFU/mL of most Candida sp. and remain the gold standard, hence it is unknown what proportion of the T2Candida positive and blood culture negative results represent false-negative cultures, deep-seated occult infection with negative blood cultures, or false-positive T2Candida results.
Conclusions: The quick turn-around-time of T2Candida, ability to rapidly detect potential azole-resistant species, e.g., C. krusei and consequent earlier initiation of appropriate antifungal therapy would be expected to produce a noticeable survival benefit.

S10.3 Mixed Yeast Infections—Common or not?

Ana Alastruey-Izquierdo
Mycology Reference Laboratory, National Centre for Microbiology, Madrid, Spain
Objectives: Invasive candidiasis remains one of the most prevalent systemic mycoses. Several studies have documented the presence of mixed yeast infections but data is very limited. We conducted a multicenter prospective study to describe the epidemiology and microbiological characteristics of mixed yeast infections causing invasive candidiasis.
Materials & Methods: Thirty-four centers from 14 countries participated. Samples were collected for a period of six months. All mixed yeast infections in sterile samples were isolated and sent to a reference laboratory to conduct molecular identification and antifungal susceptibility testing by EUCAST methodology.
Results: A total of 6895 yeast cultures were identified and mixed yeast infections occurred in 150 cases (2.2%). Most of the centers were from Europe, with an overall rate of 4.2% (118 out of 2840 yeast cultures). Of 122 cases, the most frequent combinations were Candida albicans/C. glabrata (42, 34.4%), C. albicans/C. parapsilosis (17, 14%), and C. glabrata/C. tropicalis (8, 6.5%). All Candida isolates were susceptible to amphotericin B, 6.4% were fluconazole-resistant, and two isolates (1.6%) were echinocandin-resistant.
Conclusions: The global rate of mixed yeast infections was 2.2%, 4.2% in Europe (the most represented continent). C. albicans/C. glabrata was the most common combination, but a high diversity of combinations and distributions was identified. Resistance to echinocandins was present but rare and fluconazole resistance rates were variable. As different susceptibility patterns can be identified in MY infections, it is important to accurately identify the species involved and to perform susceptibility testing to support the clinical management of these infections.

S11.3 Mycobiome and Invasive Candidiasis

Tobias Hohl
The intestinal microbiota is a complex community of bacteria, archaea, viruses, protists and fungi. While the composition of bacterial constituents has been linked to immune homeostasis, infectious susceptibility, and clinical outcomes in bone marrow transplantation, the role of non-bacterial constituents and of cross-kingdom microbial interactions in these processes is poorly understood. Fungi represent a major cause of infectious morbidity and mortality in immune-compromised individuals. To examine the relationship of intestinal fungi (i.e., the mycobiota) with fungal bloodstream infections (BSI) we integrated an optimized bioinformatics pipeline with high-resolution mycobiota sequencing and comparative genomic analyses of fecal and blood specimens from recipients of allogeneic hematopoietic cell transplants (allo-HCT).
First, we conducted a small case-control study to compare the intestinal mycobiota of allo-HCT patients with (n = 8) and without (n = 7) Candida BSI. Patients with Candida BSI experienced a prior marked intestinal expansion of pathogenic Candida species; this expansion consisted of a complex dynamic between multiple species and subspecies with a stochastic translocation pattern into the bloodstream. The intestinal expansion of pathogenic Candida species was associated with a significant loss in bacterial burden and diversity, particularly in the anaerobes.
Second, we conducted a larger observational study in allo-HCT patients (n = 156) examine the overall density and biodiversity of intestinal fungi during allo-HCT. In this cohort, we found that global measures of fungal density and diversity were stable, but that the species composition changed drastically from day to day. We identified a subset of patients with fungal dysbiosis characterized by culture positivity, stable expansion of Candida parapsilosis complex species, and distinct trans-kingdom microbiota profiles. These patients had worse overall survival and higher transplant-related mortality, independent of candidemia. Thus, simultaneous analysis of intestinal fungi and bacteria identifies dysbiosis states across kingdoms that may promote facilitate invasive disease and poor allo-HCT outcomes. These findings support microbiota-driven approaches to identify patients at risk for fungal BSI and adverse allo-HCT outcomes for pre-emptive therapeutic intervention.

S11.4 Mycobiome and Microbial Interactions

Ilse Jacobsen
Objectives: As both commensal and pathogen, Candida interacts not only with the host but also with members of the bacterial microbiota. While antagonistic interactions between Candida and bacteria have received considerable attention, synergistic interactions are less well understood. One of the most common Candida-associated bacteria identified during mixed infections are enterococci, especially E. faecalis. Our work and that by others demonstrated synergistic interactions between these species, and I will discuss some of the underlying mechanisms identified.
Materials & Methods: We used a mucus-producing in vitro enterocyte model with different MOIs and C. albicans and E. faecalis strains to determine factors contributing to synergistic damage. The role of physical interactions was analysed using transwell inserts and culture supernatants. The possible impact of metabolites was investigated by metabolome analysis and spiking experiments. As a proof-of-concept for the in vivo relevance we employed a murine oropharyngeal candidiasis model.
Results: Consequences of E. faecalis-C. albicans interactions for enterocyte damage in vitro depend on the bacterial strain and synergism requires expression of the E. faecalis cytolysin. Cytolysin-dependent synergism was confirmed in vivo in mice. Synergistic damage was independent of filamentation, candidalysin, and was also promoted by less pathogenic fungal species. While physical contact of fungi and bacteria contributed to synergistic damage, enhanced bacterial damage was also observed with C. albicans-conditioned media. We identified glucose depletion by Candida as one factor that promotes host cell damage by E. faecalis.
Conclusions: Our data and results from other groups with other bacteria indicate that certain bacterial-fungal combination have to potential to aggravate the course of infection in vitro and in animal models. This is likely also the case in human patients, with possible consequences for treatment and outcome. A deeper understanding on which bacteria and bacterial factors act synergistically with Candida is however necessary to determine which patients might be at increased risk and in which cases treatment should be adjusted to target specific coinfections.

S11.5 Development of a Novel Mycobiome Diagnostic for Fungal Infection

Danielle Weaver, Mike Bromley and Paul Bowyer
University Of Manchester
Objectives: Pan-fungal diagnostics which simultaneously allow speciation would be a vast improvement to clinical mycology. Within the last decade, the human mycobiome has been increasingly characterised using NGS targeting the internal transcribed spacer (ITS) regions. Mycobiome analysis is a strong candidate diagnostic, with the potential to identify all species within a sample and possibly in a quantitative manner. ITS targets give broad coverage and high sensitivity, but their ability to provide an accurate, quantitative representation of a fungal community has been questioned. The variable copy number of ITS regions in fungal genomes and the presence of intra-species variation can introduce bias. To avoid these issues, this study aimed to develop a novel, alternative amplicon target for use as an NGS fungal diagnostic.
Materials & Methods: A novel DNA target was designed to enable mycobiome analysis using the latest Illumina sequencing platform, the iSeq100, whose relatively low cost, small size and ease-of-use makes it highly suitable for a diagnostic laboratory. To enable automated analysis and rapid results, an in-house bioinformatics workflow and sequence database were also developed. Pilot sequencing of mock fungal communities was performed to compare the new assay and established ITS1 method using the Illumina iSeq100 and MiSeq sequencing platforms.
Results: The novel assay performed similarly on both sequencing platforms and could successfully identify Aspergillus, Penicillium, Candida, Cryptococcus, Rhizopus, Fusarium and Lomentospora species. The new target was also capable of differentiating closely related species such as Aspergillus fumigatus and Aspergillus fischeri. In addition, it outperformed ITS1 at identifying A. fumigatus, Rhizopus arrhizus, Fusarium oxysporum and other filamentous pathogens in mixed fungal communities (in the presence or absence of background human DNA). Lastly, the assay could detect as few as 2 haploid genome equivalents of A. fumigatus from spiked sputum.
Conclusions: This study has developed and tested a novel metabarcoding target and found the assay to outperform the commonly used ITS1 region at identifying filamentous fungi. The assay is a promising diagnostic candidate that could provide affordable NGS analysis to a clinical mycology laboratory.

S11.6 Effect of Exposition to Broad-Spectrum Antibiotics on the Gut Mycobiota of Healthy Volunteers

Margot Delavy 1, Charles Burdet 2,3, Natacha Sertour 1, Stevenn Volant 4, Nathalie Grall 2, Amine Ghozlane 4, Xavier Duval 2,5, France Mentré 2,3, Christophe d’Enfert 1, Marie-Elisabeth Bougnoux 1 and for the CEREMI Group
  • 1 Institut Pasteur, INRA, Unité Biologie et Pathogénicité Fongiques
  • 2 Université de Paris, INSERM, IAME, UMR 1137
  • 3 AP-HP, Departement of Epidemiology, Biostatistic and Clinical Research, Hôpital Bichat
  • 4 Institut Pasteur, Bioinformatics and Biostatistics Hub-C3BI-USR 3756 IP CNRS
  • 5 INSERM Clinical Investigation Center 1425
Objectives: Antibiotic exposure impacts the intestinal bacterial microbiota, but little is known on its effect on the fungal intestinal microbiota (mycobiota) in humans. We studied the effects of 3rd generation cephalosporins (3GC), a class of β-lactam antibiotics, on the gut mycobiota of healthy volunteers and their impact on the proliferation of the opportunistic fungal pathogen Candida albicans.
Materials & Methods: Two groups of 11 healthy volunteers received either intravenous ceftriaxone (1 g/24 h) or cefotaxime (1 g/8 h) for 3 days. Fecal samples were collected before treatment at days (D)-15, -7, -1, during treatment at D1, D2 and D3, and after treatment at D4, D7, D10, D15, D30, D90, D180. We quantified fungal and C. albicans DNA by qPCR targeting 18S rRNA or C. albicans internal transcribed spacer (ITS) 2 rRNA region, respectively. We studied gut mycobiota by sequencing the ITS1 rRNA region (HiSeq platform, Illumina). Finally, β-lactamase activity was quantified in the fecal samples by measuring nitrocefin—a chromogenic cephalosporin substrate–hydrolysis.
Results: Before 3GC exposure, the volunteers’ mycobiota was characterized by a high within and between diversity (Bray-Curtis dissimilarity within/between median: 0.85/0.88) and a low alpha diversity (median of 25 Operational Taxonomic Units per sample, Shannon Index of 1.23). By qPCR, C. albicans DNA could be detected in 20/21 volunteers, leading to a colonization rate of 95.2%. In comparison, culture and sequencing methods underestimated this colonization rates (18.2% and 45.5% colonization rate, respectively).
Discriminative analysis identified disparately represented fungal taxa in the volunteers’ samples before and after antibiotic treatment. Two days after the start of 3GC treatment, we observed a long-term expansion of the mycobiota over the microbiota, remaining for 30 days. Penicillium sp. relative abundance (RA) was significantly reduced between D1 and D4 (Wilcoxon test; q-value of 0.013, 0.005, 0.003 and 0.0002, respectively). More interestingly, the RA of C. albicans, Saccharomyces sp. and S. cerevisiae were increased at D4 (Wilcoxon test; q-value of 0.042, 0.014 and 0.026, respectively). In addition of sequences analyses, C. albicans increase was also confirmed with qPCR data, with the maximum reached at D2 (Wilcoxon test; p-value of 0.026).
Finally, we observed a negative correlation between the changes in β-lactamase activity and the changes of C. albicans DNA concentration for the D0D10 period (Spearman correlation; R: −0.59, p-value: 0.009). Indeed, in volunteers displaying a high increase of the β-lactamase activity after 3GC exposure, we could not observe any C. albicans proliferation. However, we observed a significant increase of C. albicans DNA at D4 in volunteers displaying a lower increase or even a decrease of β-lactamase activity (Wilcoxon test; p-value of 0.840, 0.008).
Conclusions: The 3GC treatment affects the mycobiota both at short and long-term and is linked to an increase of the fungal load, and, especially, of C. albicans. We identified the changes of β-lactamase activity as a potential key factor for the proliferation of C. albicans.
By having a better understanding of the factors behind C. albicans proliferation in the gut, we could identify new ways to prevent potentially life-threatening secondary infections by this pathogen.

S12.2 Definition, Diagnosis and Treatment of COVID-19 Associated Pulmonary Aspergillosis—ECMM/ISHAM Consensus Guidance

Philipp Köhler
Objectives: In December, 2019, COVID-19 emerged from Wuhan, China, rapidly evolved into a pandemic. Multiple publications and reports of COVID-19-associated pulmonary aspergillosis (CAPA), describing CAPA as an additional contributing factor to mortality have raised the awareness towards fungal superinfections in COVID-19 patients. Initial descriptions of patients with suspected CAPA illustrated the challenge of to diagnose CAPA. This is due to the fact that the use of established definitions including host factors and clinical factors (including radiology) may not be optimal in this patient population. Facing these challenges to diagnose and manage patients with CAPA, there was an urgent need to study the epidemiology and characteristics of CAPA.
Materials & Methods: To facilitate this, the European Confederation for Medical Mycology and the International Society for Human and Animal Mycology assigned a group of experts to propose consensus criteria for a case definition of CAPA and to provide up-to-date management recommendations for the diagnosis and treatment. The group gathered 22 experts from 14 countries in 6 continents. Literature review of particular topics were performed in small groups, that contributed subsections to draft consensus definitions, which was agreed on after several rounds of revision.
Results: CAPA is proposed to be defined as possible, probable, or proven. These categories depend from the sample validity and thus diagnostic certainty. Recommended first-line therapy is either voriconazole or isavuconazole. If azole resistance is of concern, then liposomal amphotericin B is the drug of choice.
Conclusions: The proposed consensus definition for CAPA facilitate homogeneous classification of CAPA patients in registries and interventional clinical trials. Moreover, the definitions can be used in daily practice for managing patients with CAPA.

S12.3 COVID Associated Mucormycosis

Arunaloke Chakrabarti
With the specter of COVID-19 pandemic, invasive fungal infections (IFIs) loom large across the globe. Among IFIs, COVID-19 associated mucormycosis (CAM) epidemic in low-and middle-income countries especially India has drawn attention of world authorities, as the outbreak is unprecedented and number of CAM cases in India exceeded 50% of global cases. A multi-center Indian study during September to December 2020 reported CAM cases at 0.27% and 1.6% of COVID-19 patients treated in hospitals and intensive care units respectively. The rise of number was 2.1-fold during the study period compared to 2019 at those centers. The patients acquired the infection at median 18 days post-COVID diagnosis. Hypoxia and inappropriate steroid therapy were identified as significant risk factors for acquiring CAM. Subsequently, the situation turns grave in India with >50,000 CAM cases during the second wave of COVID-19 (March to July 2021). The case numbers may be more than this, as the Government of India CAM dashboard mentions ‘It is very likely that the actual figures are considerably higher than this’. For the first time, CAM is declared as ‘Notifiable Disease’ in India. During this period, management of CAM cases has gone out of hands due to limited number of skilled health workers to diagnose and treat mucormycosis, and non-availability of anti-Mucorales drugs. The question that raised in everyone’s mind is—‘Why is the surge of CAM cases in India?’. Myriad hypotheses including high Mucorales in the environment, contamination of oxygen supplies, respiratory equipment, humidifier water, reused face masks, and zinc supplementation are proposed as reasons for the epidemic. But except high spore count in both indoor and outdoor environment, none of those hypotheses is proven. Our recent studies on zinc supplementation and multi-centre study on environmental factors also negated those hypotheses. Then, what are the reasons? Four factors including high spore count in environment, uncontrolled diabetes, inappropriate steroid use, and COVID-19 virus itself have been identified as possible reasons for the outbreak. The most likely narrative is that due to very high number of COVID-19 patients in the hospital during the second wave, doctors failed to do glycemic control of hyperglycemic patients and inadvertently used inappropriate dose to steroid to maintain oxygen saturation of those patients due to oxygen crisis. COVID-19 virus is known to damage β-cells of pancreas and cause enthothelitis, but it is not clear whether it impairs Mucorales-specific immunity. To tide over the antifungal availability crisis, ECMM and ISHAM jointly recommended an emergency alternate algorithm. Since the month of August 2021, with decrease in number of COVID-19 patients and better management protocol in India, the outbreak is controlled to certain extent, but unknown issues regarding the CAM epidemic haunt the minds of medical microbiologists across the globe.
References
  • Chakrabarti A. The recent mucormycosis storm over Indian sky. Indian J. Med. Microbiol. 2021, 39, 269–270.
  • Hoenigl, M.; et al. The emergence of COVID-19 associated mucormycosis: Analysis of cases from 18 countries. Bioxriv 2021, https://doi.org/10.2139/ssrn.3844587.
  • Patel, A.; et al. Multicenter Epidemiologic Study of Coronavirus Disease-Associated Mucormycosis, India. Emerg. Infect. Dis. 2021, 27, https://doi.org/10.3201/eid2709.210934.
  • Muthu, V.; et al. Is there an association between zinc and COVID-19-associated mucormycosis? Results of an experimental and clinical study. Mycoses 2021, 22, https://doi.org/10.1111/myc.13365. Epub ahead of print. PMID: 34420245.
  • Muthu, V.; et al. Epidemiology and pathophysiology of CIVID-19 associated mucormycosis: India vs. the rest of the world. Mycopathologia 2021, 2021, https://doi.org/10.1007/s11046-021-00584-8.
  • Rudramurthy, S.M.; et al. ECMM/ISHAM recommendations for clinical management of COVID -19 associated mucormycosis in low- and middle-income countries. Mycoses 2021, 64, 1028–1037. Available online: https://governmentstats.com/mucormycosis/index.html (accessed on 8 October 2021).

S12.4 Cytomegalovirus Infection and Invasive Fungal Disease

Monica Slavin
Invasive fungal disease (IFD) and viral infections frequently occur in immune compromised hosts, with viral infection preceding IFD. The first reports of this interaction came from the observation that solid organ (SOT) and haematopoietic stem cell transplant (HCT) recipients who developed end organ cytomegalovirus (CMV) invasive disease were at a significantly increased risk of developing both early and late onset IFD, particularly invasive aspergillosis, invasive mould disease and Pneumocystis pneumonia. The association with candidiasis in less clear. Further studies showed that CMV viremia, antigenemia and recipient CMV serostatus also increased the risk. CMV viremia or antigenemia increases the risk for IFD in the order of three times. However, CMV kinetics also influence risk. In HCT recipients the area under the curve of CMV antigenemia (number of positive cells and duration of antigenemia) impacts risk and in the critically ill immune suppressed patient with CMV viremia, the peak viral load influences risk for IFD. The combination of CMV viremia and influenza infection also increased the risk for IFD 25 times in one study in immunocompromised ICU patients.
CMV infection may increase the risk of IFD due to a number of common and pathogen-specific, host, treatment and environmental risk factors. The immune modulatory effects of CMV infection and associated viruses such as HHV6 and the impact of ganciclovir treatment will be described. When a HCT or SOT recipient develops CMV reactivation, the risk for IFD should be considered along with whether prophylaxis for mould or Pneumocystis infection is indicated. In particular, risks for neutropenia with ganciclovir, likely duration of ganciclovir use, presence of other viral infections and level of immune-suppression should be taken into account.
Further research is warranted to determine the biological interaction between CMV and IFD in order to better identify future patients at high risk of developing IFDs and interventions to decrease the risk.

S12.5 Pulmonary Aspergillosis in Critically Ill Coronavirus Disease 2019 Patients—A Multinational Study

Juergen Prattes, Joost Wauters, Daniele Roberto Giaccobe, Jon Salmanton-García, Johan Maertens, Marc Bourgeois, Marijke Reynders, Lynn Rutsaert, Niels Van Regenmortel, Piet Lormans, Simon Feys, Alexander Reisinger, Oliver A. Cornely, Tobias Lahmer, Mericela Valerio, Laurence Delhaes, Kauser Jabeen, Joerg Steinmann, Mathilde Chamula, Matteo Bassetti, Stefan Hatzl, Riina Rautemaa-Richardson, Philipp Koehler, Katrien Lagrou, Martin Hoenigl
Medical University Of Graz
Objectives: Coronavirus disease 2019 (COVID-19) associated pulmonary aspergillosis (CAPA) has emerged as a complication in critically ill COVID-19 patients. The main objectives of this study were to determine the prevalence of CAPA in patients with COVID-19 in intensive care units (ICU) and to investigate risk factors for CAPA as well as outcome.
Methods: The European Confederation of Medical Mycology (ECMM) conducted a multinational study including 20 centers from nine different countries to assess epidemiology, diagnosis, risk factors, treatment and outcome of CAPA. CAPA was defined according to ECMM/ISHAM consensus definitions.
Results: A total of 592 patients were included in this study, including 11 (1.9%) patients with histologically proven CAPA, 80 (13.5%) patients with probable CAPA, 18 (3%) with possible CAPA and 483 (81.6%) without CAPA. CAPA was diagnosed a median of 8 days (range 0–31) after ICU admission predominantly in older patients [adjusted hazard ratio (aHR) 1.04 per year] with any form of invasive respiratory support (HR 3.4) and receiving tocilizumab (HR 2.45). Median prevalence of CAPA per center was 10.7% (range 1.7–26.8%). CAPA was associated with significantly lower 90-day ICU survival rate (29% in patients with CAPA vs. 57% in patients without CAPA; Mantel-Byar p < 0.001) and remained an independent negative prognostic variable after adjusting for other predictors of survival.
Conclusions: Prevalence of CAPA varied between centers. CAPA was more prevalent among older patients receiving invasive ventilation and tocilizumab, and an independent strong predictor of ICU mortality.

S12.6 Immunological Profiles of Patients with Influenza-Associated Pulmonary Aspergillosis (IAPA)

Intan M.W. Dewi 1,3, Nico A.F. Janssen 1,3, Edwin Ardiansyah 1, Mihai G. Netea 1,3, Paul E. Verweij 1,3, Reinout van Crevel 1 and Frank L. van de Veerdonk 1,3
  • 1 Department of Internal Medicine, Radboud University Medical Center
  • 2 Department of Medical Microbiology, Radboud University Medical Center
  • 3 Radboudumc—CWZ Center of Expertise for Mycology
Objectives: Influenza-associated pulmonary aspergillosis (IAPA) has recently been recognized as a serious complication of severe influenza and causes high mortality in patients. In this study, we aim to characterize the inflammatory and immune responses of patients with severe influenza and IAPA.
Materials and methods: We compared the levels of circulating inflammatory markers, ex vivo cytokine production in peripheral blood mononuclear cells (PBMCs) stimulated with various ligands, and reactive oxygen species (ROS) induction in PBMCs and neutrophils in response to A. fumigatus conidia, between patients with influenza-associated pulmonary aspergillosis (IAPA), severe influenza without IAPA, and healthy controls.
Results: Severe influenza patients (with or without IAPA) have higher levels of circulating inflammatory markers compared to healthy controls, which may indicate a state of hyperinflammation. IAPA patients show specific increase in several proteins, including IL-5, compared to severe influenza patients without IAPA. Ex vivo production of innate cytokines in PBMCs were comparable between patients and healthy controls. Strikingly, production of IFN-γ after cell stimulation with several stimuli were significantly lower in patient with influenza regardless of Aspergillus infection. Cytokine production was not significantly different between IAPA patients and severe influenza patients without IAPA. Furthermore, Aspergillus- induced ROS production was elevated in neutrophils of IAPA patients compared to patients with severe influenza without IAPA and healthy controls.
Conclusions: Hyperinflammation and adaptive immune dysregulation are present in severe influenza. Specific immune markers which are elevated in IAPA patients could be explored as potential biomarkers.

S13.3 Tracing Patterns of Evolution and Acquisition of Drug Resistant Aspergillus fumigatus Infection from the Environment Using Population Genomics

Matthew Fisher
Objectives: Infections caused by opportunistic fungal pathogens are increasingly resistant to first-line azole antifungal drugs. However, despite its clinical importance, little is known about the extent to which susceptible patients acquire infection from drug resistant genotypes in the environment. Our objective was to undertake a population genomic analysis of the mould Aspergillus fumigatus from across the United Kingdom and Ireland in order to trace patterns of evolution and acquisition of drug resistant A. fumigatus infection from the environment.
Materials & Methods: A total of 153 clinical A. fumigatus isolates from five participating centres were included. Environmental isolates (n = 65) were collected from the following sources: soil (72%), plant bulbs (12%), air (3%), compost (2%), and unknown (11%). All isolates were genome sequenced and analysed within a phylogenetic framework.
Results: We present a population genomic analysis showing with high confidence occurrences where A. fumigatus has evolved resistance in the environment prior to infecting patients. We find that the fungus is structured into two clades (‘A′ and ‘B′) with little interclade recombination and the majority of environmental azole resistance genetically clustered inside Clade A. Genome-scans show the impact of selective sweeps across multiple regions of the genome. These signatures of positive selection are seen in regions containing canonical genes encoding fungicide resistance in the ergosterol biosynthetic pathway, whilst other regions under selection have no known function. Phenotyping identifies genes in these regions that act as modifiers of resistance.
Conclusions: Our study supports the hypothesis that the widespread use of azoles as fungicides in agriculture is coupled to the increasing isolation of azole-resistant A. fumigatus from environmental sources. That these isolates bear hallmark multi-locus genotypes that are indistinguishable to those recovered from patients supports the conclusion that adaptation to fungicides in the environment is leading to acquisition of A. fumigatus bearing azole-resistance genotypes. Here, we identify spatially widespread clones of A. fumigatus that are not only resistant to azoles but are also highly represented in both the environment and the clinic, suggesting that that there are few fitness costs associated with this phenotype. Our research underscores the need to more fully understand the risk posed by environmental reservoirs of pathogenic fungi that, through the use of agricultural fungicides have evolved resistance to first-line clinical azoles.

S13.4 EHA Guideline on Antifungal Prophylaxis in Adult Acute Myeloid Leukemia Treated with Novel Agents

Jannik Stemler 1,2,3, Nick de Jonge 4, Nicole Skoetz 5, Roger Bruggemann 6,7, János Sinkó 8, Alessandro Busca 9, Zdenek Racil 10, Ronen Ben Ami 11, Vanessa Piechotta 5, Russell Lewis 12 and Oliver A. Cornely 1,2,3,13
  • 1 Department I for Internal Medicine, University Hospital of Cologne
  • 2 Chair Translational Research, Cologne Excellence Cluster on Cellular Stress Responses in Aging-Associated Diseases (CECAD), University of Cologne
  • 3 German Centre for Infection Research (DZIF), Partner Site Bonn-Cologne
  • 4 Department of Haematology, Amsterdam UMC, Amsterdam
  • 5 Cochrane Haematology, Department I for Internal Medicine, University Hospital Cologne
  • 6 Department of Clinical Pharmacy, Radboud University Medical Center
  • 7 Nijmegen Institute for Health Sciences, Radboud University Medical Center
  • 8 Department of Hematology and HSCT, South-Pest Central Hospital National Institute of Hematology and Infectious Diseases
  • 9 Dipartimento di Oncologia ed Ematologia SSCVD Trapianto allogenico di Cellule Staminali, A.O. Citta’ della Salute e della Scienza di Torino
  • 10 Ustav Hematologie A Krevni Transfuze
  • 11 Infectious Diseases Division, Infectious Diseases unit, Tel Aviv Sourasky Medical Center
  • 12 Dipartimento di Scienze Mediche e Chirurgichea, Alma Mater Studiorum Università di Bologna
  • 13 Clinical Trials Centre Cologne (ZKS Köln), University of Cologne, Faculty of Medicine and University Hospital Cologne
Objectives: To define evidence- or consensus-based recommendations for antifungal prophylaxis for AML patients on treatment with novel agents.
Novel therapeutic agents for acute myeloid leukemia (AML) have become available recently. Antifungal prophylaxis is generally recommended during induction remission chemotherapy, however, treatment settings for AML patients have become diverse and the risk-benefit ratio for antifungal prophylaxis in those settings is not well assessed in clinical trials. Due to cytochrome p450 metabolization and its inhibition by antifungal drugs, there is potential for drug-drug interactions (DDI) between novel AML agents and antifungals.
Materials & Methods: Experts from the European Hematology Association (EHA) Working Group Infections in Hematology and Cochrane Hematology Group develop an evidence and consensus-based guideline according to the GRADE methodology. The following PICO endpoints for each of the novel agents were formulated: occurrence of fungal infection, prolongation of hospitalization, days on intensive-care unit and mortality due to fungal infection, quality-of-life, and potential drug-drug interactions. Systematic literature review was performed. In three consensus-meetings, recommendations for each novel AML drug and specific setting were formulated.
Results: The following novel agents for treatment of AML were identified with not all of them being yet licensed for treatment: Hypomethylating agents (HMA; Azacytidine and decitabine), Midostaurin, Venetoclax (+HMA), Lestaurtinib, Gilteritinib, Sorafenib, Quizartinib, Ivosidenib, Enasidenib, Crenolanib, Glasdegib, Sapacitabine, Custatuzumab, Iomab B, Idanasutlin.
Evidence from the literature was generally scarce since fungal infections and prophylaxis were generally not assessed in randomized controlled trials of the respective AML drug.
Evidence-based recommendations were formulated for HMA, Midostaurin, and Venetoclax/HMA, for all other agents, consensus-based recommendations were given including the patient-specific setting of application of the novel agents (relapsed/refractory AML, single therapy or in combination with chemotherapy, induction treatment or maintenance etc.) into the decision process.
Antifungal prophylaxis is not recommended or moderately recommended in most settings, and strongly recommended if the novel AML agent is administered with intensive chemotherapy during induction treatment. Dose adaptations of some of the AML agents (midostaurin, venetoclax, quizartinib, sorafenib, gilteritinib) are moderately recommended with limited evidence if antifungal prophylaxis is administered with a strong CYP3A4 inhibitor due to expected increased exposure.
Conclusions: The first guideline document to help supporting the decision if to use antifungal prophylaxis in AML patients under treatment with novel agents will soon become available.

S13.5 Candida auris Clinical Isolates from Patients with COVID-19 in Saint Petersburg, Russia: Identification, Antifungal Susceptibility

Natalia Vasilyeva 1, Ellina Oganesyan 1, Irina Vybornova 1, Svetlana Gordeeva 2, Sergey Kovyrshin 1, Irina Moshkevich 1, Anastasia Taraskina 1, Ivan Pchelin 1, Galina Chilina 1 and Tatyana Bogomolova 1
  • 1 North-western State Medical University named after I.I. Mechnikov
  • 2 Clinical Infectious Hospital named after S.P. Botkin
Objectives: to determine the spectrum of resistance to antifungal drugs of C. auris clinical strains isolated in St. Petersburg 2020–2021 from patients with COVID-19.
Materials and methods: A total of 78 strains of C. auris from patients (urine—50, blood—24, sputum—2, bronchoalveolar lavage—1, sinus punctate—1) hospitalized in 5 clinics in St. Petersburg were studied.
Identification was conducted by MALDI-TOF MS (Bruker Daltonic, Germany) and sequencing the internal transcribed spacer region (ITS) rDNA.
Antifungal susceptibility testing was performed using colorimetric panels Sensititre YeastOneYO10 (Thermo Fisher Scientific, Renfrew, UK), including: amphotericin B, voriconozole, itraconazole, posaconazole, fluconazole, anidulafungin, caspofungin, micafungin, 5-flucytosine. Candida auris isolates were cultivated in Sabouraud dextrose agar at 35 °C for 24 h and an inoculum at 1–5 × 105 cells/mL was prepared in distilled water. For the interpretation of the results, tentative breakpoints recommended by the CDC (Center for the Control and Prevention of Infectious Diseases, 2020) were used.
Results. MIC values (μg/mL) were as follows: amphotericin B—0.12–2, voriconazole—0.06–8, itraconazole—0.12–16, posaconazole—0.06–8, fluconazole—32–256, anidulafungin—0.015–8, caspofungin—0.06–1, micafungin—0.06–1, 5-flucytosine—≤0.06–0.12.
Conclusions. C. auris strains isolated from patients with COVID-19 in St. Petersburg are characterized by the development of resistance in 100% of fluconazole and 15% were resistant to amphotericin B and fluconazole.

S14.1 Fungal Respiratory Infections in Cystic Fibrosis

Michaela Lackner
Objectives: An overview will be given on fungal agents causing infections in cystic fibrosis patients. Chronically ill patients with several therapeutic cycles have a higher risk to face drug-resistant infections and therapeutic failure. Particularly azole-resistant fungi, represent an emerging problem. The aim is to provide and overview on intrinically azole-resistant fungi causing infections in CF-patients and fungi that are prone to aquire azole-resistance. Fungi acquire azole-resistance not only during therapy, but also in the enviornment. Azole-contaminated nieches will be highlighted and common azole-resistance meachisms will be discussed.
Conclusions: The talk will be concluded with strategies to reduce the developement and favouring of azole-resistant fungi and to improve and generate new therapeutic options.

S13.6 Hyperendemic Zoonotic Sporotrichosis: Implementation of a Public Health Assistance Service for Human Sporotrichosis in Southern Brazil

Vanice Poester 1, David A Stevens 2, Rossana Basso 1,3, Livia Munhoz 1, Jéssica Benelli 1,3, Gabriel Klafke 1 and Melissa Orzechowski Xavier 1,3
  • 1 Universidade Federal Do Rio Grande
  • 2 California Institute for Medical Research
  • 3 HU-FURG/EBSERH
Objectives: In Brazil, zoonotic sporotrichosis is a public health problem, with thousands of cases in the last decade in the country. An important way to reduce the cat-human transmission of Sporothrix brasiliensis is to spread information through health education activities, and promote better access for laboratory diagnosis. We report the implementation of a public specialized reference service (SRS) for diagnosis and treatment of sporotrichosis in southern Brazil.
Methods: The SRS was implemented in Rio Grande city (RG) (Rio Grande do Sul (RS), Brazil) at the University Hospital (HU-FURG-EBSERH). The impetus to implement a SRS for human sporotrichosis emerged from epidemiological data provided by the Mycology Laboratory (FAMED/FURG) in the last ten years, showing more than 600 cases of feline sporotrichosis, and 20 human cases (between 2012 and 2017). To study the impact of implementing SRS, the annual average number of cases, and the period between the appearance of lesions until diagnosis were compared, considering prior data and that post-implementation.
Results: The SRS was officially implemented in 2017 after meetings with RG health professionals to discuss logistics, and achieve involvement from as many stakeholders as possible. A referral flow was proposed (Figure 1). It includes clinical screening for sporotrichosis suspicious cases by professionals in RG primary health care (UBS), then referral to the SRS infectious disease service (HU-FURG/EBSERH) as the reference center for diagnosis and treatment of the disease. Since the SRS began, February 2017 to February 2021, 53 patients with suspected sporotrichosis were referred to HU-FURG/EBSERH. The diagnosis was confirmed in 83% of these (n = 44). Comparing the average of sporotrichosis cases in the pre-service implementation period (2012–2017), 3.25 cases/year, with the average of 11 cases/year post-implementation (2017–2021), this represented an increase of 275% in diagnosed cases. The interval from the beginning of lesions until diagnosis in the pre-service implementation period was a mean of 206 days (range 15 to 1095). This interval was reduced to an average of 79.5 days (range 5 to 540) after service implementation, representing a decrease of 235%. This allows an early therapeutic attack on the disease, at a more responsive stage. Of 33 basic UBS, 14 units referred patients to the SRS, representing 42% of the municipal health units.
Conclusions: In view of the hyperendemic situation of sporotrichosis, our report highlights, at a level of one municipality, the impact that an integrated service can have in confronting this problem. Similar measures and actions need also to be improved and established with regard to animal health, directly addressing the feline population to decrease fungal dissemination. Finally, these actions should be developed not only at the municipality level, but encompass states, regions, and all the national territory, aiming to contain the geographic expansion of sporotrichosis.

S14.1 Fungal Respiratory Infections in Cystic Fibrosis

Michaela Lackner
Objectives: An overview will be given on fungal agents causing infections in cystic fibrosis patients. Chronically ill patients with several therapeutic cycles have a higher risk to face drug-resistant infections and therapeutic failure. Particularly azole-resistant fungi, represent an emerging problem. The aim is to provide and overview on intrinically azole-resistant fungi causing infections in CF-patients and fungi that are prone to aquire azole-resistance. Fungi acquire azole-resistance not only during therapy, but also in the enviornment. Azole-contaminated nieches will be highlighted and common azole-resistance meachisms will be discussed.
Conclusions: The talk will be concluded with strategies to reduce the developement and favouring of azole-resistant fungi and to improve and generate new therapeutic options.

S14.3 Immunotherapy

Darius Armstrong-James
Objectives: To outline the current and emerging approaches to immunotherapy for respiratory fungal infections in cystic fibrosis.
Materials & Methods: Literature review and presentation of current data from ongoing Cystic Fibrosis Strategic Research Centre “Targeting Immunotherapy for Fungal Infection in Cystic Fibrosis”
Results: Current options for fungal immunotherapy include cytokine and chemiine therapies although these have not been systematically evaluated in the context of cystic fibrosis. The advent of a number of monoclonal antibodies for the treatment of asthma has opened up new possibilities in terms of managing cystic fibrosis-associated allergic bronchopulmonary aspergillosis. A number of novel anti-inflammatories have also been developed for the treatment of airway inflammation in cystic fibrosis. Furthermore, there is emerging data on the impoact of novel CFTR channel modulators on inflammatory responses to airway infection in cystic fibrosis.
Conclusions: The opportiunities for immunotherapeutic approaches to fungal infection in cystic firbosis are wide-ranging and fast moving. Precision immunophenotyping and systematic clinical studies are required to better define the utility of novel immunotherapeutic agents in this setting.

S14.4 Genotypic and Phenotypic Portrait of Candida albicans Clinical Isolates Colonizing the Airways of Patients with Cystic Fibrosis

Mayssa GNAIEN 1, Corinne MAUFRAIS 2, Yasmine REBAI 1, Wael MAMI 1, Aicha KALLEL 3, Fatma KHALSI 4, Samia HAMOUDA 4, Hanen SMAOUI 4, Monia KHEMIRI 4, Sondes HADJ FREDJ 4, Taieb MESSAOUD 4, Khadija BOUSSETTA 4, Kalthoum KALLEL 3, Christophe d’ENFERT 2, Helmi MARDASSI, Marie Elisabeth BOUGNOUX 2 and Sadri ZNAIDI 1,2
  • 1 Institut Pasteur de Tunis, LR16IPT01
  • 2 Institut Pasteur, INRA, Unité Biologie et Pathogénicité Fongiques
  • 3 La Rabta, Laboratoire de Parasitologie et de Mycologie
  • 4 Hôpital d’Enfants Béchir Hamza de Tunis
Introduction: Candida albicans is a colonizer of Cystic Fibrosis (CF)-patient airways, competing with CF-associated pathogens such as Pseudomonas aeruginosa and Staphylococcus aureus and contributing to the severity of disease progression.
Objectives: The main goal of our study is to identify specific molecular patterns of chronic colonization in C.albicans serial isolates recovered from CF-patients. These molecular patterns will serve as the next biological targets implemented for novel pharmacological approaches related to CF-respiratory infections.
Methods: We serially recovered ~140 C. albicans clinical isolates over a period of 30 months from the expectorated sputa of 23 pediatric and 2 adult CF patients at the Children’s Hospital in Tunis, and characterized the genotype and phenotype of a subset of strains using multilocus sequence typing (MLST) and growth assays on multiple stress-, filamentous growth- and biofilm-inducing media.
Results: Out of 15 patients sampled during at least 9 months, 8 and 4 were chronically and transiently colonized with C. albicans, respectively. MLST analyses of 57 strains originating from 15 patients indicate that each patient is colonized with a single strain, while 6 of them carry isolates from clade 4; a clade known to be enriched with strains from Middle-East/Africa. A subset of these isolates with the same sequence type and colonizing 3 unrelated patients displayed altered susceptibility to cell wall-perturbing agents, suggesting changes in cell wall structure/function during growth in the CF-patient lung. We also observed differential ability to filament and to form biofilms in a set of identical isolates from clade 10 sampled over a period of 1 year in a pediatric patient, suggesting alterations in phenotypes associated with virulence.
Conclusions: MLST allowed us to investigate the population structure and the epidemiology of C. albicans clinical isolates in the contexte of chronic airways colnization within CF-patients. Besides genotypes data, phenotypic assays findings enabled us to select 30 C. albicans clinical isolates for whole-genome sequencing analyses in order to identify polymorphisms that could explain the emergence of new traits during chronic outgrowth of C. albicans in the CF-patient lung.

S14.5 Exophiala Dermatitidis Infection in Cystic Fibrosis Accelerates Lung Function Decline; A Retrospective Single-Centre Review of Historical Lung Function

Jonathan Ayling-Smith 1,2, Gemma Ford 3, Lorraine Speight 1, Rishi Dhillon 4, Matthijs Backx 4, P. Lewis White 4, Kerry Hood 2 and Jamie Duckers 1
  • 1 Cardiff and Vale University Health Board
  • 2 Cardiff University
  • 3 Cwm Taf Morgannwg University Health Board
  • 4 Public Health Wales
Objectives: The impact of Exophiala dermatitidis on lung function in CF is unknown. The objective of this study was to assess if the growth of this microorganism impacts the lung function of patients with cystic fibrosis.
Materials & Methods: All patients in a single CF centre who had grown E. dermatitidis were compared with a random negative control group. A historical limit of 2007 or 1 year before transitioning to the adult CF team was used. Patients with less than 24 months of data in the control group and 48 months of data in the E. dermatitidis group were excluded. The sample size was 31 and control group size was 62. Patients were included up to transplantation, CFTR modulator use, moving out of area or death. The rate of decline in lung function was calculated as FEV1% change/year using the mean FEV1 from the earliest 12-month period on record and the mean FEV1 from the most recent 12-month period. In the E. dermatitidis group rates were calculated prior to the first recorded isolation of E. dermatitidis and subsequent.
Results: The mean rate of decline of the control group of −0.824%/year (S.D. 1.36) was not statistically different (P = 0.2) to the mean rate of decline in the E. dermatitidis group, prior to positive culture (−0.337%/year, S.D. 2.38). However, there was a significant difference (P < 0.01) in rate of decline between the E. dermatitidis group pre and post positive culture (−0.337%/year compared to −1.824%/year S.D. 2.35). This is worse than national average. The control and E. dermatitidis groups were not significantly different in CF genotype, pancreatic sufficient proportion and amount of time studied.
Conclusions: The results suggest that E. dermatitidis growth has a temporal relationship with poorer lung function. It is not clear if this is cause or effect. The sample size of this retrospective analysis is small in a single centre but the significance of this result warrants further research into the microbiota of patients with E. dermatitidis.

S15.1 Cryptococcus qPCR Assays: The Future for Routine Mycology Labs and Clinical Trials Dealing with Cryptococcosis—An AMBITION Sub-Study

Alexandre Alanio
Background: Routine mycology from clinical trials on cryptococcosis is mainly based on testing CrAg in blood and cerebrospinal fluid (CSF), CSF observation in India ink and fungal culture using quantitative cryptococcal culture (QCC), which is labor intensive and difficult to manage in some settings.
We aimed at evaluating quantitative (qPCR) and reverse transcriptase quantitative PCR (RT-qPCR) assays to quantify the fungal load in the CSF, in blood and to identify Cryptococcus species responsible for the infection. We also aimed at understanding the dynamics of fungal DNA and RNA detection overtime during treatment to better understand the pathophysiology of the disease and to find interesting diagnostic and prognostic markers.
Methods: We developed three identification quantification qPCR assays based on the amplification of the unique nuclear QSP1 target gene specific of serotype A, D and B/C and a 28S multi-copy qPCR assay to improve sensitivity for detection in plasma and blood. We developed also a reverse transcriptase qPCR based on QSP1 whole nucleic acids (WNA) amplification for viability testing.
We advantageously evaluated our assays on patients recruited in the AMBITION-cm study in Gaborone (Botswana) and Blantyre (Malawi), 2 of the 7 sites of this phase III randomized clinical trial evaluating the efficacy of a single dose of liposomal amphotericin B with flucytosine and fluconazole as compared to the current WHO recommended treatment regimen. Patients were sampled at day 0, 7 and 14 for CSF (pellet and supernatant) and at H24, day 3 and day 7 for plasma and whole blood.
Results: From a total of 209 patients recruited in the study (85 from Botswana; 124 from Malawi), we were able to obtain material from 205 patients. From QSP1 qPCR tested in CSF at D0, 169 (81%) were identified including 138 (81.7%) as serotype A, 28 (16.6%) as serotype B/C, 3 (1.8%) with mixture of A and B/C, 36 with no qPCR amplification. No difference in terms of fungal loads at D0, D7 and D14 in CSF was observed between serotype A and B/C with QCC, and qPCR assays.
QCC was compared to qPCR quantification showing a good correlation with QSP1 qPCR (slope = 0.797, R2 = 0.73) and with 28S qPCR (Slope = 0.771, R2 = 0.778) assays.
The number of patients positive with QCC at D7 and D14 was significantly lower than with qPCR QSP1 and 28S assays (p < 0.0001).
The early fungicidal assay (EFA) was higher with QCC than with qPCR as the median slope was lower with QCC than with QSP1 and 28S assays. Slope between D0 and D7 was significantly lower than that of D7-D14 in QCC and in qPCR assays. D0-D7 slopes calculated with QSP1 quantification were significantly lower in the single arm regimen than in the control arm. No significant difference in slopes were observed in patients alive or dead at week 10 (W10) in QCC and qPCR assays.
D0 CSF fungal loads of patients with negative QCC or qPCR at D7 was lower than that with negative QCC or qPCR at D14 or than the patients with persistent signal at D14 (p < 0.0001). Interestingly, the patients with persistent signal at D14, EFA correlated with the initial fungal load in QCC (R2 = 0.499), QSP1 (R2 = 0.67) and 28S (R2 = 0.61) assays.
The fungal load at D0 was significantly higher in patient who died at week 2 (W2) and at W10 as compared to patients who survived at W10 (p < 0.01), with no significant difference of initial fungal load in both treatment regimens (p > 0.05).
Detection of Cryptococcus DNA (28S qPCR) in plasma or blood within the first 24 h of treatment was significantly associated with early mortality at W2 and mortality at W10 (p < 0.01).
QSP1 RT-qPCR showed that detection of DNA was due to viable fungal cells as the quantification of QSP1 WNA was systematically higher (×2 to 5) than that of DNA.
Conclusions: Quantification of the CSF and detection in plasma at D0 will be identifying patients at risk of death that would potentially benefit from a different therapeutic management.

S15.2 AMBITION Trial and Beyond

Joe Jarvis
Cryptococcal Meningitis (CM) is a leading cause of HIV-related mortality. Based on phase-II study data showing that a single high-dose of liposomal amphotericin-B (AmBisome, Gilead Sciences Inc) was non-inferior to 14 days of standard dosing in clearing Cryptococcus from the central nervous system we performed a phase-III randomised controlled non-inferiority trial to examine the impact of a single high-dose of AmBisome in averting all-cause mortality from CM (the AMBITION trial). HIV-positive adults with a first episode of CM in Botswana, Malawi, South Africa, Uganda and Zimbabwe were randomised to induction therapy of either (i) single, high-dose AmBisome (10 mg/kg) given with 14 days of flucytosine 100 mg/kg/day and fluconazole 1200 mg/day (AmBisome) or (ii) 7 daily doses of amphotericin B deoxycholate (1 mg/kg) plus 7 days of flucytosine 100 mg/kg/day, followed by 7 days of fluconazole 1200 mg/day (control). All participants received consolidation therapy of fluconazole 800 mg/day for eight weeks. The primary endpoint was all-cause mortality at ten weeks with the trial powered to show non-inferiority with a 10% margin. Single high-dose AmBisome on a backbone of flucytosine and fluconazole was non-inferior to the current WHO recommended standard of care for HIV-associated cryptococcal meningitis. This talk will outline the background and scientific rationale for the AMBITION trial, present the headline findings, and discuss the implications for clinical practice worldwide.

S15.4 Modifications of the Cell Wall during Cryptococcosis

Liliane Mukaremera
Globally, meningitis caused by Cryptococcus causes 15% of all HIV/AIDS related deaths (~181,000 individuals per year). Even with the best available treatment, mortality rates due to HIV-associated Cryptococcal Meningitis range from 40% in high income to 70% in low income countries. Therefore, new strategies to improve outcome of Cryptococcus infection are urgently needed, and this depends on a deeper understanding of Cryptococcus pathogenesis.
Our current research focuses on understanding cell wall modifications during Cryptococcus infection. Mammalian cells lack a cell wall, making it an ideal target for new anti-Cryptococcus therapies. Currently, no drugs targeting the cell wall are used to treat Cryptococcus infection, not even Echinocandins, widely used to treat other fungal infections. These drugs showed early promise against C. neoformans in vitro, but are ineffective in vivo. This indicates that the structure of C. neoformans cell wall in vivo is different from that observed in vitro, and different from that of other common fungal pathogens. These observations led us to investigate how the Cryptococcus cell wall is modified during infection.
Using a laboratory strain of Cryptococcus neoformans we found that the cell wall is different in Cryptococcus cells grown under laboratory conditions and those formed during infection. In addition, within the in vivo cell population, cells with different sizes and morphologies possess different cell wall composition. Next, we examined the cell wall of Cryptococcus clinical isolates obtained from HIV-infected patients suffering from Cryptococcus meningitis. Similar to the laboratory strain, all clinical isolates tested presented cell subpopulations with different cell wall composition. In particular, cell wall chitin and chito-oligomer contents varied between cell subpopulations, and cell proportions in each subpopulation also differed between isolates.
Cryptococcus cell wall chitin has been associated with a detrimental immune response and worsening of the disease in the mouse model of cryptococcosis. Therefore, our observations that Cryptococcus clinical isolates possess cell subpopulations with differing cell wall might explain differences in immune responses, as well as disease progression observed among patients suffering from Cryptococcus meningitis.

S15.5 Molecular Analysis of Cryptococcus spp. Reveals Species Diversity and Multilocus Sequence Typing Heterogeneity among People Living with HIV in Kinshasa

Bive Zono 1,8, Rosalie SACHELI 2,8, Hippolyte SITUAKIBANZA 3, Pius KABUTUTU 1, Marcel MBULA 3, Gaultier MUENDELE 4, Raphaël BOREUX 8, Nicole LANDU 5, Celestin MUDOGO 1, Pierre-Robert M’BUZE 6, Michel MOUTSCHEN 7, Georges MVUMBI 1, Marie-Pierre HAYETTE 2,8
  • 1 Molecular Biology Service, Department of Basic Sciences, Faculty of Medicine, University of Kinshasa
  • 2 National Reference Center for Mycosis, University Hospital of Liege
  • 3 Infectious Diseases Service, Department of Internal Medicine/Department of Tropical Medicine, Faculty of Medicine, University of Kinshasa
  • 4 Advanced HIV-Infection Management Unit, Internal Medicine Department, Centre Hospitalier Mère et Enfant de NGABA
  • 5 Advanced HIV-Infection Management Unit, Internal Medicine Department, Centre Médical et Evangélique Révérend LUYINDU
  • 6 Advanced HIV-Infection Management Unit, Internal Medicine Department, Centre Hospitalier Roi Baudouin 1er
  • 7 Department of Infectious Diseases and General Internal Medicine, University Hospital Center of Liege
  • 8 Center for Interdisciplinary Research on Medicines, University of Liège
Objectives: In the Democratic Republic of Congo (DRC), the neuromeningeal cryptococcosis (NMC) hospital prevalence varies between 8.8 and 11% with a death rate of about 50%. However, the Cryptococcus isolates circulating are poorly and formerly described. We describe the molecular characterization of Cryptococcus spp. isolated from people living with HIV (PLWHIV), and the association between NMC severity factors and the Cryptococcus multilocus sequence typing (MLST) profiles.
Materials & Methods: Cerebral spinal fluid (CSF) was collected from PLWHIV with neuromeningeal syndrome hospitalized in three Kinshasa public hospitals from 1 February 2019 to 29 February 2020, and cultured on Sabouraud dextrose agar + chloramphenicol medium afterwards. Serotyping PCR, internal transcribed spacer (ITS) sequencing, and MLST from next-generation sequencing (NGS) data were performed to genotype the Cryptococcus isolates. Raw NGS data were processed and the loci alleles were manually extracted using Geneious software. NMC severity factors such as hypoglycorrhachia (<50 mg/dL), raised CSF opening pressure (>30 cm water), and the patient pejorative outcome were compared to the Cryptococcus sequence type (ST)-MLST profile which was identified, using Pearson chi-square test or Fisher exact test.
Results: Out of 29 isolates included in the present study, 23 (79.3%; 95% IC: 65.5–93.1) have been identified as serotype A using serotyping PCR, while 6 (20.7%; 95% IC: 6.9–34.5) had unidentifiable profile. Moreover, all the 29 isolates have been characterized by ITS sequencing as follow: Cryptococcus neoformans var. grubii (23 of 29 isolates, 79.3%), Cryptococcus curvatus (5 of 29, 17.2%), and Cryptococcus laurentii (1 of 29, 3.5%). Apart from this highlighted species diversity, C. neoformans var. grubii isolates were all identified as molecular type VNI using the MLST ISHAM scheme, with seven different STs including ST93 (14 out of 23, 60.9%), ST53 (1 out of 23, 4.3%), ST31 (1 out of 23, 4.3%), ST5 (1 out of 23, 4.3%), ST4 (1 out of 23, 4.3%), ST69 (1 out 23, 4.3%), and one novel ST not yet reported worldwide (2 out of 23, 8.6%). Furthermore, two isolates (8.6%) showed a mixed molecular profile (under investigation). Phylogenetic analysis carried out by the unweighted pair group method with arithmetic mean algorithm (UPGMA) of concatenated gene sequences from the seven MLST loci indicated that the main ST isolated in this study is very close to the only isolate previously reported from the DRC. The others are distant from it, even more so for ST69. All the STs identified in the present study have been isolated in the neighbouring countries of the DRC except for ST53, which has only been reported in Southeast Asia. Among NMC severity factors, only the patient pejorative outcome was associated with the minority STs infections (87.5%, p = 0.02) (ST53, ST31, ST5, ST4, STA, ST69).
Conclusions: Molecular analysis of Cryptococcus spp. isolates showed wide species diversity, and ST-MLST heterogenicity within the only one molecular type identified. The existence of the STs isolated in this study in the DRC neighbouring countries suggests probable close-to-home spread. Furthermore, infections due to minority STs were associated with a pejorative outcome than those due to ST93.

S16.3 Managing Antifungal Tolerant Biofilms: Our Current Understanding and Future Directions

Gordon Ramage
Managing antifungal tolerant biofilms: our current understanding and future directions.
Fungal biofilms are notoriously difficult to manage due to their inherent tolerance to antifungal agents. These structures are physiologically distinct, surrounded by extrapolymeric matrix and have primed resilience to antifungal agents. This presentation will summarise our current understanding of fungal biofilm tolerance and describe some of the key in vitro and in vivo studies that have examined the impact of polyenes and other antifungal agents against these hard-to-treat infections. It will also examine the relevant studies that have demonstrated positive clinical management of biofilm related infections and discuss how polyenes and newly developed antifungal agents are being used in medicine.

S16.5 Ibrexafungerp Is Effective in Treating Murine Mucormycosis Caused by Rhizopus Delemar

Teklegiorgis Gebremariam 1, Sondus Alkhazraji 1, Yiyou Gu 1, Laura Najvar 2,3, Katyna Borroto-Esoda 4, Nathan Wiederhold 2, Thomas Patterson 2,3, Scott Filler 1,5 and Professor Of Medicine Ashraf Ibrahim 1,5
  • 1 The Lundquist Institute at Harbor-UCLA Medical Center
  • 2 University of Texas Health Science Center at San Antonio
  • 3 South Texas Veterans Health Care System, San Antonio
  • 4 Scynexis
  • 5 David Geffen School of Medicine
Objectives: Despite antifungal therapy and surgical debridement, overall mortality of invasive mucormycosis is >40%. Currently, the world is witnessing an explosion in mucormycosis in India among COVID-19 patients with >47,000 cases reported since May 2021. Thus, novel therapeutic modalities are needed. Ibrexafungerp (IBREXA) is the first member of a new class of triterpenoid antifungal agents that inhibit glucan synthase enzyme involved in the synthesis of the fungal cell wall polymer β-(1,3)-D-glucan. We sought to compare the activity of IBREXA alone and in combination with clinically used antifungal drugs against murine mucormycosis.
Methods & Materials: In vitro susceptibility was conducted by the CLSI M38 method using a clinical isolate of Rhizopus delemar (a common cause of mucormycosis). ICR mice were immunosuppressed with cyclophosphamide and cortisone acetate on days −2, +3, and +8, relative to infection with intratracheally instilled R. delemar. Treatment with placebo (diluent control), IBREXA (30 mg/kg, po, BID), liposomal amphotericin B (LAMB,10 mg/kg, iv, OD), posaconazole (POSA, 30 mg/kg, po, QD), a combination of IBREXA + LAMB, or a combination of IBREXA + POSA began 24 h post infection and continued for 7 days for IBREXA and POSA and 4 days for LAMB. Mice survival through Day +21 served as the primary endpoint.
Results: The minimum effective concentration (MEC) value for IBREXA against R. delemar 99–880 was >8 µg/mL, while the MIC for AMB and POSA at 100% inhibition of growth were 0.06 and 0.5 µg/mL, respectively. While all placebo mice (n = 20/arm, from two experiments with similar results) died by day 16 post infection, all treatment groups resulted in significant enhancement in median survival time and overall percent survival (Table 1) (p < 0.002 for any treatment vs. placebo). Furthermore, IBREXA + LAMB treatment resulted in significantly improved overall survival when compared to any monotherapy treatment (p < 0.04 vs. IBREXA, LAMB, or POSA). Finally, there was no significant difference in the overall survival between IBREXA + LAMB vs. IBREXA + POSA (p = 0.173), although median survival was longest with IBREXA + LAMB.
Conclusions: Despite no in vitro activity, IBREXA monotherapy demonstrated in vivo efficacy in treating R. delemar infection in immunosuppressed mice. This IBREXA activity was equivalent to antifungal drugs that are currently used for treating mucormycosis. Importantly, IBREXA demonstrated synergy when combined with LAMB against murine mucormycosis. Continued investigation of IBREXA as a novel antifungal agent against mucormycosis is warranted.
Table: Median Survival TimeMedian Survival (Day)% Survival
Placebo80
IBREXA1535
LAMB1330
POSA1325
IBREXA + LAMB>2165
IBREXA + POSA1550

S16.6 Lanosterol 14-α-demethylase-F5 Homologue Mediates Short-Tailed Azole Resistance in Mucormycetes: Characterization of Mucor circinelloides LDM-Genes in The Heterologous Model S. Cerevisiae

Katharina Rosam 1, Brian C. Monk 2, Mikhail Keniya 2, Paul Schuchter 1 and Michalea Lackner 1
  • 1 Institute of Hygiene and Medical Microbiology, Medical University of Innsbruck
  • 2 Sir John Walsh Research Institute and Department of Oral Biology, Faculty of Dentistry, University of Otago
Objectives: Lichtheimia corymbifera, Rhizopus arrhizus, and Mucor circinelloides are the most prevalent causative species of mucormycosis in Europe. Mucormycosis is an often lethal fungal infection, due to its fast progression and the limited treatment options available. Recommended first-line treatment is amphotericin B (AmB). Isavuconazole (IVU) and posaconazole (PSC) are recommended as salvage therapies. Short-tailed azoles such as voriconazole (VRC) are ineffective due to intrinsic resistance, which is suspected to be mediated via the amino acid (AA) changes Y129F and V123A, exclusively occurring in the LDM-F5 version of lanosterol 14-α-demethylase (LDM). We aim to generate a deeper understanding of the impact of AA changes in the ligand-binding pocket of the LDM on drug resistance to generate more effective azole drugs.
Materials & Methods: LDM homologue genes (McLDM-F1 and McLDM-F5) of M. circinelloides were overexpressed with and without their cognate cytochrome-P450-reductase (CPR) at PDR5 and PDR15 loci in Saccharomyces cerevisiae, respectively. S. cerevisiae parental strains AD2Δ and AD2Δgal were used, both strains have seven ABC-transporters deleted and a pdr1-3 gain of function mutation in the Pdr3 transcriptional regulator. AD2Δgal parental strain has in addition a galactose-inducible native ERG11. To study the effect on drug binding within the ligand-binding pocket, AA changes were introduced in the LDM-F1 and reverted in the LDM-F5 gene (F129Y, A293V, F129Y & A293V), respectively.
Resistance testing was performed according to EUCAST guidelines for: VRC, fluconazole (FLC), IVU, PSC, itraconazole (ITC), and AmB, the fungicide triadimenol (TDM), plus the novel drug candidates (MCC7995, MCC8186). Minimal inhibitory concentrations (MIC) 90 and fold-changes in reference to the parental strains were determined. Resistance- and growth-phenotypes and growth kinetics were characterized. All transformants were genetically confirmed and protein expressions were verified using SDS-page and Western blots. Enzyme functionality and drug binding was studied using a novel enzyme kinetic assays.
Results: All mean MIC values are given in mg/L for AD2Δgal. Resistance phenotypes were as follows: highest resistance against short-tailed azoles was found for McLDM-F5-CPR (VRC: 4 and FLC: 128), followed by McLDM-F5 (VRC: 0.58 and FLC: 42.67) and McLDM-F1-CPR (VRC: 0.29 and FLC: 14.67). Isavuconazole responded similar to VRC, as it showed high MIC values for McLDM-F5-CPR (4). The novel compounds MCC7995 and MCC8186, as well as TDM had the same resistance characteristics as FLC. MICs of long-tailed azoles (PSC, ITC) and AmB were not affected when compared to AD2Δ.
The calculated generation times for AD2Δgal strains ranged from 154 to 187 min (min) in the exponential phase, whereby McLDM-F5 was the fittest strain (154 min) followed by McLDM-F1 (173 min), McLDM-F1-CPR (175 min), and McLDM-F5-CPR (187 min). Morphologically, single and co-expressing strains showed similar growth patterns.
Conclusions: To summarize, we constructed viable S. cerevisiae strains carrying McLDM variants with and without the cognate CPR. Co-expression of cognate reductase significantly impacted on short-tailed azole resistance, even though generation time was not shorter than in single expressing strains. In conclusion, these data strengthen the hypothesis that the AA changes in the McLDM-F5 confer resistance to short-tailed azoles.

S17.3 Impact of Environmental Approaches for Allergen Avoidance and Asthma Control

Jean-Pierre Gangneux
Patients with asthma are commonly exposed to multiple indoor allergens that may contribute to the increased asthma-related complications in this population. Preventing strategies are still questioned, among them pharmacological approaches but also air quality improvement leading to healthy home environments. The analysis of the literature shows contrasting results but methodologies greatly varies. Global allergen avoidance strategy with an individualized, home-based, comprehensive environmental intervention with an Indoor Environment Counsellor (IEC) is the most promising method. We will review the impacts of such method from the environmental side to clinical improvement.

S17.4 Type 2-High Asthma Patients Reveal a Specific Indoor Mycobiome and Microbiome

Louise-Eva Vandenborght 2, Raphaël Enaud 1, Charlotte Urien 2, Noémie Coron 1, Pierre-Olivier Girodet 1, Stéphani Ferreira 2, Patrick Berger and Laurence Delhaes 1
  • 1 CHU de Bordeaux, Inserm U1045, Université de Bordeaux
  • 2 GenoScreen, Research and Development, Microbiota Team
Background and Objectives: Currently, the relation between microbial exposome and asthma is well-admitted, but combining NGS results from pulmonary and indoor microbiomes (or microbial exposome) of asthmatic patients with spirometry, clinical and endotypes parameters is a new research field. In this context, our objectives were to investigate the links between indoor microbial exposome and pulmonary microbial communities (exogenous, endogenous mycobiome and microbiome), and to document the exposome role onto inflammatory and clinical outcomes of patients with severe asthma (SA).
Materials & Methods: On the whole, 55 SA patients from the national COBRA cohort were submitted to an indoor microbial exposome analysis trough Electrostatic Dust Collectors (EDC). Among them, 22 patients were able to produce sputa during stable or pulmonary exacerbation periods. A set of 22 pairs of EDC and sputum were collected during the study period and analyzed using targeted metagenomic in order to compare microbial communities from all EDC and sputum samples of patients, according to type 2 (T2)-asthma endotypes.
Results: Compared to patients with T2-low SA, patients with T2-high SA exhibited an a decrease of fungal α-diversity of their indoor microbial exposome, significantly correlated to FeNO levels. In addition, the β-diversity of EDC mycobiome clustered significantly according to T2 endotypes. Moreover, the proportion of fungal taxa in common between sputum and EDC samples was significantly higher when patients exhibited an acute exacerbation compared to patients with stable pulmonary status.
Conclusions: These results illustrated for the first time a potential association between indoor mycobiome and clinical features of SA patients, renewing the interest in deciphering the interactions between indoor environment, fungi, and host in asthma.

S17.5 Antifungal Therapeutic Outcomes in Allergic Broncho Pulmonary Aspergillosis (ABPA) Patients with Asthma

Lisa Nwankwo 1, Desmond Gilmartin 2, Sheila Matharu 2, Anand Shah 4 and Darius Armstrong-James 3,4,5
  • 1 Pharmacy, Royal Brompton Hospital, Guy’s and St. Thomas’ NHS Foundation Trust
  • 2 Clinical informatics, Royal Brompton Hospital, Guy’s and St. Thomas’ NHS Foundation Trust
  • 3 MRC Centre for Molecular Bacteriology and Infection, Department of Infectious Diseases, Imperial College
  • 4 Department of Respiratory Medicine, Royal Brompton Hospital, Guy’s and St. Thomas’ NHS Foundation Trust
  • 5 MRC Centre of Global Infectious Disease Analysis, Department of Infectious Disease Epidemiology, School of Public Health
Background: The human host defence system determines the clinical presentation of infection due to Aspergillus fumigatus. In patients with underlying respiratory disease, it can cause pulmonary aspergillosis infections such as ABPA (allergic bronchopulmonary aspergillosis). Outcomes with antifungal treatment in patients with ABPA on a background of asthma have not been extensively studied in real world settings.
Objectives: The aim of this study was to characterize the clinical spectrum of therapeutic outcomes in patients with ABPA on a background of asthma, as a strategy for optimizing disease interventions. Description of real world treatment response in this patient group may help future focused research and for identification of patient subgroups that may benefit from intensive management and patient follow up to prevent disease progression.
Materials & Methods: This was a retrospective single-centre cohort study evaluating longitudinal outcomes in non-cystic fibrosis (CF) ABPA patients with underlying chronic lung disease (asthma), and description of treatment approaches. Statistical Analysis System (SAS) programming was used for data integration from multiple hospital electronic systems, for patient identification and data analysis. Criteria for inclusion were patients with a background of asthma, serum Total IgE >1000 IU/mL and a positive Aspergillus IgE, with or without a positive culture for A. fumigatus from a respiratory sample. Data collected included demographics, lung function severity, disease activity serological markers (Aspergillus IgE, Aspergillus IgG, Total IgE) and triazole levels. In this study the impact of fungal therapy on disease outcomes was assessed.
Results: SAS analysis identified 452 patients with asthma complicated by ABPA from Oct 2009 to March 2021 (11 years 6 months). Univariate and bivariate analysis were applied to understand the relationships between lung function, drug levels and Aspergillus serology over time. Trough triazole drug levels correlated inversely with Aspergillus IgE levels for posaconazole and voriconazole, (though p values were not statistically significant); as drug level increased into a therapeutic range, a corresponding decrease in Aspergillus IgE was observed. Forced expiratory volume (FEV) % predicted in 1 s improved in patients treated with antifungals. The highest improvement was seen with posaconazole (rs = 0.27, p = 0.1591) (Figure 1) but the impact of isavuconazole treatment on lung function could not be evaluated due to insufficient data. Though lung function improved on itraconazole therapy (Figure 1), and total IgE reduction occurred (Figure 2), it did not correlate with a reduction in Aspergillus-specific IgE, even when levels were in therapeutic range (rS = 0.11, p < 0.0001). For posaconazole, voriconazole and isavuconazole, both Aspergillus IgE and Total IgE reduction were observed (Figure 2). Of all the triazoles used in this cohort, a median sub-therapeutic level of 0.82 mg/L was experienced with voriconazole, with median levels for the other antifungals being therapeutic (Itraconazole—0.76 mg/L, posaconazole—1.39 mg/L, isavuconazole—3.29 mg/L, p < 0.0001, Kruskal-Wallis statistic).
Conclusions: Antifungal therapeutic outcomes and influencers of this in patients with ABPA on a background of asthma are complex and multi-factorial. Longitudinal monitoring in these patients and adjusting treatment accordingly may improve outcomes, but further analysis is needed, and consideration of the interaction of other non-fungal therapies should be explored.

S18.2 Diagnosis of Invasive Aspergillosis: What Is New?

Juergen Prattes
Invasive aspergillosis remains a devastating disease in critically ill and immunocompromised patients. Early and reliable diagnosis represents a cornerstone for successful management of aspergillosis. In this presentation, new insights in already established diagnostic procedures as well as new diagnostic tools will be discussed. A special focus will be given to new point-of-care diagnostic tools, which enable rapid and easy to perform assessment of suspected aspergillosis.

S18.3 PCR Diagnosis

Lewis White
Public Health Wales Mycology Reference laboratory, PHW Microbiology Cardiff, UHW, Cardiff, UK
PCR to aid in the diagnosis of aspergillosis has been used for over two decades, with use generally limited to specialist centres, restricted by limited standardization, the lack of commercial assays and external quality assurance schemes that prevented incorporation into international consensus definitions for classifying invasive fungal disease. However, many developments have arisen over the last decade making Aspergillus PCR comparable with other biomarker assays used for the diagnosis of aspergillosis.
The efforts of the Fungal PCR initiative have standardized molecular methods used to test a range of specimens, external quality assurance schemes for Aspergillus PCR are available from Quality Control for Molecular diagnostics and a range of commercial Aspergillus PCR assays are available. These developments have lead to the incorporation of Aspergillus PCR in to international definitions for classifying invasive aspergillosis and permits the incorporation of Aspergillus PCR methods in any centre with access to a general molecular diagnostics laboratory.
Molecular diagnostics remain the only non-culture assay with the capacity to identify potential resistance and data pertaining to a range of commercial Aspergillus PCR assays with the capacity to identify the most common mutations associated with azole resistance in Aspergillus fumigatus, in the absence of culture, is increasingly available. Given the expanding range of both clinically and environmentally driven mutations associated with azole resistance in A. fumigatus, methods such as pyrosequencing are being used to identify mutations direct from the sample.
A range of novel molecular tests are being developed with the capacity to enhance the molecular diagnosis of aspergillosis. Proximity ligation assays combine the specificity of antibody testing with the sensitivity of molecular testing, droplet digital PCR provides enhanced quantification and detection of limited DNA concentrations, while the use of meta-genomic sequencing can detect free DNA from a wide array of pathogens circulating in the plasma of patients.
A recent Cochrane review and meta-analysis of Aspergillus PCR testing of blood samples confirmed performance but opposite to GM-EIA testing showed that prior antifungal therapy impacted specificity but not sensitivity.

S18.4 Urine Aspergillus Antigen Detection as an Aid to Diagnose Invasive Aspergillosis

Kausik Datta 1,2, Robina Aerts 3, Johan Maertens 3, Nitipong Permpalung 1, Donald Sheppard 4 and Kieren Marr 1,2
  • 1 Johns Hopkins University School of Medicine
  • 2 MycoMed Technologies LLC
  • 3 Hematology Department, University Hospitals Leuven
  • 4 McGill University
Objective: We previously reported the use of novel antibodies recognizing galactofuranose-containing glycans in a lateral flow assay as an aid to diagnose invasive aspergillosis (IA) using urine. Johns Hopkins and MycoMed Technologies have now optimized MycoMEIA™, a diagnostic enzyme immunoassay.
Methods: Validation studies were performed using samples obtained from JHU, AsTeC multicenter repository, and University Hospitals Leuven, Belgium. Diagnoses were adjudicated by reviewers blinded to test results. IA was graded as proven, probable, or possible IA, using consensus definitions. MycoMEIA assays were performed in batch, blinded to clinical diagnosis, and results were interpreted as sample index values relative to a threshold control, with index ≥1 considered positive.
Results: 710 specimens from 267 people were tested. Index values ranged from 0.236 to 24.366, corresponding to urinary antigen concentrations ranging from 8 ng/mL (analytical antigen estimation limit) to 180 ng/mL antigen equivalent. Numerical analysis of cohorts with confirmed or suspected IA excluded people with airway disease. In the validation subset that included urine specimens from people with proven or probable IA, collected with receipt of minimal (<3 days) antifungal therapy, MycoMEIA sensitivity was 95.2% (95% CI: 76.2–99.9) and specificity was 95.6% (95% CI: 91.2–98.2). Receiver operator characteristic area under the curve was 0.992 (95% CI: 0.98–1). In the larger cohort of subjects with minimal antifungal therapy, 4/4 (100%) people with proven IA and 27/31 (87%) people with probable IA had positive MycoMEIA assays, with a per case sensitivity of 88.6% (95% CI: 73.3–96.8) and specificity of 90% (95% CI: 80.5–95.9). In the overall cohort, specimens tested without consideration of prior antifungal receipt yielded positive assay results in 4/6 (67%) people with proven IA and 28/45 (62.2%) people with probable IA, lowering the sensitivity to 62.7% (95% CI: 48.1–75.9). MycoMEIA results were semi-quantitatively distributed according to certainty of invasive disease, with positive tests in 46/97 (47.4%) who had clinical signs and symptoms without confirmation using current diagnostics.
Conclusions: The MycoMEIA assay is a sensitive and specific diagnostic aide for IA. Since antigen expression may decrease with antifungal therapy, the test may be best employed with early signs of IA and/or for screening in people with high risks.

S18.5 Proteomic Analysis of Humoral Immune Components in Bronchoalveolar Lavage of Patients Infected or Colonized by Aspergillus fumigatus

Sarah Dellière 1,2, Magalie Duchateau 3, Sarah Wong 2, Quentin Giai Gianetto 3, Hélène Guegan 4, Mariette Matondo 3, Jean-Pierre Gangneux 4 and Vishukumar Aimanianda 2
  • 1 Laboratoire de Mycologie Médicale, Hôpital Saint-Louis
  • 2 Molecular Mycology Unit, UMR2000, Institut Pasteur
  • 3 Plateforme de Protéomique, Institut Pasteur
  • 4 Inserm, EHESP, CHU de Rennes, Université de Rennes
Objectives: The role of humoral immunity against fungal pathogens is a disregarded research niche in medical mycology. While recent studies have indicated their specific as well as crucial roles against several fungal pathogens, a global view of the multitude/complex nature of humoral immune components is needed to bring new insight into host-fungal interaction. In this direction, we undertook a comparative proteomic analysis of the broncho-alveolar lavage (BAL) collected from individuals infected or colonized by Aspergillus fumigatus (an airborne fungal pathogen) vs. controls, to identify those humoral components affected upon this fungal infection.
Methods: Two BAL-pools, one each from patients infected or colonized by A. fumigatus (Aspergillus + BAL) and controls (n = 10 in each pool) were subjected separately to in-solution trypsin digestion and analyzed on a Q Exactive Plus mass-spectrometer coupled with an EASY-nLC1200 chromatography system. The raw data was searched with MaxQuant against Uniprot Homo sapiens reference proteome. Functional annotation was performed using DAVID and protein-protein interactions were studied using STRING database.
Results: A total of 1177 proteins were identified in the two BAL-pools, among which 181 proteins were less abundant and 337 proteins were completely absent in Aspergillus+ BAL compared to controls. Gene-Ontology analysis of these less abundant/absent proteins (518 in total) indicated that those highly overrepresented proteins were from innate immune functional categories, and mostly related to activation of the complement system (p = 7.6 × 10−4). C1q, mannan binding lectin serine peptidase 2 (MASP2), ficolin 2 (FCN2), surfactant protein D (SP-D), complement factor H related proteins 2 and 5, complement 8 and C-type lectin receptor CD206 were among completely absent proteins in the Aspergillus + BAL. In contrast, a total of 435 were more abundant in Aspergillus+ BAL, among which 111 proteins were only identified in Aspergillus+ BAL including ficolin-1 (FCN1) and interleukin-8 (IL-8). Pentraxin-3 was found significantly increased in Aspergillus+ BAL. Protein-protein interaction analysis further highlighted potential crosstalk between these humoral immune components.
Conclusions: While some of the humoral components found altered in Aspergillus+ BAL in our proteomic analysis, such as SP-D and FCN2, have been studied in host-A. fumigatus interaction, the roles of other components have yet to be studied. The absence or less abundance of humoral components in Aspergillus + BAL may be due to their consumption, degradation, or inhibition of their biosynthesis, while overproduction may be the reason for their increased abundance. These new leads and hypotheses require further investigation to understand the interplay between humoral immune system of host and A. fumigatus. Moreover, humoral components that were completely absent or only present in A. fumigatus infected or colonized BAL could be potential immunodiagnostic markers of A. fumigatus infection.

S18.6 Aspergillus Lateral Flow Assay with Digital Reader for the Diagnosis of COVID-19 Associated Pulmonary Aspergillosis (CAPA): A Multicenter Study

Brice Autier 1, Juergen Prattes 2, P Lewis White 3, Maricela Valerio 4, Marina Machado 4, Jessica Price 3, Matthias Egger 2, Jean-Pierre Gangneux 1 and Martin Hoenigl 2,5,6
  • 1 Inserm, EHESP, Irset (Institut de Recherche en Santé, Environnement et Travail), UMR_S 1085, CHU Rennes, Univ Rennes
  • 2 Division of Infectious Diseases, Medical University of Graz
  • 3 Public Health Wales Mycology Reference Laboratory, UHW
  • 4 Hospital General Universitario Gregorio Marañón
  • 5 Division of Infectious Diseases and Global Public Health, University of California San Diego
  • 6 Clinical and Translational Fungal-Working Group, University of California San Diego
Objectives: The Aspergillus LFA is a rapid diagnostic test that has been recently introduced into the market to supplement some weaknesses of Aspergillus galactomannan immunoassay. This multicenter study evaluated the performance of the IMMY Aspergillus Galactomannan Lateral Flow Assay (GM-LFA) with automated cube reader for diagnosis of pulmonary aspergillosis in patients with COVID-19 (CAPA) associated acute respiratory failure requiring intensive care unit (ICU) admission.
Materials & Methods: A total of 198 respiratory samples and 149 serum samples from 243 patients were retrospectively tested with the IMMY sona Aspergillus Galactomannan LFA (IMMY, Norman, Oklahoma, USA). GM immunoassay (Platelia Aspergillus Ag ELISA; Bio-Rad Laboratories, Marnes-la-Coquette, France) was routinely and prospectively performed in the majority of samples. Participating centers were the University Hospital of Rennes (France), the University Hospital of Graz (Austria), the Public Health Wales Mycology Reference Laboratory (Cardiff, United-Kingdom), and the Hospital General Universitario Gregorio Marañón of Madrid (Spain). Patients were admitted to ICU between March 2020 and April 2021, and retrospectively classified for CAPA status according to the European Confederation of Medical Mycology (ECMM)/International Society for Human and Animal Mycoses (ISHAM) criteria, with the exclusion of Aspergillus LFA as mycological criterion (Koehler et al., Lancet Infect Dis 2020).
Results: At the 1.0 optical density (ODI) cutoff, sensitivity of GM-LFA was 68%, 83% and 42%, and specificity was 80%, 84% and 98% for tracheal aspiration (TA), non-directed bronchioalveolar lavage (NBL), and bronchioalveolar lavage (BAL), respectively. When combining all respiratory samples, area under the curve (AUC) for receiver operating characteristic (ROC) curve was 0.809 and 0.724, 0.887 and 0.723 for isolated TA, NBL and BAL, respectively. When testing serum using a 0.5 ODI cutoff, sensitivity and specificity of GM-LFA was 14% and 93%, respectively. Spearman correlation analysis showed a significant correlation between serum LFA-ODI and serum GM-ODI (rho 0.323, p = 0.001). For 8/85 patients without CAPA, serum GM-LFA result was between 0.5 and 0.67 and would have misclassify them as “probable CAPA” using the recommended 0.5 cutoff value.
Conclusions: Overall, the Aspergillus GM-LFA showed good performance for CAPA diagnosis, especially on respiratory samples at the 1.0 cutoff. As some false positive results can occur for serum samples, isolated results slightly above the recommended cutoff should lead to further mycological investigations to increase the specificity.

S19.1 Antifungal Tolerance: Spanning the Genetic and Phenotypic Diversity of Candida albicans

Judy Berman
Mortality from invasive fungal diseases approaches 50%, despite the use of available antifungal drug. The rare appearance of antifungal drug resistance (e.g., <2% of C. albicans isolates are drug resistant) cannot explain these treatment failures. Antifungal tolerance is a poorly understood property that is expressed to different degrees in different susceptible (non-resistant) isolates, yet is not measured routinely in the clinic or in most research studies. We are studying how tolerance differs between isolates, what biological mechanisms drive it and how it affects only some cells within a single isolate. We also are interested in how to inhibit it so as to improve treatment outcomes. The cell biological properties of genetic and non-genetic contributions to C. albicans antifungal tolerance along with a large scale ‘OMICS approach that we have embarked upon to address the mechanistic issues at the species, isolate and single-cell levels.

S19.3 BET Bromodomain Inhibition as a Potential New Antifungal Therapeutic Strategy

Jérôme Govin
Objectives: Opportunistic fungal infections are a major cause of morbidity and mortality in hospitalized immunocompromised individuals. The emergence of drug resistance in many strains and the toxicity and high cost of the limited repertoire of available drugs indicates that there is an urgent need for novel therapeutic agents.
Bromodomain and Extra-Terminal (BET) proteins are chromatin-associated factors that regulate gene transcription and chromatin organization. BET proteins recognize chromatin through their two bromodomains (BDs). BET BDs are readily druggable and efforts by both academic groups and biopharmaceutical companies have led to the discovery of several potent and selective human BET BD inhibitors, which are currently under clinical evaluation for the treatment of various cancers and other non-infectious diseases.
Materials & Methods: Our research program combines yeast genetics/epigenetics, biochemistry, structural biology, medicinal chemistry and medical mycology It involves a consortium of 4 laboratories: J. Govin, C. Petosa & M. Cornet (Grenoble, France); C. McKenna (USC, Los Angeles, CA, USA).
Results: Our data showed that the BET protein Bdf1 is essential in Candida albicans & C. glabrata and that mutations inactivating its two BDs result in a loss of viability in vitro and decreased virulence in mice. Furthermore, we identified small-molecule compounds that inhibit Bdf1 BDs with high selectivity over human BDs.
Conclusions: These findings establish BET inhibition as a promising antifungal therapeutic strategy and identify Bdf1 as an antifungal drug target.

S19.4 Use of Animal Infection Models in Preclinical Antifungal Development

David Andes
Animal infection models in the pharmacokinetic/pharmacodynamic (PK/PD) evaluation of antimicrobial therapy serve an important role in preclinical assessments of new antifungals. The assays are utilized for dosing optimization in clinical trial design and for preliminary guidance in in setting susceptibility breakpoints. The goal of animal model studies is to both mimic the infectious disease process in humans to allow for robust PK/PD studies to find the optimal drug exposures that lead to therapeutic success. The PK/PD index and target drug exposures obtained in validated animal infection models are critical components in optimizing dosing regimen design in order to maximize efficacy while minimize the cost and duration of clinical trials. The output from use of models of invasive candidiasis and aspergillosis have correlated well with patient outcome. Emerging fungal pathogen models are similarly providing useful proof of principle to guide and support progression from preclinical to clinical investigation. This presentation will review the design and application of animal infection model use as a component of preclinical drug development.

S19.5 Development of the Arabian Killifish (Aphanius dispar) as a Model Host to Study Human Fungal Pathogens

Atayaf Hamied 1,2, Larissa John 1, Tina Bedekovic 1, Alex Brand 1, Tetsu Kudoh 1 and Mark Ramsdale 1
  • 1 University of Exeter
  • 2 University of Baghdad
Objectives: Studies using zebrafish embryos have developed our knowledge of the immune response to human fungal pathogens and assisted in the development of antifungal drug screens. However, zebrafish embryos are not viable at human body temperatures (normal or pyrexic), which has a significant impact on these findings as a high temperature is crucial for the full virulence of many pathogenic fungi. In this study we have developed Arabian Killifish embryos, Aphanius dispar (originating from the warm waters of the Arabian and Persian Gulfs) as an alternative to zebrafish embryos, so that the pathogenesis of Candida albicans infections can be followed at physiologically relevant temperatures (30–40 °C).
Materials & Methods: Arabian killifish embryos were injected with C. albicans yeast cells (wild-type and mutant strains) and the progress of infection studied using CFU, direct imaging and embryo survival. Nanopore PromethION sequencing of the A. dispar genome allowed the monitoring of host immune function markers via Western blots and qPCR. Host immune functions were knocked down with targeted morpholinos. Infection progress has been monitored in the presence of fluconazole (0–32 µg/mL). A transgenic DARK fish line (gch-knockout) has been created using CRISPR-Cas9 technology to facilitate live-cell imaging of infection progression.
Results: Using this model in the context of C. albicans infection, we have shown dose dependent survival, tracked the spread of infection in live embryos, observed the interaction of C. albicans cells (yeast and hyphae) with immune cells, and shown that infections can be effectively treated with antifungal drugs. Genome sequencing revealed the presence of many genes of interest for further study related to immune function. Morpholino knockdown of irf8 and cxcr4 (required for macrophage differentiation and migration, respectively) strongly decreased embryo survival following challenge with C. albicans. The successful deletion of the gch gene using CRISPR-Cas9 to make DARK embryos demonstrates that transgenic killifish lines can be generated for the study of host responses to fungal infection.
Conclusions: Arabian killifish embryos can support C. albicans infections at 30–40 °C and the interaction with host immune cells can be monitored in real-time. In addition to the clear benefits of studying infections at physiologically relevant temperatures, the yolk of the Arabian killifish is clearer than in zebrafish helping to improve imaging, somite movement is delayed compared to zebrafish (reducing the requirement for tricaine which could interfere with host functions), and the duration of the embryonic stage is 12 d (c.f 9 d in zebrafish) enhancing the temporal resolution of host responses. Overall the Arabian Killifish model has many advantages over zebrafish and could make a significant contribution to our understanding of fungal pathogenesis.

S20.1 From Trials to Routine Care—Strengthening Pathways to Effective Implementation—Lessons from Cryptococcal Meningitis and the UNITAID/CHAI Programme for Advanced HIV Disease

Angela Loyse
According to the latest UNAIDS 680,000 [480,000–1.0 million] people died from AIDS-related illnesses in 2020. Many of these deaths in resource limited settings (RLS) are preventable. Changes in routine care practices have lagged significantly behind advances in diagnostics and treatments demonstrated in clinical trials in the last decade. To reduce deaths and prevent morbidity there needs to be increased attention and resources allocated to effective and sustainable implementation interventions and strategies tailored to routine care RLS.
This talk will focus on the methodology and preliminary findings of the DREAMM implementation science project. The DREAMM project aimed to reduce mortality from HIV-related central nervous system (CNS) infections within routine care services and prospectively describe their epidemiology in Tanzania, Malawi and Cameroon. The project is divided into 3 key phases: (1) Observation, (2) Training, and (3) Implementation. The main DREAMM intervention is the implementation of an algorithm for the diagnosis and treatment of HIV-related CNS infection. Key features of the algorithm are bedside rapid diagnostic testing, alongside routine laboratory sample processing, and the use of WHO-recommended treatment strategies for cryptococcal meningitis, the leading cause of HIV-related meningo-encephalitis in Sub-Saharan Africa. The two main DREAMM implementation strategies are: (1) Empowerment of local leadership, and, (2) Improvements in the delivery of quality of hospital care in RLS. The delivery of quality care was improved using the following 3 tools: (1) Health system engineering, (2) A freely accessibly co-designed education program for laboratory technicians and frontline healthcare workers (HCWs), and (3) Joint laboratory and clinical communities of practise. Preliminary data suggest a substantial reduction in mortality following the implementation of the DREAMM intervention and implementation strategies.
Key advances and gaps in ending often preventable and unacceptably high deaths due to HIV-related CNS infection in RLS will be summarised. Programmatic advances in Cryptococcal Meningitis and advanced HIV disease (AHD) in African low-and middle-income countries (LMICs) more broadly will be outlined. Preliminary data from the flucytosine (5-FC) access program in South Africa will be presented. In addition, the Unitaid/CHAI program on AHD is rolling out commodities for AHD, including tests and medicines for cryptococcal meningitis, in 8 African LMICs and India. Significant implementation gaps remain however, including in access to CD4 testing, alongside gaps in demand creation, and R&D for Cryptococcal Meningitis and AHD.

S20.3 Improving Outcomes for Patients with Sporotrichosis, Chromoblastomycosis and Mycetoma in South America

Flavio Queiroz-Telles
Introduction: The Implantation or subcutaneous mycoses (IM) include a heterogeneous group of fungal diseases that develop at the site of transcutaneous trauma. These diseases are a frequent health problem in Latin American countries and other tropical and subtropical areas of the world. Although these infections rarely cause disseminated or invasive disease, they have an important impact on public health, may be difficult to control, and often recur. According to their estimative burden, sporotrichosis, chromoblastomycosis (CBM) and mycetoma are the most relevant IM in South America (SA).
Sporotrichosis is the most prevalent and globally distributed of the IM. It is caused by several Sporothrix species, a genus of thermally dimorphic fungi that infect humans and animals. This disease usually develops after inoculation with contaminated organic material or via zoonotic transmission. Sapronotic transmission by plants, occurs around the globe, however, an emerging species, S. brasiliensis, is transmitted to humans and dogs by cats directly from the yeast form, and causing the largest sporotrichosis outbreak ever recorded. Cat transmitted sporotrichosis (CTS), is estimated to involve about 5000 humans, 8000 cats and 300 dogs and is expanding through into neighboring SA countries. The main issue of CTS is the early diagnosis suspicion. Microbiological confirmation may be time consuming (culture) and direct exam and/or histopathology have low sensitivity (<20%). Immunological or molecular tests are not commercially available in SA. The preliminary results of a rapid test (SLAF) using blended Sporothrix spp. antigens in 298 sera samples of patients with proved/probable CTS and 200 controls, showed 82.6% of sensitivity and 81.5% of with 95% CI of 73.69% to 89.56% and 75.41% to 86.63%, respectively When validated, SLAF may help early diagnosis and therapy of CTS, avoiding the increasing of morbity and reducing treatment duration.
Chromoblastomycosis: CBM is the second most prevalent implantation mycosis in the world, caused by several melanized fungi, almost all members of the Herpotrichiellaceae family, widely found in nature. CBM is mainly an occupational disease and prevalent in agriculturists. The estimative global burden of CBM is nearly 10,000 cases/year. In SA, in a 106 years period, 2619 cases were reported, mostly caused by Fonsecaea pedrosoi. Although the diagnosis of CBM does not rely on expensive and sophisticated laboratory tools, the disease remains neglected by all health systems, making the time of diagnosis too long (mean of 9 years). This aspect certainly impacts in morbidity, including disease progression, risk of superinfection and malignant transformation. The best therapeutic method for small initial lesions is surgical excision. Diagnosis is often delayed and systemic antifungal therapy is usually required. Long-term therapy with itraconazole is the best option for inoperable lesions. The response rate to itraconazole ranges from 15% to 80%, depending on the causative agent and severity of the disease. As this disease is caused by several types of transcutaneous trauma, the use of protective equipment such as gloves, shoes, and adequate clothes may reduce the risk of infection.
Mycetoma: Mycetoma is a chronic, progressive, implantation inflammatory disease characterised by severe and stigmatising deformities, disability, and high morbidity. The disease is caused by fungi (eumycetoma) and several Actinomycetales members (actinomycetoma). Its estimative global burden is 9000 cases. There are no robust epidemiological studies on mycetoma in SA, but it is tconsidered the third most prevalent endemic IM in SA, especially among low socioeconomic adult males living in rural areas from Argentina, Brazil, Colombia and Venezuela, where the principal agents are Madurella spp. and S. apiospermum. The diagnosis of eumycetoma relies on clinical suspicion, radiological histopathology and microbiology exams. Therapy for eumycetoma consists of prolonged antifungal therapy with Itraconazole or posaconazole. Cure rate is 25–35%.

S20.4 Mycology Expereince from a Cancer Hospital in Pakistan

Summiya Nizamuddin and Azra Parveen
Shaukat Khanum Memorial Cancer Hospital and Research Center
Objectives: The incidence of invasive fungal infections (IFIs) in immunocompromised cancer patients has continued to increase over the last few decades and IFIs have become a leading cause of morbidity and mortality in this group of patients. The morbidity and the mortality of IFIs remain high while the diagnosis and treatment of IFIs are highly challenging, especially for a developing country. Being a large tertiary care cancer hospital in Pakistan, we encounter a variety of fungal infections in our patients. We report our experience of fungal infections in cancer patients from the last 2 years.
Materials & Methods: The retrospective study was conducted at Shaukat Khanum Memorial Cancer Hospital and Research Centre, Lahore, Pakistan, and comprised data related to all cancer patients with a reported positive fungal culture between January 2018 and April 2021.
Results: A total of 332 non-duplicate cases of invasive fungal infections were identified. 54% were caused by Aspergillus species, 41% by yeasts, 3% by mucorales and 2% by other moulds. Out of all the yeast infections, 70% were associated with candidemia and 30% by non-candidemia infections. 34% of all candidemias was caused by C. albicans where 66% were caused by non-albicans Candida. Those suffering from solid tumors developed candidemias more compared to those suffering from hematological maliagnancies. Males suffered more with candidemias compared to females. The age group of 40–60 years developed candidemias the most followed by the 1–10 years age group. 3 infections caused by the rare yeasts, C. duobushaemulonii and C. auris were also identified.
Out of all the IFIs caused by Aspergillus species, 78% were caused by A. flavus at 78%, A. fumigatus at 14% and A. terreus at 7%. Solid tumor patients and males suffered more in these infections as well. 2 infections caused by Madurella species were also identified in the infections caused by other moulds.
Conclusions: The a variety of pathogens, ranging from yeasts to to invasive molds were ecountered in this analysis. The bulk of IFIs in our cancer patients is caused by Aspergillus species followed by yeasts. Non-albicans Candida are more likely to be the cause of candidemia. With increasing reports of resistant fungal patheogens, continued and long term survillance of fungal disease epidemiology is required.

S20.5 Laboratory Diagnosis of Invasive Fungal Infections in a Low-Resource Setting: A Five Year Retrospective Study

Rebecca Peters, Adobi Dike and Rita Oladele
Lagos University Teaching Hospital
Objectives: Serious fungal infections can be life threatening. Prompt laboratory diagnosis is critical in effective management of these infections. Nigeria with a population of >200 million people is estimated to have an 11.8% burden of fungal infections annually. This study examines laboratory data on invasive fungal infections (IFI’s) generated over a five-year period in the mycology unit of a tertiary health institution in Nigeria.
Materials & Methods: Data of clinical specimens/samples received for fungal studies between January 2016 and December 2020 were retrieved from the laboratory records of the Medical Microbiology and Parasitology laboratory, Lagos University Teaching Hospital (a 760 bed facility with a 10 bed ICU and HDU capacity). Samples were received from various clinics in the hospital including ICU/HDU, ENT, Neurosurgery, Maxillofacial and Pediatrics department. Suspected cases of superficial infections were excluded. Microscopic examination was carried out using 10% KOH, India ink and Giemsa staining. All samples were cultured on Sabouraud Dextrose Agar and 10% brain heart infusion agar supplemented with chloramphenicol and Gentamicin. Blood samples were cultured in Bactec (BD)/BactAlert blood culture systems. Yeast isolates were subjected to Germ tube test while encapsulated yeasts were tested for urease production. Mould isolates were identified using conventional fungal identification methods. Antifungal susceptibility testing was however not done.
Results: In the period under review, a total of two hundred and sixty five (265) specimens/samples were received from patients suspected to have invasive fungal infection. The age range of the patients was 2 months–84 years. Majority (226; 85.3%) was between ages 18–84 years. Male: female ratio was 1:1.7. Sputum 47 (17.7%) followed by nasal swabs 39 (14.7%), blood 26 (9.8%) and CSF 23 (8.8%) were the predominant samples; the least samples were urine 2 (0.8%), intracranial mass 5 (1.9%) and maxillofacial mass 5 (1.9%). A total of 80 (30.2%) fungal isolates were recovered from culture with species distribution as shown below. Candida spp. 50 (62.5%) accounted for majority of the isolates with non-C. albicans 35 (70%). This was followed by Aspergillus spp. 16 (20%) with A. flavus 10 (62.5%) predominant.
Conclusions: This study highlights the gaps in our laboratory diagnostic capacity. Low samples level probably due to lack of suspicion of fungal IFIs on part of clinicians in our setting. There is need to drive awareness amongst clinicians and inclusion of antifungal susceptibility testing and therapeutic drug level monitoring in our spectrum of services.
Pattern of types of samples sent to the laboratory for fungi studies 2016–2020.
Specimen TypeFrequency (%)
Vitreous fluid7(2.6)
Corneal scrapping10(3.8)
Ear swab24(9.1)
Nasal swab39(14.7)
Nasal polyps15(5.7)
Sinonasal mass16(6.0)
Intercranial mass5(1.9)
Maxillofacial tissue5(1.9)
Oral swab4(1.5)
Urine2(0.8)
CSF23(8.8)
Blood26(9.8)
Pleural14(5.3)
Sputum47(17.7)
Soft tissue biopsy21(7.9)
Distribution of isolated cultured and identified.

S21.4 NEOGLUCAN Study: Serial (1–3) β D Glucan Levels in High Risk Neonates

Laura Ferreras-Antolin 1,2, Nasreen Aziz 3 and Adilia Warris 2,4
  • 1 Paediatric Infectious Diseases Research Group, Infection and Immunity, St. George’s University of London
  • 2 MRC Centre for Medical Mycology, University of Exeter
  • 3 Neonatal Unit, St. George’s University Hospital NHS Foundation Trust
  • 4 Paediatric Infectious Diseases, Great Ormond Street Hospital
Objectives: Neoglucan aimed to characterise the baseline values and the dynamics of serum (1,3)-β-D-glucan (BDG) in neonates at high risk of neonatal invasive candidiasis (NIC); as well as to determine the effect of various clinical variables on these levels.
Methods: Single centre prospective cohort study aiming to include 20 neonates. Neonates were included if they were prematurely born with a gestational age <29 weeks and/or if they presented with a birth weight ≤1000 gr. Blood samples for BDG assessment were obtained twice weekly for a period of 6 weeks. BDG concentration were measured using the Fungitell® assay.
Results: Nineteen neonates were enrolled. The median age was 10 days (IQR 6–15) with a median gestational age of 25 weeks (IQR 24–27) and a median birth weight of 730 gr (IQR 650–810). Eight neonates were girls (42.1%). There were no positive blood cultures for Candida spp. and none of the neonates was diagnosed with NIC. Only one neonate was found colonised with C. parapsilosis. A total of 190 serum samples were included in the study. The median BDG value was 59 pg/mL (IQR 30–148), whereas the mean was 119 pg/mL (SD ± 154). A total of 42.1% (80/190) samples showed values 80 pg/mL, with all the neonates presenting at least one test above this cut-off. Twenty-two percent of the samples showed values 160 pg/mL; 18/19 neonates had at least one value above this level. Neonatal age did not show linear association with BDG levels; regression coefficient was 0.45, t-test 0.6 (p = 0.547). The BDG levels were stratified by presence of factors which potentially can influence BDG test results. Only the exposure to steroids and the use of a heel prick as sampling method were associated with statistically significant differences in BDG levels. Neonates on steroids showed higher BDG levels compared to those not treated; median 100 pg/mL (IQR 53–225) vs. 53.5 pg/mL (28–143) (p < 0.05). Samples taken by heel prick presented a median BDG of 66.5 pg/mL (32–151), compared to those obtained by venepuncture or CVC, median was 22.5 pg/mL (13–49) (p < 0.01). Abdominal surgery or abdominal pathology, the administration of parenteral nutrition, blood product transfusion or exposure to antimicrobials did not show effect to BDG levels.
Conclusions: The BDG levels in serial neonatal blood samples showed high variability. A significant proportion of samples (42.1%) presented values above the threshold for positivity (e.g., ≥80 pg/mL) in the absence of NIC. The exposure to postnatal steroids and the heel prick as the method of blood sampling were associated with higher BDG levels. The current BDG threshold for positivity needs to be reconsidered to allow its use in neonates at high risk for NIC.

S21.5 Optimization of Fluconazole Therapy for the Treatment of Invasive Candidiasis in Preterm Infants

Aline G.J. Engbers 1,2, Robert B. Flint 2,3, Swantje Völler 1,4, Irwin K.M. Reiss 2, Jan-Willem Alffenaar 6, Dick Tibboel 2, Sinno H.P. Simons 2, Catherijne A.J. Knibbe 1,7 and Roger Brüggemann 8,9
  • 1 Department of Systems Biomedicine & Pharmacology, LACDR, Leiden University
  • 2 Department of Paediatrics, Division of Neonatology, Erasmus UMC—Sophia Children’s Hospital
  • 3 Department of Hospital Pharmacy, Erasmus University Medical Center
  • 4 Division of BioTherapeutics, LACDR, Leiden University
  • 5 Department of Neonatology, Radboud University Medical Center
  • 6 Department of Clinical Pharmacy and Pharmacology, University Medical Center Groningen
  • 7 Department of Cinical Pharmacy, St. Antonius Hospital
  • 8 Department of Pharmacy and Radboudumc Institute of Health Sciences, Radboud University Medical Center
  • 9 Radboudumc Center for Infectious Diseases and Center of Expertise in Mycology Radboudumc/CWZ, Radboud University Medical Center
Objectives: Fluconazole is the first-choice drug for treatment of invasive candidiasis in preterm infants, that affects 4–8% of intans with a birthweight below 1000 g [1]. Due to the poor outcome of invasive candidiasis timely and adequate treatment is essential, but currently there is no licensed dosing regimen for treatment with fluconazole in preterm infants. Preterm infants are therefore often treated as term infants, for which a maintenance dose of 6 to 12 mg/kg every 72 h if postnatal age is below 14 days, every 48 h if postnatal age is 15–28 days and daily once postnatal age is above 28 days. In this study we performed a population pharmacokinetic study on fluconazole in preterm infants to evaluate currently used dosing strategies and to develop a therapeutic regimen for this cohort.
Materials & Methods: Fluconazole concentrations obtained from preterm infants from two studies were pooled and analysed using NONMEM V.7.3. Patients were treated therapeutically or prophylactically. Dosing was at the discretion of the treating physician. Samples were obtained for therapeutic drug monitoring or opportunistically, aiming for 4 samples. A population pharmacokinetic model was developed based on objective function value and numerical and graphical performance. Postnatal age, gestational age, postmenstrual age, birthweight, actual bodyweight, gender, being small for gestational age and serum creatinine concentrations were examined as covariates and included in the model if they decreased the objective function value with 6.6 points minimally (p < 0.01) and decreased interindividual variability.The developed model was used to evaluate current dosing practice. A therapeutic dosing strategy aiming to reach a minimum target exposure of 400 and 200 mg·h/L per 24 h for fluconazole-susceptible C. albicans meningitis and other systemic infections, respectively, was developed.
Results: In 41 preterm neonates with median (range) gestational age 25.3 (24.0–35.1) weeks and median postnatal age at treatment initiation 1.4 (0.2–32.5) days, 146 plasma samples were collected. A one-compartment model described the data best, with an estimated clearance of 0.0147 L/h for a typical infant of 0.87 kg with a serum creatinine concentration of 60 µmol/L and volume of distribution of 0.844 L. Clearance of fluconazole was found to increase with 16% per 100 g increase in actual bodyweight, and to decrease with 12% per 10 µmol/L increase in creatinine concentration once postnatal age was above 1 week (Figure 1). To maintain target attainment throughout the treatment period we suggest to administer fluconazole daily, independent from postnatal age. Additionally, we suggest dose adjustments based on serum creatinine and postnatal age to achieve 400 or 200 mg·h/L in all preterm infants (Figure 2).
Conclusions: In preterm infants, fluconazole clearance is best predicted by actual bodyweight and serum creatinine concentrations. To account for these effects fluconazole dosing should not only be based on bodyweight but also on creatinine concentration to achieve optimal exposure in all infants.
References
  • Turner, K. et al. Curr. Med. Chem. 2012, 19, 4617–4620.

Q02 Recurrent Vulvovaginal Candidiasis (RVVC)—A Diagnostic Challenge

Riina Rautemaa-Richardson
Recurrent vulvovaginal candidiasis (RVVC) is a debilitating, chronic condition which affects over 138 million (6%) women of reproductive age annually. It is a hormonally and immunologically driven condition triggered by Candida spp. However, Candida is also a common coloniser of the vulva and vagina. The symptoms of VVC are non-specific and shared with a number of infectious and non-infectious conditions. Therefore, the diagnosis of vulvovaginal candidiasis has to build on the combination of symptoms and clinical and laboratory findings, not culture results alone.
The following questions will be discussed in this session: How do you diagnose RVVC? What are the cornerstones of RVVC management? How do you manage patients with poor or partial response to treatment? What is the evidence for the benefit of alternative treatments? What alternative or additional diagnosis need to be considered?

Q03 Clinical Mycology—How to Get Things Going in LMICs

Rita Oladela 1,2,3
  • 1 Department of Medical Microbiology & Parasitology, College of Medicine University of Lagos, Idi araba, Lagos, Nigeria
  • 2 Medical Mycology Society of Nigeria
  • 3 Africa Mycology Working Group
Background: Currently, more than five times more people live in low- and middle-income countries (LMICs) than in high-income countries. The covid-19 pandemic and its fallout have laid bare deep-seated social and economic inequalities with marginalised groups being at greater risk of infection and being disproportionately affected by containment measures and their socioeconomic consequences. Most LMICs are burdened with marked by social and health inequalities, with poorly funded and overburdened health systems. GAFFI has estimated the burden of disease in a number of LMICs. An estimated 47 million Africans suffer from fungal diseases, of which an estimated 1.7 million suffer from a serious fungal infection annually. Additionally, a high prevalence of HIV in Sub-Saharan Africa contributes to a high burden of opportunistic fungal infections. Furthermore, approximately 50% of fungal related deaths in the setting of HIV infections occur in Africa.
Challenges: Fungal infection remains a neglected field, and diagnostic facilities and access to treatments are limited across most of these countries.
The diversity of clinical manifestations of invasive fungal diseases represents a diagnostic challenge in many scenarios.
Most LMICs lack a surveillance system for fungal infections despite a number of them being endemic for some life-threatening mycoses.
An important capacity limitation in clinical laboratories of LMICs is identification of antimicrobial resistant organisms as well as other pathogens to species level. This affects the surveillance of infections and antimicrobial resistance.
There is a pervasive picture of inadequate/poor diagnostic capacity for fungal infection (mostly due to lack of infrastructure and skilled personnel).
There is low level of awareness among health care workers and policy makers, with apathy on part of government.
Unavailability and non-accessibility of antifungal drugs is well documented.
The recent revolution in non-culture-based diagnostics is yet to penetrate most LMICs, with the exception of the cryptococcal antigen testing.
Way forward.
United efforts are mandatory to face the growing challenges in medical mycology—GAFFI, ISHAM, ECMM and CDC already started but more needs to be done.
Input from African CDC is crucial.
Individual country government ‘buy-in” with investments in clinical mycology and diagnostic resources should be advocated for.
Education and training of healthcare providers as well as educating the general public to change the attitudes of people is an another aspect that needs to be concentrate on. Intensive awareness programs for clinicians will drive clinical index of suspicion.
Capacity building including the human resources as well as the laboratory capacity in hospitals.
Medical school curriculum revision to capture mycoses adequately.
Some fungi cannot be routinely grown under lab conditions and culturing is time consuming and requires specialist training; also equipment need electricity, which at best is erratic in most LMICs. Thus, there is a need for diagnostics that can be widely applied by laboratory technicians lacking traditional fungal identification skills and facilities. This must be affordable.
Barriers to accessing antifungal drugs must be addressed, GAFFI contribution to this is noted but more needs to be done; prices and toxicities must be addressed alongside with availability of alternative medications/treatment options.
Surveillance of serious mycoses is essential to prevent and control infections, to detect outbreaks and also to see the effects of interventions.
Establishing Medical Mycology Societies have been demonstrated to drive awareness.
The role of telemedicine in areas that lack mycologists.
Funding research to address epidemiology and knowledge gaps.

Q05 β-D-Glucan in Paediatrics

Laura Ferreras-Antolin
β-D-glucan (BDG) is a cell wall component of many pathogenic fungi. The detection of BDG as an assay is clinically broadly used and it has been included as mycological criterion in the revised definitions of IFD from the EORTC/MSG consensus group. However, the current data on BDG in paediatrics is limited prompting specific considerations when BDG is used in children. In this session we aim to discuss the current evidence surrounding BDG use in paediatrics.

Q06 Teaching Medical Mycology

Yang Dong-Hoon and June Kwon-chung
National Institutes of Allergy and Infectious Diseases, NIH, Bethesda, Maryland, USA
Cryptococcus gattii species complex as an opportunistic pathogen: Underlying medical conditions associated with infection.
Cryptococcus gattii species complex has been considered a primary pathogen due to its high infection frequency among apparently immunocompetent patients. In order to scrutinize the pathogen status, we analyzed cryptococcal isolates and patient histories from 135 global C. gattii cases in which 86 were diagnosed as immunocompetent (though some had other medical issues) while 49 were diagnosed as immunocompromised with underlying conditions similar to those seen in C. neoformans infection. Plasma from 32 of the 86 seemingly immunocompetent patients were obtained to analyze for the presence of GM-CSF autoantibodies. 76% of the patients with no underlying health issues showed presence of GM-CSF autoantibodies, suggesting that the GM-CSF autoantibody is the major hidden risk for the infection. No relationship between the C. gattii lineages and underlying conditions was found, except for over representation of VGIV from HIV+ patients due to the prevalence of VGIV in Africa. Patients with C. gattii infections warrant detailed evaluation for unrecognized immunologic risk.

Q06 Teaching Medical Mycology

Esther Segal
Medical Mycology is part of Medical Microbiology; the latter being considered a prerequisite of the curriculum for students in Medicine at the preclinical study stage. This in-turn will be the basis for Infectious Diseases, to be taught at the stage of clinical studies, including clerkships at rounds at the patient’s-bed.
Thus, different approaches may be taken for teaching Medical Mycology, such as detailed exhaustive studies during the initial preclinical study- stage or minimal studies at this stage and more in- depth and broader content during the clinical- study period.
In this Session the focus will be on the Teaching of Medical Mycology at the preclinical study stage.
Teaching Medical Mycology is focusing on presenting in form of lectures and in practical laboratory sessions the major:
  • Morphological and physiological characteristics, the ecology, as well as the virulence-attributes of the fungi involved in human-diseases, and the major antifungal- groups in use.
  • Lectures will also include:
    the epidemiological aspects of host-pathogen interactions
    the laboratory diagnosis, including laboratory test-demonstrations
    the principles of treatment
    The major groups of fungi associated with human-diseases are covered, including:
    The Dermatophytes and Dermatophytoses
    Mallassezia infections
    Candida and candidiasis
    Cryptococcus and cryptococcosis
    Aspergillus and aspergillosis
    Mucorales and mucormycosis
    The Dimorphic fungi—emphasis on Histoplasmosis and Coccididomycosis
    Pneumocystis.
Each group will be illustrated by a specific clinical-case description before the detailed characteristics are discussed.
We believe that this approach provides a sound basis of knowledge and understanding to the students for their later education in the clinical study-stage.

Q09 Antifungal Therapeutic Drug Monitoring (TDM) for Optimal Dosing and Monitoring Strategies: The Recent Updates

Chin Fen Neoh
Invasive fungal diseases (IFD) are associated with high mortality and morbidity in particular among the immunocompromised and critically ill patients. Managing patients with IFD remains challenging. Inadequate antifungal drug exposure at the site(s) of infection may contribute to treatment failure while toxicity occurs if the drug concentration exceeds normal therapeutic range. There is an increasing emphasis on the utility of antifungal therapeutic drug monitoring (TDM) in optimising the management of invasive fungal diseases (IFD) over the last decade. Application of TDM is common for itraconazole, voriconazole, posaconazole and flucytosine that with considerable inter- and intra-individual variability in pharmacokinetics profiles or with greater tendency of drug-drug interactions. This presentation aims to provide the recent updates on the recommendations for the need for TDM of each antifungal agent, including the strategies for dose adjustment. The role of TDM for those antifungals without routine recommendations for TDM and the role of clinical pharmacogenetics implementation for CYP2C19 prior to initiation of voriconazole therapy will be briefly discussed as well.

Q10 Radiology

Joanne Cleverley
In this question and answer session the imaging of fungal infection will be discussed. The session will emphasize the role of different imaging modalities, radiology terminology and the spectrum of imaging findings to suggest a diagnosis of fungal infection.

Q12 Mycological Diagnosis on the Bedside: Where Are We in 2021 Cryptococcosis

John Perfect
This presentation is based around a “meet the expert” format. Initially, there will be a short discussion which examines the tools for diagnosis from cultures, antigens, PCR and histopathology. I will describe the tests and utilization with both their values and their deficits. I will touch on the simple, cheap lateral flow assays (LFA) and how they are being used in pre-emptive strategies in high-risk patients in highly endemic areas for cryptococcosis. I will also discuss some new research studies examining host blood cell transcriptome signatures to identify cryptococcosis. It is important to emphasize that our biggest deficiency in cryptococcosis is the prolonged time from symptoms to diagnosis which can lead to a poor prognosis. Furthermore, I will discuss how to follow treatment success with quantitative CSF yeast counts, repeated CSF antigens or PCR. One of the hardest clinical diagnostic needs in cryptococcal meningoencephalitis is to separate relapse/persistence infection from development of immune reconstitution inflammatory syndrome (IRIS). It is at this interface that one must use assessment of all tools including cultures, biomarkers, radiographs and timing of symptoms to make critical decisions in management strategies.
After a discussion of these issues, there will be several illustrative cases to describe principles of cryptococcal diagnosis. Finally, the discussion will be opened up to the attendees for questions directed to expert and if necessary, specific selected questions from the presenter will be asked and answered.
Cryptococcosis remains a worldwide infection as the most common fungal CNS infection in medicine. It is deadly and its risk groups are enlarging. New antifungals for cryptococcal disease are still several years away; therefore, to reduce the 15–30% mortality, it will be important that we utilize effectively our diagnostic platform.

Q14 Diagnosis from Tissue: Histology and Accurate Identification—Is it Possible?

Nathan Wiederhold
The diagnosis and appropriate treatment of invasive fungal infections depends upon accurate identification of pathogens by pathologists and clinical microbiologists. Histopathologic and cytopathologic studies are useful in providing diagnostic insight in patients with suspected fungal infections. Such examinations can offer provisional identifications of fungal organisms, which can help guide initial therapy while laboratory results are pending. Common etiologic agents of invasive mycoses may be recognized based on morphologic characteristics observed in tissue and biologic fluids, such as those obtained from bronchoalveolar lavage and bronchial washings. However, care should be taken in the interpretation of these findings, as there may be a false sense of the ability to correctly categorize fungal organisms to the genus or species level by morphologic features alone. Studies have demonstrated discordant results between histopathology/cytology studies and laboratory results due to overlapping morphologic features, morphologic mimics, and sampling errors. Thus, histopathology/cytology findings should provide a differential of potential fungal pathogens and be combined with results from laboratory studies, including cultures, antigen tests, serology, and/or molecular assays, in order to improve accuracy in the identification of etiologic agents of fungal infections. Inaccurate identification of the infecting organism can lead to inappropriate antifungal therapy and possibly poor clinical outcomes.

Q14 Diagnosis from Tissue: Histology and Identification

Raquel Sabino 1,2
  • 1 Department of Infectious Diseases, Reference Unit for Parasitic and Fungal Infections, Instituto Nacional de Saúde Dr. Ricardo Jorge, Lisbon, Portugal
  • 2 Instituto de Saúde Ambiental, Faculdade de Medicina, Universidade de Lisboa, Lisbon, Portugal
Histopathology continues to be a rapid and cost-effective means of providing a presumptive or definitive diagnosis of invasive fungal infections.
Tissue samples from patients with suspected invasive fungal disease (IFD) should be examined not only by mycological culture but also by microscopy and specific fungal stains should be included. For histopathological diagnosis of fungal infection is required deep knowledge about fungal morphology in tissue and also about the various reactions of the tissue in response to that infection. Highly experienced histopathologists are therefore essential to detect fungal structures and also to recognize tissue reactions associated with IFD, distinguishing them from staining artifacts.
Histopathology of specimens obtained from an affected site, showing a positive result by the presence of distinctive structures associated to specific endemic fungal species, is considered as criteria for proven IFD. On the other hand, observation of yeasts may sometimes point out for a specific IFD but without confidence. Examination of filamentous fungi in histopathological sections can provide important information like the presence of septa, the hyphal diameter or branching angle and melanisation and may thus yield valuable diagnostic clues on the nature of the causative agent. However, a reliable identification of the fungal species based solely on morphological criteria in histopathology is usually impossible. Species identification of fungi detected in histopathological sections should be attempted using immunohistochemical and/or molecular tools. The recently revised EORTC/MSG criteria for diagnosis of IFD from tissue specimens recommends the amplification of fungal DNA by PCR combined by DNA sequencing only when fungal elements are seen by histopathology.
During this presentation we will discuss with the audience, in an interactive mode, the advantages and pitfalls of tissue diagnosis, and which tests that can be performed to a more targeted diagnosis.

Q16 Fungal Outbreaks

Ilan Schwartz and Alida Fe Talento
Fungi are ubiquitous in natural and built environments, and the ability to cause serious, opportunistic infections in persons with medical or surgical breaches to innate immune defences make hospital associated infections particularly challenging for infection prevention and control programs. Hospital outbreaks, defined as an increased number of cases linked by time and place, due to fungi can involves yeasts (unicellular fungi) or moulds (multicellular fungi). With regards to yeasts, outbreaks due to Candida species like C. parapsilosis and more recently C. auris have been increasing worldwide. Hospital outbreaks of cryptococcosis and pneumocystosis in immunocompromised patients are particularly troubling. Similarly, outbreaks due to moulds such as Aspergillus and Mucorales are well recognised. This session will focus on the challenges of fungal outbreaks in the healthcare setting. These challenges are fourfold. First is the detection of fungal outbreaks due to the difficulty of early and accurate diagnosis of fungal infections. Second is source identification given that fungi are widely dispersed in the environment. Third is the global emergence of antifungal resistance in a backdrop of limited effective therapeutic options. Fourth is the paucity of data on effective infection control measures to manage these outbreaks. Systems to prevent outbreaks in the healthcare setting is key and the role of new technologies such as whole genome sequencing in the management of fungal outbreaks will be discussed.

Q17 Antifungal Stewardship

Souha Kanj 1 and Samir Agrawal 2
  • 1 American University of Beirut Medical Center, Department of Internal Medicine, Division of Infectious Diseases
  • 2 Senior Lecturer and Honorary Consultant, Division of Haemato-Oncology, St. Bartholomew’s Hospital, Barts Health NHS Trust; and Blizard Institute, Queen Mary University of London
Invasive fungal infections (IFI) remain a challenge to the treating physician because of difficulty in diagnosis and high rates of morbidity and mortality associated with these infections, which occur predominantly in the immunosuppressed and critically ill patients. The incidence of invasive fungal infections, especially candidiasis, aspergillosis, and mucormycosis, continues to rise. With the excessive use of azole antifungal agents, we have witnessed a global increase in more resistant fungal species and genera. In addition, the large-scale use of antifungal agents in agriculture has selected for resistant Aspergillus species. There is a wide variation in the epidemiology of fungal infections worldwide, even between neighbouring countries depending on antifungal use in humans and the environment. Consequently, it is no longer acceptable to manage IFI wholly empirically and identifying the species of the infecting organism and its susceptibility profile to the various antifungal agents is key.
Studies have shown that delay in initiation of antifungal therapy is associated with a significant increase in mortality. Therefore, empirical antifungals are often started, but every effort must be made to make a prompt diagnosis of IFI. While histopathology and fungal cultures remain the cornerstone of a definitive diagnosis of IFI, these they have poor sensitivity and take many hours to days for a result. The availability of rapid fungal biomarkers, such as the Aspergillus galactomannan, β-D-glucan, and polymerase chain reaction, can—potentially—provide diagnostic information in hours. These tools have been used for screening and guiding pre-emptive therapy in high-risk patients. Studies have shown that combining biomarkers increases the sensitivity and specificity with an impact on fungal infection-free survival in some patients and allows for early discontinuation. More recently, the development of new molecular tools such as Matrix-Assisted Laser Desorption/Ionization—Time of Flight, FilmArray, Light Cycler, T2Candida assay, and others, allows the rapid detection of fungal pathogens and resistance markers with a turnaround time of only a few hours. Investigational tools such as Proximity Ligation Assay, Breath Fungal Secondary Metabolite Signature, and Siderophore-based Molecular Infection Imaging are promising tools for the diagnosis of IFI. Point-of-care testing is helpful, especially in diagnosing Cryptococcal Meningitis in some developing countries where access to microbiology laboratory is limited, but also for diagnosing invasive aspergillosis using Lateral Flow Devices.
These diagnostic tools can have a tremendous impact on clinical management of IFI. Antifungal stewardship (AFS) team plays a key role in optimising individual patient care, by supporting the frontline clinicians with expert knowledge on the use and limitations of rapid fungal biomarkers, guiding choice of diagnostics and choice of antifungal drugs. The AFS team ideally should be made up of an ID physician, pharmacist and a doctor from the clinical service the patient is in. Studies have shown that AFS programmes ensure optimal antifungal drug use, support de-escalate them to narrower-spectrum agents, reduce overall drug usage and cost and lead to better patient care. These efforts will ultimately translate into decreasing antifungal resistance and reducing overall healthcare cost.

P38 Evaluation of Three Methodologies that Allow In Vitro Induction of the Capsule of Cryptococcus neoformans var. grubii

José Rodas 1, John Gómez 1, Clara Duque 1, Claudia Cuervo 1, Iván Mojica 2 and Juan Gómez 2
  • 1 University Institution Colegio Mayor of Antioquia
  • 2 Synlab Laboratory S.A.S.
Objective: To evaluate the efficacy of three methods for in vitro capsule induction of Cryptococcus neoformans var. grubii.
Materials & Methods: 15 strains of Cryptococcus neoformans var. grubii were used for being preserved in 20% skim milk, which were reactivated, isolated and subjected to the technique of Thomaz et al., 2016, Zaragoza & Casadevall 2004 and a modification of the Zaragoza & Casadevall 2004 method for the induction and capsule formation in vitro, identified by MALDI-TOF EM. The incubation time corresponded to 24 h. Longer periods do not influence the increase in capsule size significantly. For method (A) a McFarland pattern was prepared between 0.89 and 1.29 in sterile water with each strain, for method (B) and (C) a pattern between 2.3 and 2.5 with PBS and sterile water respectively. After 24 h of incubation, the samples were centrifuged at 870× g for 5 min and the supernatant was discarded; subsequently it was suspended in 100 µL of sterile water. Once suspended the cells, 20 uL of suspension and 10 uL of diluted Chinese ink were taken 1:8 for its microscopic reading. Using an Olympus CX33 microscope equipped with a calibrated micrometric ruler, the measurement of the total yeast diameter and the diameter of the yeast with the capsular space was performed. Finally, the difference between the circumference of the capsule and the yeast circumference was found to define the capsular size. From each method, 20 blastoconidias were chosen per strain and thus estimate the percentage of cells with capsule production (capsule induction capacity).
Results: Method (A) and (C) induced capsule in 100% (15/15) of the strains studied, method (B) only in 86.67% (13/15) of the strains; similarly, for method A 99.33% (280/300) produced capsules in all cells of the population while for method B and C 53.33% (160/300) these presented between the (5–20%) and (60–100%) of capsulated cells respectively. The size of the capsule varied according to the method and sizes were found between 0.5 µm and 2 and 11.5 µm.
Conclusions: Method (A) presented more efficiency in terms of production and capsule size. Biological variability plays a decisive role in recognizing ideal conditions and inducing the production of capsules similar to that formed in the host.

P001 Critical Assessment of Cell Wall Integrity Factors Contributing to In Vivo Echinocandin Tolerance and Resistance in Candida glabrata

Rocio Garcia-Rubio 1, Rosa Y. Hernandez 1, Alissa Clear 1, Kelley R. Healey 2, Erika Shor 1,3 and David S Perlin 1,3,4
  • 1 Center for Discovery and Innovation, Hackensack Meridian Health
  • 2 Department of Biology, William Paterson University
  • 3 Department of Medical Sciences, Hackensack Meridian Health School of Medicine
  • 4 Georgetown University
Objectives: Fungal infections cause significant mortality and morbidity worldwide. For several decades, azole drugs have been the primary therapy to treat infections caused by Candida species. However, the extensive use of azoles has led to an epidemiological shift toward Candida species with higher azole tolerance, such as Candida glabrata. Thus, another drug class, the echinocandins, is currently recommended as first line antifungal therapy. The echinocandins target 1,3-β-glucan synthase (GS), the enzyme responsible for producing a major component of the fungal cell wall. Although echinocandins are considered fungicidal, C. glabrata exhibits echinocandin tolerance both in vitro and in vivo, where a subset of the cells survives and facilitates the emergence of echinocandin-resistant mutants by modifications in GS-enconding FKS genes. Unfortunately, these mutations are often associated with therapeutic failure. The objective of this work was to identify C. glabrata genes that contribute to echinocandin tolerance in vitro and in vivo.
Methods & Materials: To identify genes that contribute to C. glabrata echinocandin tolerance, we examined a collection of C. glabrata deletion mutants chosen because they were sensitive to cell wall damaging agents and/or because these genes or their orthologs in Saccharomyces cerevisiae were known to function in cell wall maintenance. We used an in vitro tolerance assay to measure the survival of each knock-out strain after 24-h exposure to a wide range of caspofungin concentrations. The deletion mutants that resulted in significantly reduced tolerance to caspofungin were therefore selected for further studies in vivo using a mouse model of C. glabrata gastrointestinal (GI) colonization. In this model, the mouse GI tract was sterilized using antibiotics and then colonized via oral gavage. Stably colonized mice were exposed to high-dose daily caspofungin treatment after three days of colonization. Fresh fecal samples were collected every other day throughout the experiment to assess fungal burden in the GI tract. Echinocandin susceptibility testing as well as FKS sequencing was performed in strains isolated from the GI tract of mice with fungal rebound 15 days after colonization.
Results: We identified three C. glabrata genes involved in the maintenance of cell wall integrity—YPS1. YPK2, and SLT2—whose deletion mutants showed echinocandin hyper-susceptibility in vitro. We also assessed their contribution to echinocandin tolerance and emergence of resistance in vivo. We found that mice colonized with strains carrying deletions of these genes were more effectively sterilized by daily caspofungin treatment relative to mice colonized with the wild-type parental strain. Furthermore, consistent with a role of tolerant cells serving as a reservoir for generating resistant mutations, a reduction in tolerance was associated with a reduction in the emergence of resistant strains. Finally, reduced susceptibility in these strains was due both to the well described FKS-dependent mechanisms and as yet unknown, FKS-independent mechanisms.
Conclusions: The above-mentioned genes involved in the maintenance of cell wall integrity contribute to echinocandin tolerance both in vitro and in a mouse model of gastrointestinal colonization, shedding light on the importance of this pathway in echinocandin tolerance and emergence of resistance in vivo.

P002 Antimicrobial Potentials of Lantana Camara Montevidensis Leaf Extract on Wounds Infected with Candida Isolates Using Animal Models

Ofonime Ogba, Sunday Edim and Stanley Anyawu
University Of Calabar
Objectives: Medicinal plants are important source of medication in traditional system of medicine. The aim of this study was to determine the antimicrobial activity of Lantana camara leaf extract against clinical isolates of Candida from infected wounds invitro and in vivo using animal models. The objectives of the study was to isolate and identify Candida isolates from wounds of patients attending University of Calabar Teaching Hospital (UCTH). Determine the susceptibility pattern of the Candida isolates and the antimicrobial potentials of Lantana camara leaf extract against the yeasts isolates.
Materials & Methods: Aqueous and methanol leaf extraction was done using Soxhlet apparatus. Ten Candida isolates associated with wound infections were re-identified and used for the study. Antifungal susceptibility testing was done using the E-Test strips. Fifteen healthy male Wistar rats were used for the study. The rats were anesthetized before making incision wounds on the neck region. The rats were treated with 100 mg/mL, 50 mg/mL and 25 mg/mL concentration of extract topically. The skin tissues of the sacrificed rats were obtained for histological examination using Heamatoxylin and eosin technique.
Results: The susceptibility rate of the Candida isolates ranged from (0.0–40.0%). Fluconazole was the most effective antifungal. Isolates were most susceptible (40.0%) to 100 mg/mL concentration of extract. Rats treated with 100 mg/mL methanol extract had significant mean wound contractions of 70.33 ± 0.58 with damaged tissue repair.
Conclusions: Methanol extract of Lantana camara leaf has antimicrobial activity on Candida isolates and topical healing effect on Candida wound infections and may be used as an alternative to antimicrobials for Candida wound management.

P010 Multifactorial Role of Mitochondria in Echinocandin Tolerance Revealed by Transcriptome Analysis of Drug-Tolerant Cells

Rocio Garcia-Rubio 1, Cristina Jimenez-Ortigosa 1, Lucius DeGregorio 1, Christopher Quinteros 1, Erika Shor 1,2 and David S Perlin 1,2,3
  • 1 Center for Discovery and Innovation, Hackensack Meridian Health
  • 2 Department of Medical Sciences, Hackensack Meridian Health School of Medicine
  • 3 Georgetown University
Objectives: Echinocandin drugs are a first line therapy to treat invasive candidiasis, which is a major source of morbidity and mortality worldwide. The opportunistic fungal pathogen Candida glabrata is notable for rapidly evolving echinocandin-resistant strains associated with clinical failure. Echinocandin resistance is thought to emerge within a small echinocandin-tolerant subset of C. glabrata cells that are not killed by drug exposure, but mechanisms underlying echinocandin tolerance are still unknown. The objective of this study was to gain new insights into echinocandin tolerance in C. glabrata by examining the transcriptome of echinocandin-tolerant cells.
Methods & Materials: Fluorescence-activated cell sorting was used to highly enrich for C. glabrata cells that have survived prolonged echinocandin exposure in vitro, followed by single-cell RNA sequencing to examine the transcriptional landscape of echinocandin-tolerant cells. Based on the functional categories of differentially expressed genes, we selected different types of chemical inhibitors to modulate the most significantly up- or downregulated pathways to ask whether this modulation altered C. glabrata echinocandin tolerance. Based on these results, we focused on the role of mitochondria in echinocandin tolerance. We examined ROS levels in caspofungin-treated cells by using ROS-sensitive dyes followed by flow cytometry analysis. We used qRT-PCR to examine individually the expression of several genes involved in oxidative stress responses during caspofungin or micafungin treatment. We also generated a number of mitochondria-deficient strains lacking various mitochondrial components using CRISPR, as well several petite mutants that emerged during ethidium bromide or echinocandin treatment. All mitochondria-deficient mutants were examined for echinocandin tolerance using the caspofungin killing assay. Finally, partially purified 1,3-β-D-glucan synthase (GS) was obtained to measure kinetic inhibition by echinocandins in vitro.
Results: This analysis identified a transcriptional signature of echinocandin tolerance distinct from the stereotypical yeast environmental stress response characterized by upregulation of pathways involved in chromosome structure and DNA topology and a downregulation of oxidative stress responses, the latter of which was observed despite increased levels of reactive oxygen species. Further analyses showed that inhibitors of mitochondrial complexes I and IV reduced echinocandin-mediated cell killing. However, an ROS scavenger did not alter cell killing dynamics, indicating that ROS per se do not significantly contribute to cell death upon echinocandin exposure. We also found that mutants lacking various mitochondrial components, including both respiration-proficient and respiration-deficient strains, all showed an echinocandin hyper-susceptible phenotype at below-MIC concentrations. Finally, GS purified from mitochondrial mutants exhibited normal in vitro inhibition kinetics, indicating that mitochondrial defects influence cell survival downstream of the drug-target interaction.
Conclusions: These results provide new insights into the C. glabrata response to echinocandins, revealing a unique transcriptional signature as well as a multifactorial role of mitochondria in echinocandin tolerance.

P011 In Vitro Antifungal Effect of Plant-Based Compound CIN-102 on Filamentous Fungi and Their Biofilm

Maurine D’agostino 1, Nicolas Tesse 2, Jean Pol Frippiat 1, Marie Machouart 1,3 and Anne Debourgogne 1,3
  • 1 EA Simpa
  • 2 SEPTEOS
  • 3 CHRU Brabois
Objectives: Today the increase of invasive fungal infections (IFIs) due to immunosuppressive therapies and the emergence of resistant strains can induce therapeutic failure. To face it, the SEPTEOS company has recently developed CIN-102, including cinnamaldehyde and active compounds from two essential oils of cinnamon. CIN-102 has already been shown to be active against the three main genera of filamentous fungi (Aspergillus sp., Fusarium sp. and Scedosporium sp.) with a unimodal distribution of MIC (minimal inhibitory concentration). The objective of this study is to describe the mode of action of this natural mixture on filamentous fungi (fungistatic or fungicidal effect) and to visualize its effectiveness on the biofilm, a factor of virulence and resistance to antifungals.
Materials & Methods: Eight strains are studied: Fusarium solani, Fusarium dimerum, Lomentospora prolificans, Scedosporium apiospermum, Aspergillus flavus, Aspergillus fumigatus and two azole resistant A. fumigatus. CIN-102 is compared with two antifungal drugs used in clinical practice: amphotericin B (AMB) and voriconazole (VRZ).
In order to determine if CIN-102 has an fungicidal or fungistatic effect, a time kill assay was performed. After differents incubation times with antifungals, the Colony Forming Units (FCU) are counted. A decrease in FCUs greater than 3 log 10 is considered as a fungicidal effect.
Biofilms were formed after a 90-min adhesion phase followed by the addition of RPMI medium and after a 48 h at 37 °C. Antifungals at different concentrations were added, either after the adhesion phase or after the 48 h of incubation to study their effect on the formation and on the preformed biofilm. After washing, a mixture of XTT-menadione was added to the wells. After 60 min at 37 °C, the OD (optical density) is measured at 450 and 630 nm. An optical microscope observation allows the visualization of elements of the biofilm.
Results: The fungicidal effect of CIN-102 was demonstrated at 2 or 4 MIC for all strains tested from 12 to 24 h for Fusarium. Aspergillus and Lomentospora prolificans and from 48 h for Scedosporium apiospermum.
We observed an antifungal effect of CIN-102 on biofilm, and particularly on its formation, with 100% inhibition achieved from 1 MIC. Finally, CIN-102 was able to inhibit 100% of biofilm formation by five other tested strains (A. fumigatus, A. flavus, F. dimerum, L. prolificans and S. apiospermum) against one for VRC (A. fumigatus) and two for AMB (A. fumigatus and A. flavus) and it was effective at low concentration for all of the strains (from 1/2MIC to MIC).
Conclusions: In conclusion, CIN-102 is active on filamentous fungi with fungicidal activities and actions on biofilm, it can be an interesting candidate as a new antifungal class. Further study including an in vivo study will be carried out in order to validate the potential of CIN-102 to offer new treatment possibilities against these pathologies.

P012 Detection of Wild-Type Candida Vaginal Isolates with Reduced Susceptibility to Azoles Used for the Treatment of Vulvovaginal Canididiasis

Joseph Meletiadis 1,2, Lamprini Kanioura 2,3, Maria Siopi 1, Drosos Karageorgopoulos 4, Flavia de Bernardis 5 and Stavroula Antonopoulou 6
  • 1 Clinical Microbiology Laboratory, Attikon University Hospital
  • 2 Department Medical Microbiology and Infectious Diseases, Erasmus MC
  • 3 MycoLab, Diagnostic Laboratory of Sexually Transmitted Diseases, Specific Infectious Diseases, Fungal, Microbiological and Cytologic Examinations
  • 4 4th Department of Medicine of the University of Athens, Attikon University Hospital
  • 5 Department of Infectious Diseases, Istituto Superiore di Sanità
  • 6 Department of Microbiology, General Hospital “G. Gennimatas”
Objectives: Azoles are the first line therapy of vulvovaginal canididiasis (VVC) with various efficacy rates against different Candida species. However, there no clinical breakpoints neither epidemiological cut-off values (ECOFF) for these drugs and Candida vaginal isolates hindering the detection of non-wild phenotypes and antifungal resistance. We therefore determined the ECOFFs of different azoles used in the treatment of VVC against Candida vaginal isolates and compared them with the MICs of fluconazole resistant isolates.
Materials & Methods: The in vitro activity of 216 yeast isolates (102 C. albicans, 93 C. parapsilosis, 21 C. glabrata) against fluconazole, ketoconazole, miconazole, econazole, itraconazole and clotrimazole) were tested with the EUCAST EDef 7.3.2. The correlation between fluconazole MICs and MICs of the other azoles were analyzed with Pearson correlation after log2 transformation. The MIC distributions were analysed with the ECOFFinder2.0 in order to define the wild-type population and determine local ECOFFs. The MICs of azoles for fluconazole susceptible (MIC ≤2 mg/L) and non-susceptible (MIC >2 mg/L) isolates were determined for each species.
Results: Statistically significant correlation was found between fluconazole MICs and MICs of all the other azoles for C. albicans (r = 0.73–0.95, p < 0.001) and C. parapsilosis (r = 0.23–0.75, p < 0.001) whereas for C. glabrata significant correlation was found only for itraconazole and clotrimazole (r = 0.83–0.90, p < 0.001). The median (range) MICs of fluconazole, ketoconazole, miconazole, econazole, itraconazole and clotrimazole for fluconazole susceptible and non-susceptible isolates together with ECOFFs encompassing >97.5%/99% of wild-type MICs for C. albicans, C. parapsilosis and C. glabrata are shown in Table 1. Although there was some overlapping between the MICs of fluconazole susceptible and non-susceptible isolates, the differences were statistically significant (p < 0.05) with the median MICs differ by >2 twofold dilutions in most cases. ECOFFs were 1–2 twofold dilutions higher than the median MIC of fluconazole susceptible isolates. However, the median MIC of fluconazole non-susceptible isolates were ≥2 twofold dilutions higher than the corresponding ECOFFs only for C. albicans and all azoles except and clotrimazole and for C. parapsilosis for ketoconazole and itraconazole.
Jof 07 00916 i001
Figure 1. The median (range) MICs for each azole and Candida species for fluconazole susceptible (FLU S) and no-susceptible (FLU non-S) isolates together with estimated local epidemiological cut-off values (ECOFF).
Conclusions: Significant differences of ketoconazole, miconazole, econazole, itraconazole and clotrimazole MICs were found between fluconazole susceptible and non-susceptible isolates. Non-wild type phenotypes were associated with reduced azole susceptibility particularly for C. albicans. The estimated ECOFFs could be used to define wild-type population of Candida vaginal isolates and detect isolates with reduced susceptibility to azoles. Multicentre MIC distributions are required to verify wild-type populations and determine official ECOFFs for vaginal isolates.

P013 Difficult-to-Treat Cryptococcal Meningitis in an Immunocompetent Patient: Antifungal Therapy Toxicity, Fluconazole Resistance and Severe Intracranial Hypertension

Miguel Ángel Verdejo-Gómez 1, Lorena Salmerón-Godoy 1, Carmen Moreno de la Santa 1, Manuel Lizasoain-Hernández 1, Ana Pérez de Ayala 2, Francisco Jiménez-Morillas 4, María Pilar Hernández-Jiménez 3 and Carlos Lumbreras-Bermejo 1
  • 1 Internal Medicine Department, Hospital Universitario 12 De Octubre
  • 2 Microbiology and Parasitology Department, Hospital Universitario 12 de Octubre
  • 3 Internal Medicine Department, Hospital Universitario La Princesa
  • 4 Emergency Department, Hospital Universitario 12 de Octubre
Objectives: Cryptococcal Meningitis is a rare condition in non-HIV, immunocompetent hosts. Clinical experiences must be shared in order to increase the knowledge about this infection.
Materials & Methods: We report the case of a 59-year-old woman who attended to the Emergency Deparment for 10-days progressive headache, nausea and vomiting. Se had a personal history of obesity, dyslipemia and classic migraine. She had not travelled abroad recently. On initial evaluation she was afebrile, with no abnormal findings in physical and neurological examination. Blood examination showed leukocytosis, mild hypokaliemia and mild lactate deshydrogenase increase. Ophthalmological fundus examination suggested intracranial hypertension (ICH) and a cranial computed tomography (CT) with intravenous contrast showed neither intraparenchymal injuries nor vascular complications. Eventually, lumbar puncture was performed obtaining a clear cerebrospinal fluid at an opening pressure of 44 cmH2O (normal <20 cmH2O), cyto-biochemical analysis with mononuclear-dominance pleocytosis (60 leukocytes/μL, 80% mononuclear), hypoglycorrhachia (45 mg/dL, with blood glucose: 120 mg/dL) and proteinorrachy (0.74 g/L). Urgent Gram’s staining showed inflammatory cells and the presence of yeasts, with Chinese ink staining that showed encapsulated blastoconidium cells compatible with Cryptococcus spp. (Figure 1). The latex agglutination for Cryptococcus antigen resulted positive at a >1/128 titer. After these findings, we started induction treatment for Cryptococcal Meningitis with liposomal Amphotericin B 4 mg/kg/day and Flucytosine 25 mg/kg/6 h.
Results: A comprehensive study of clinical predisposing conditions was performed with no findings. Thoracic-abdomen-pelvis CT did not show hidden neoplasia. After two weeks of treatment, we observed severe neutropenia secondary to flucytosine, which lead us to a substitution by high-dose fluconazole. Furthermore, she continued with moderate hypokalemia due to both persistent vomiting and amphotericin B toxicity, requiring prolonged parenteral supplementation.
Microbiological characterization was consistent with Cryptococcus neoformans var grubii, and susceptibility pattern revealed fluconazole Minimal Inhibitory Concentration (MIC) of >32 µg/mL by broth microdilution commercialized method, so we decided to change Fluconazole to Voriconazole for completing the induction scheme, which finally consisted in Voriconazole 300 mg bid plus liposomal amphotericin B at dose described previously for a total of 30 days.
Notwithstanding, the patient maintained persistent syntomatic ICH (range 29 to 50 cmH2O) despite daily lumbar puncture and an adequate microbiological response. Therefore, we decided to place a ventriculus-peritoneal derivation (VPD) that allowed us controlling intracranial pressure, with significant clinical improvement.
Once induction treatment was completed, we started consolidation treatment with oral Voriconazole 200 mg bid, buy an elevation of gamma-glutamyl transferase more than 10 times upper limit was developed. Voriconazole was stopped with subsequent normalization of liver enzymes. Instead, Isavuconazole 200 mg qd was used for up to 12 months.
Currently, the patient is not receiving antifungal therapy, she is in a good clinical condition with no evidence of microbiological relapse.
Conclusions: In conclusion, we present a 59-year-old immunocompetent women who developed acute meningitis due to Cryptococcus neoformans, requiring the use of new azoles for its treatment and with ICH poor control which forced us to place a VPD, resulting in a favorable outcome.
Jof 07 00916 i002
Figure 1. Chinese ink stain on CSF culture.

P014 Elucidating Amphotericin B Tolerance, a Neglected Phenotype in Clinical Isolates of Aspergillus terreus

Roya Vahedi-shahandashti and Cornelia Lass-Flörl
Institute of Hygiene and Medical Microbiology, Medical University Innsbruck
Objectives: Infections due to Aspergillus species are an acute threat to human health. Aspergillus species within the section Fumigati are the most frequently occurring agents, but depending on the local epidemiology, representatives of section Terrei or section Flavi are 2nd or 3rd most important. Aspergillus terreus holds an exceptional position within the aspergilli due to its reduced sensitivity to amphotericin B (AmB). Usually, AMB minimum inhibitory concentrations (MIC) are high (>2 mg/L), but a broad range of MIC phenotypes have been reported in the absence of clinical breakpoints for AMB. The discordance between treatment outcome and infections due to the “AMB susceptible A. terreus” may be attributable to drug tolerance. This study aimed to examine the killing kinetic patterns of AMB against A. terreus isolates to define tolerant phenotypes.
Materials & Methods: Tolerance is the ability of a “susceptible isolate” to grow in the presence of AMB above the MIC; tolerant fungi are characterized by a longer minimum duration of killing time (MDK) than susceptible isolates. We investigated AMB-MDKs of A. terreus sensu stricto isolates (n = 4) representing susceptible (S < 1 mg/mL) and resistant (R > 4 mg/mL) phenotypes (EUCAST). Time-kill curve analysis (99% killing of the initial population) was performed in RPMI 1640 and AM3 media at different AMB concentrations, and in parallel, the germination rate was determined microscopically.
Results: Time-kill curves of AMB against A. terreus 164 (MIC = 0.5 μg/mL), A. terreus 81 and 31 (each AMB MIC = 1 μg/mL), and A. terreus 134 (MIC = 4 μg/mL) showed different killing patterns in AM3 and RPMI 1640, respectively. A. terreus 81 and A. terreus 31 showed tolerant phenotypes in AM3 at AMB concentrations of 20× MICs and 40× MICs. No tolerant phenotypes were detected in RPMI 1640 media. All isolates showed a significantly faster germination rate in AM3 medium when compared to RPMI 1640, evaluating different time points.
Conclusions: Our study revealed that A. terreus with AMB MICs = 1 mg/mL displays tolerant phenotypes, and that nutrition media may influence this activity. AM3 medium potentially supports the fungicidal activity of AMB against A. terreus by inducing rapid germination (vulnerable against AMB) in an early stage of incubation. The combination of the MDK and MIC provides a new framework to identify AMB-tolerance in A. terreus.

P015 Polyunsaturated Fatty Acids Enhance the Activity of Fluconazole against Candida krusei In Vitro and in a Caenorhabditis elegans Model

Abdullahi Temitope Jamiu, Jacobus Albertyn, Olihile M. Sebolai and Carolina H. Pohl
Pathogenic Yeast Research Group, Department of Microbiology and Biochemistry, University of the Free State
Objectives: Although Candida albicans remains the major cause of invasive candidal infections, the incidence of infections caused by non-albicans Candida species, including C. krusei especially in immunodeficient population, is rapidly increasing and demands urgent public health attentions. Candida krusei intrinsically exhibits resistance to fluconazole while also rapidly displaying adaptive resistance to other antifungal drugs. Moreover, like other common Candida spp., this yeast has the propensity to form recalcitrant biofilm with increased resistance. Hence, the need to develop novel and effective therapeutic strategies to combat infections caused by this pathogen is undoubtable. One such approach is through combination therapy with natural compounds such as polyunsaturated fatty acids (PUFAs). This study was conceptualised to investigate the potentiating effect of PUFAs with fluconazole against C. krusei biofilm in vitro, as well as the conserved nature of this effect in a Caenorhabditis elegans infection model.
Materials & Methods: This study was carried out by exposing C. krusei biofilm to the sub-inhibitory concentration (SMIC50) of fluconazole alone or in combination with PUFAs; linoleic acid (LA) or gamma-linolenic acid (GLA), and evaluating the biofilm metabolic activity using XTT reduction assay. Subsequently, the influence of these treatments on biofilm morphology, membrane integrity, oxidative stress, and efflux pump activity was also evaluated with scanning electron microscopy, propidium iodide, antioxidative, and Rhodamine 6G efflux assays, respectively. In addition, the ability of the PUFAs to prolong the survival and reduce the fungal burden of infected C. elegans was assessed.
Results: Our results indicated that both PUFAs individually enhance the activity of fluconazole towards C. krusei biofilm in vitro via cell membrane damage, elicitation of oxidative stress, disruption of efflux pump activity, and ultimate induction of cell rupture. Additionally, the PUFAs potentiate the activity of fluconazole towards C. krusei in vivo, evident of the enhanced survival and significant reduction in fungal burden of infected C. elegans.
Conclusions: Taken together, PUFAs show potential as antifungal-potentiating agents against intrinsically fluconazole-resistant C. krusei, both in vitro and in vivo. This finding may pave the way for future studies into novel therapeutic options for overcoming increasing antifungal resistance.

P016 Antifungal Susceptibility of Clinical Cryptococcus gattii Isolates from Colombia Varies among Molecular Types

Carolina Firacative 1 and Patricia Escandón 2
  • 1 Universidad Del Rosario
  • 2 Instituto Nacional de Salud
Objectives: To determine if clinical Colombian Cryptococcus gattii isolates of the molecular types VGI, VGII and VGIII differ in the susceptibility to commonly used antifungal drugs, as cryptococcosis by C. gattii is endemic in Colombia, affecting mostly immunocompetent hosts, and considering that antifungal susceptibility differences between molecular types of cryptococcal isolates have been reported in various other countries.
Materials & Methods: C. gattii isolates from 42 patients recovered in 15 Colombian states were included. Most patients (88.1%) did not have any risk factor for cryptococcosis. Susceptibility testing was carried out using Sensititre YeastOne plates (Thermo Scientific, Waltham, MA, USA), to amphotericin B, 5-flucytosine, fluconazole, itraconazole, voriconazole and posaconazole. Minimum inhibitory concentrations (MICs) of each antifungal drug were determined per molecular type and for all isolates. Mode and geometric mean MICs were calculated. MICs per drug and molecular type were compared with epidemiologic cut-off values (ECV) >95%, to determine if the isolates belong to the wild-type distribution, as established with worldwide isolates.
Results: Most (85.7%) C. gattii isolates from Colombia distribute among the wild-type populations of each molecular type, per antifungal drug. However, six (14.3%) non-wild-type isolates were identified. Among the molecular type VGII, two isolates were simultaneously fluconazole and voriconazole non-wild type. In addition, in VGI and VGIII, one 5- flucytosine and three fluconazole non-wild type isolates were identified, respectively. In general, the susceptibility of the studied isolates to amphotericin B did not differ among molecular types. The molecular type VGI was found to be less susceptible to 5-flucytosine than VGII. In addition, VGII was found to be less susceptible to fluconazole, itraconazole and voriconazole than VGI and VGIII. VGII was also less susceptible to posaconazole than VGIII.
Conclusions: This study emphasizes the importance of identifying reduced drug susceptibility of cryptococcal isolates when treating cryptococcosis and of establishing the molecular types of the isolates. MIC determination is essential, with special attention to the in vitro activity of fluconazole, as this is a drug with long-term usage that is prescribed in the three-part strategy of induction, consolidation, and maintenance, as such, the emergence of high-level of fluconazole resistance is probable. Reduced susceptibility to other azoles must be surveyed as well since these drugs are salvage consolidation therapies when fluconazole is not available. In general, broaden investigations of the genetic basis of reduced antifungal susceptibilities phenotypes in C. gattii are warranted, as it is still unknown what causes the differences in the in vitro antifungal susceptibilities of the molecular types and the occurrence of resistance when there has not been previous exposure to the drugs.

P025 Improving Laryngectomy Clinical Practice, Patient Care, and Quality of Life by Tackling Candida Biofilm Formation on Voice Prostheses

Campbell W. Gourlay, Daniel R. Pentland, Fritz A. Muhlschlegel and Jack Davis
University of Kent
Objectives: To test whether a precise anti-fungal treatment regime can extend voice prosthesis lifespan thus offering a new evidence-based management approach that can be adopted within the clinic.
Materials & Methods: We formed a multi-disciplinary team consisting of ENT practitioners and University based researchers. Lab based experiments and clinical microbiology analyses were directed towards our research questions. This approach led to the construction and NHS ratification of a set of treatment guidelines. The guidelines were then applied to a patient cohort and analysed for significance in a study spanning seven years.
Results: Here we report that colonisation of VP by the yeast is the major problem underlying device failure and that C. allbicans is the most predominant coloniser. We present evidence that the high CO2 environment generated by exhaled breath is a key driver of C. albicans biofilm development on VP. Elevated CO2 activates and accelerates the biofilm program and enhances key support attributes including adhesion, iron acquisition, glucose uptake and hyphal transition. We present evidence from a patient study that antifungal treatment extends VP lifespan by an average of 270%, a the most significant enhancement of prosthesis performance reported to date. We also present evidence that antifungal treatment can reduce the ability of bacteria such as S. aureus, to colonise VP as a result of the inhibition of C. albicans-bacterial interactions.
Conclusions: As a result of our work we have introduced a robust anti-fungal treatment plan that significantly extends VP lifespan in patient studies. Our clinical care pathway offers a real improvement to patient care and is now being used in a number of NHS trusts across the UK.

P026 Antibiofilm Activity of Olorofim (F901318) against Azole-Resistant Aspergillus fumigatus

Lisa Kirchhoff 1, Silke Dittmer 1, Dan-Tiberiu Furnica 1, Jan Buer 1 and Joerg Steinmann 1,2
  • 1 Institute of Medical Microbiology, University Hospital Essen
  • 2 Institute of Clinical Hygiene, Medical Microbiology and Infectiology, Klinikum Nuernberg
Objectives: In recent decades, the number of reports on invasive infections with azole-resistant Aspergillus fumigatus (ARAF) increased. Especially biofilm forming fungi can cause refractory infection-manifestations (e.g., in cystic fibrosis or immuno suppression) which are usually linked to increased resistances to anti-infective agents. The need of novel anti-infective therapeutics with new underlying mechanisms against several fungal infections is emerging. Here, the novel antifungal compound olorofim (F901318), which belongs to the new class of the orotomides, targeting the dihydroorotate dehydrogenase within the de novo pyrimidine biosynthesis pathway, has been tested for its activity against different stages of ARAF and non-ARAF biofilms.
Materials & Methods: Olorofim activity has been analyzed at different stages (prior adhesion, 4 h, 12 h, 24 h and 48 h after inoculation) of biofilm formation of clinical ARAF strains (n = 16) as well as azole susceptible A. fumigatus isolates (n = 4) by using an XTT assay. Olorofim was applied in concentrations of a total, a half, a quarter and an eighth of the previously determined minimum inhibitory concentrations (MICs) by broth microdilution method after EUCAST.
Results: Olorofim showed MICs between ≤0.008 and 0.03 mg/L against the here included A. fumigatus isolates. Antimicrobial and antibiofilm activity of olorofim has been detected to be strain specific. Best antibiofilm activity has been observed when olorofim was added prior to adhesion (t0) and right after adhesion (t4) with biofilm reduction up to 96% compared to the non-treated control. In contrast, olorofim did not show an effect on mature (t24 & t48) A. fumigatus biofilm. Additionally, the germinated biofilm of A. fumigatus has been detected to be resistant towards olorofim.
Conclusions: In conclusion, the novel drug olorofim showed promising effects against initial phases of A. fumigatus biofilm formation, regardless their susceptibility towards azoles. However, no effect on mature biofilms was found.

P027 Combined Activity of Liposomal Amphotericin B and Voriconazole against Fusarium solani and Scedosporium apiospermum Biofilms

Aikaterini Vikelouda 1, Maria Simitsopoulou 1, Charalampos Antachopoulos 1, Lemonia Skoura 2 and Emmanuel Roilides 1
  • 1 3rd Department of Pediatrics, Aristotle University, School of Medicine
  • 2 Department of Microbiology, Aristotle University, School of Medicine
Objectives: Fusarium species and Scedosporium apiospermum are distributed worldwide and considered important emerging pathogens, causing locally invasive or disseminated fungal diseases in humans especially among immunocompromised hosts. Fusarium spp. are related to vision-threatening keratitis among other infections, while S. apiospermum frequently colonizes airways of cystic fibrosis patients chronically impairing respiratory function. The ability of both fungi to form biofilms (BF) on solid and tissue culture surfaces has been suggested as an important factor that may contribute to the pathogenicity profile of these organisms. Little is known about drug combinations against F. solani or S. apiospermum biofilm-derived infections. We assessed the in vitro damaging activity of liposomal amphotericin B (L-AMB) and voriconazole (VRC) against F. solani (FS) and S. apiospermum (SA) mature BF alone or in combination.
Materials & Methods: F. solani (n = 3) and S. apiospermum (n = 3) clinical strains were incubated at 105 cfu/mL in 96-well microtiter plates at 37 °C for 48 h. BF formation was assessed by 1% safranin staining and quantitated spectrophotometrically at 490 nm. For MIC determination, two-fold dilutions of L-AMB and VRC (0.007–256 mg/L) were incubated with BF for 24 h (n = 6–9). The combinational activity of L-AMB (0.5–32 mg/L) with VRC (0.125–64 mg/L) against BF at 37 °C for 24 h was determined using a checkerboard microdilution method (n = 10). BF damage compared to controls was assessed by XTT metabolic reduction assay. MIC50 was determined as ≥50% BF damage. Drug interactions were analyzed using Bliss independence model. The combination effect was defined as synergistic, antagonistic or indifferent when the observed BF damage was significantly higher, lower or equal to the expected damage, respectively.
Results: All strains of both organisms formed strong BF (OD range: 0.195–0.238). LAMB and VRC BF MIC50’s for FS were 2 and >256 mg/L, whereas MIC50’s for SA were 2 and 32 mg/L, respectively. LAMB was significantly more effective against BF of FS and SA compared to VRC (2 mg/L vs. >256 and 32 mg/L, respectively; p < 0.05), exhibiting comparable activities against either organism. Combinational treatment of SA biofilms resulted in synergistic effect at 2–4 mg/L of L-AMB combined with 4–16 mg/L of VRC. Mean ΔE value of significant interactions, 17% [range, 14% to 20%]; mean SE, 3.7% [range, 3.0% to 4.3%]. By comparison, antagonistic effects at concentrations of 0.5–4 mg/L of L-AMB combined with 0.125–16 mg/L of VRC was observed against FS biofilms, demonstrating mean ΔE value of significant interactions −28% (range: −11% to −55%) with mean SE 4.6% (range: 2.5–7.9). In contrast.
Conclusions: While a comparable antifungal effect is achieved by LAMB alone against BF of F. solani and S. apiospermum, voriconazole activity is poor against BF of either organism. However, combination of LAMB with VRC at near BF MIC concentrations exhibits synergistic activity against S. apiospermum BF, whereas the combined activity of LAMB with VRC is antagonistic against F. solani BF. These findings may have important implications in the treatment of biofilm-related infections caused by these fungi.

P028 Candida auris Biofilm Heterogeneity Influences the Host Response in an In Vitro Wound Model

Jason L. Brown 1,3, Christopher Delaney 1,3, Bryn Short 1,3, Mark C. Butcher 1,3, Emily McKloud 1,3, Craig Williams 1,3, Ryan Kean 2,3 and Gordon Ramage 1,3
  • 1 University of Glasgow
  • 2 Glasgow Caledonian University
  • 3 Glasgow Biofilms Research Network
Objectives: In the years since its sudden emergence in 2009, Candida auris quickly established itself as a prolific nosocomial pathogen and a global health risk. This enigmatic yeast has exhibited two distinct growth phenotypes that have been termed aggregating and non-aggregating cells. The aggregating phenotype stems from the inability of daughter cells to detach from the parent cell during dell division. Limited data has previously shown that these cell phenotypes influence traits such as biofilm formation and virulence. Herein we aimed to investigate the role of differing cell phenotypes in biofilm formation and virulence using in vitro skin epithelium infection models.
Methods: In this study, we screened a panel of C. auris isolates for biofilm formation, using an electron impedance method and biofilms were subsequently viewed either using scanning electron microscopy or confocal imaging via labelling with novel fluorescent smart-probes. Next, the transcriptional profile of aggregating and non-aggregating isolates during biofilm formation was compared using RNA-sequencing.
Results: These analyses showed a high level of biofilm heterogeneity between cell phenotypes and this was reflected in their respective transcriptomes. Analysis revealed an upregulation of genes relating to the fungal cell wall, adhesion and host cell invasion. Building upon these findings, we then investigated, for the first time, the fungal recognition and inflammatory response of a three-dimensional skin epithelial model to C. auris. In addition, a wound was inflicted on this epithelial model to mimic a portal of entry for the fungal cells. Although both cell phenotypes elicited a minimal response without a wound, when a passage of entry was created, both aggregating and non-aggregating cells induced a greater inflammatory response with the aggregating phenotype being more proinflammatory.
Conclusions: The ability of C. auris to generate such immune responses in wounded skin shows why this yeast has become such a high risk within nosocomial environments where susceptible patients may have multiple indwelling lines.

P029 Omic Modelling of Candida albicans Biofilms

Christopher Delaney Delaney 1, Jon Pratten 2, Dave Bradshaw 2 and Gordon Ramage 1
  • 1 University Of Glasgow
  • 2 Oral Health R&D, GlaxoSmithKline
Objectives: Candida biofilms are a substantial clinical and human health burden which are still underappreciated. Benefits afforded by morphogenic switching from planktonic to biofilm communities include resistance to antimicrobials in the host’s immune system, and resilience towards mechanical disruption, all of which complicate the treatment and management of infections. Biofilm formation in Candida spp. is influenced by numerous factors, including response to the host, pH, bacteria, and many other environmental factors. We aimed to profile and to decipher the mechanisms that underpin the observed heterogeneity and phenotypic differences that we observe in clinical strains. Additionally, we aimed to discern molecular and metabolic signatures of biofilm formation in response to environmental and bacterial stimulus.
Methods & Materials: C. albicans isolates derived from BSI have been profiled and identified to be phenotypically distinct in their biofilm formation. Transcriptomics by RNA-Seq, proteomics by MS and metabolomics by MS was performed on phenotypically distinct C. albicans strains, biofilm competent and biofilm deficient, clinical isolates +- foetal calf serum (FCS). Data sets were integrated by computational, pathway-based and network methods to elucidate adaptive biofilm mechanisms. C. albicans has also been profiled in the presence of numerous bacterial species using established RNA-Seq pipelines to identify C. albicans transcriptional response to bacterial adhesion.
Results: Differences were observed in the biofilm competent (HBF) compared to the biofilm deficient (LBF) isolates with both susceptibilities and drug resistance correlated with the biofilm forming ability. From our high and low Candida isolates we observed phenotypic switching of LBF in the presence of serum. We also found functional differences related to phenotype and this observed switching. The LBF response to serum included enrichment in fatty acid and acl-coA metabolic pathways. Metabolomic analysis revealed changes in arachidonic acid metabolism in serum grown isolates and changes in the amino acid metabolism between LBF and HBF isolates. Integrating these data conceptually we were able to observe overlaps in the metabolic reprogramming of C. albicans isolates in serum with joint pathway analysis confirming changes in the fatty acid metabolic response in both transcriptomic and metabolomic data.
Conclusions: Through the application of transcriptomics and metabolomics we have demonstrated that these holistic methodologies are invaluable to biofilm research. We identified molecular processes and metabolomic reprogramming of C. albicans in response to the biofilm inducing stimulus of serum. We also highlight the current and potential benefits that integration of multiple omics data sets provides. Integration is not without its challenges, however, and we identify some key methodologies that could improve interpretability of omics datasets derived from microbial communities.

P030 Differences in Yeast Biofilm Production According to Species and Clinical Origins

Seydou Nakanabo Diallo 2, Ahalieyah Anantharajah 1, Maria Isabel Montesinos Hernandez 3, Marie Robins 1, Françoise Van Bambeke 4, Hector Rodriguez-Villalobos 1
  • 1 Cliniques Universitaires Saint Luc-UCL
  • 2 Intitut national de Santé Publique
  • 3 Laboratoire Hospitaliere Universitaire de Bruxelles LHUB
  • 4 Louvain Drug Reseach Institute
Objectives: Biofilm production (BP) on implanted biomaterials and/or host surfaces is recognised as one of the most important virulence factors of Candida spp. and is associated with increased resistance to antifungal agents. There is however, a lack of data concerning the Candida spp. BP on different clinical sources. We analysed the BP by clinical isolates of yeast isolated from different infection sites.
Methods & Materials: A total of 122 yeast (106 clinical isolates) including 18 spp. were analysed for BP. Clinical isolates included 74 C. albicans and 32 non-albicans yeast (C. glabrata, C. tropicalis, C. lusitaniae, C. kefyr, C. melibiosica, C. dubliniensis, C. parapsilosis, C. intermedia, C. norvengensis, C. krusei, C. fabiani, Exophiala dermatidis, Cryptococcus neoformans and Saccharomyces cerevisiae). Strains were isolated from candidemias (n = 21), vaginosis (n = 21), urinary tract infections (n = 9), gastric infections (n = 2), respiratory tract including Cystic fibrosis (CF) patients (n = 50) and other sites (n = 3). Biofilms were grown in 96-well cell culture microplates in Sabouraud dextrose broth for 48 h and the biofilm biomass was evaluated by crystal violet staining. Results were normalized according to the CFU/mL and compared to C. albicans ATCC 24433, used as reference strain.
Results: All species analysed were biofilms producers. C.tropicalis, C. melibiosica, C. fabiani, C. krusei, C. parapsilosis showed 2–3 times higher bivomass level compared to reference strain. Among clinical isolates, 65% showed BP (58% of C. albicans and 75% of Candida non-albicans). Considering the clinical origin, 57% of Candida spp. isolated from candidemia, 45% of Candida spp. from urinary tract infections, 61% of Candida spp. from vaginosis, 62% Candida spp. from respiratory tract and 100% Exophiala dermatidis from CF patients were able to produce biofilm. Non-Significant differences on BP were noted among C. albicans isolates based on the infection site.
Conclusions: Our data showed that all tested species of yeast were biofilm producers including C. melibiosica, C. palmioleophila, C. valida, Metschnikowua pulcherrima, Kluveyromyces lactis, C. sorbosa and C. pararugosa (non-previously described). The majority of clinical isolates are biofilm producers. However significant differences in biofilm biomass were observed according to the species. Our data suggest an adaptation of some fungal species (Exophiala spp.) to clinical environment particularly in respiratory tract to cystic fibrosis patients, providing a sanctuary to the biofilm growth.

P031 Antifungal Tolerance on Mono and Dual-Species Biofilm

Ouassila Bekkal Brikci-Benhabib 1, Zahia Boucherit-Otmani 2 and Kebir Boucherit 2
  • 1 University Of Ain Temouchent
  • 2 Laboratory Antibiotics Antifungals: Physico-chimical, Synthesis and Biological Activities, University of Tlemcen, Algeria
Introduction: Infections associated with vascular catheters have seen their incidence increase over the last decade because of their insertion which has become a systematic gesture at least on an interim basis. These vascular catheters provide a support for the adhesion of several microorganisms, in particular the yeasts Candida. The latter are capable of forming mono or multi-species biofilms, which originate from a high tolerance to clinically used antifungal agents.
It is in this context that our study aims to investigate the rate of mono or multi-species fungal alterations of peripheral venous catheters and to test their sensitivity to amphotericin B and Caspofungin in the planktonic state and also in biofilm mode.
Materiel and methods: The isolated strains were identified by phenotypic and genotypic methods and were analyzed to determine their minimal concentrations inhibiting their growth in planktonic and biofilms forms using amphotericin B and caspofungin.
Results: The results obtained showed that 12.10% of all catheters collected were by Candida sp. and 2.73% of catheters were contamined by Saccharomyces cerevisiae, Cryptococcus neoformans, Trichosporon asahii.
The mono-species alteration of the catheters is greater than that of the dual-species with a frequency of 79 and 21% respectively. Mixed combination isolated isolated on catheters is Candida albicans/Candida glabrata and Candida parapsilosis/Trichosporon.
All isolated strains in planctonic form were susceptible to amphotericin B with Minimum Inhibitory Concentrations (MIC) ranging from 0.03 to 1 mg/mL. MIC obtained with caspofungin vary from 0.06 to 1 μg/mL. In contrast, sessile cells of yeast mono and dual-species biofilms formed ranging from 0.25 to 8 μg/mL for amphotericin B and caspofungin ranges from 0.5 to 16 μg/mL.
Conclusions: Sessile Minimum Inhibitory Concentrations (SMIC) of Candida sp. and other yeast isolates in their mono and dual-species biofilms are up to 32 times greater than MICs for amphotericin B and 64 times for caspofungin.

P032 Quantitative Analysis of In Vitro Biofilm Formation by Clinical Isolates of Dermatophyte and Anti-Biofilm Activity of Common Antifungal Drugs

Marjan Motamedi and Forozan Sasanipoor
Department of Medical Parasitology and Mycology, School of Medicine, Shiraz University of Medical Sciences
Objectives: Over the past decades, many pathogenic fungi, such as bacteria, have been shown to have the ability to form biofilms, and biofilm formation is an important virulence factor for fungi. The aim of this study was to investigate the ability of biofilm formation by clinical dermatophyte isolates from different parts of the body, inhibition of biofilm formation by common anti-dermatophyte drugs, and finally accurate identification of isolates by sequencing.
Materials and Methods: The study population consisted of 50 dermatophyte isolates that were collected from 2019 to 2020 from patients referred to the two mycology laboratory of Shiraz, Iran. The isolates were identified by ITS gene region sequencing. The suspension (equivalent to 0.5 McFarland) of the isolates was used to evaluate the ability of the isolates to form biofilms and also the effect of itraconazole, terbinafine and griseofulvin at concentrations of 2–32 μg/mL on inhibiting biofilm formation. Two optical microscope and a scanning electron microscope were used to study the microscopic structure of biofilms formed on the surface of 96-well plate wells.
Result: The ability of biofilm formation by the isolates was 74% (37 cases). There is a statistically significant relationship between the ability of biofilm formation and the affected organ (p value = 0.029). In species isolated from tinea cruis and tinea unguim, we see 86.6% and 80% of biofilm formation ability, respectively. There was no statistically significant relationship between different levels of biofilm formation and identified species (p value = 0.32). In terms of the ability biofilm formation, can be said that out of 74% of isolates that had this ability, 22% belong to Trichophyton mentagrophytes, 20% belong to Trichophyton rubrum and the rest (32%), includes other species. Itraconazole and terbinafine in 70% of samples and griseofluvin in 66% have IC50 in concentration <2. The mean concentrations of IC50 in the three drugs itraconazole, terbinafine and griseofluvin are 3.78, 2.42 and 3.18 μg/mL, respectively. Spearman correlation coefficient between griseofulvin and biofilm formation ability is closer to one number. This relationship indicates that isolates with higher biofilm formation ability at higher concentrations of the drug have IC 50. Observation of the biofilm structure by optical microscope showed extensive mycelial growth with lateral hyphae surrounded by a polysaccharide-rich extracellular matrix in some parts of the plate surface, which is characteristic of biofilm formation. A highly focused scanning electron microscope provided three-dimensional images of biofilms at the plate surface, allowing better evaluation of fungal structures (Figures 1 and 2).
Conclusions: Almost all common dermatophyt species studied in this study were able to produce biofilms in vitro, which can play an important role in the pathogenesis of dermatophyte and failure to treat dermatophytosis infections. Terbinafine with favourable antibiofilm activity can be considered as the first option for the treatment of dermatophytosis. Further research to identify the biofilm ability of other dermatophyte species and to better understand the biofilm inhibitory activity of other antifungal drugs could provide new insights into the successful treatment of dermatophytosis infection.

P033 Quantification of Biofilm Formation by Candida auris Isolates in a Tertiary Care Centre in South India

Mary Kiran Danni 1, J Jayalakshmi 2, M K Renuka 1 and Anupma Jyoti Kindo 1
  • 1 Sri Ramachandra Institute Of Higher Education And Research
  • 2 KMCH Institute of Health Sciences and Research
Objectives: The aim of this study is to quantify biofilm formation by Candida auris strains isolated from a tertiary care centre in South India.
Materials & Methods: 30 isolates of Candida auris were obtained from different patients from various samples like blood, urine and pus. The isolates were identified as Candida auris by MALDI TOF MS and further confirmed by colony PCR.
The strains will be grown on Sabourauds Dextrose Agar at 37 degree Celcius, over 24 h. The growth will be transferred in 0.85% saline matching the density of 0.5% MacFarland nephelometer standard tube no. 3, to get a concentration of 107 yeast cells/mL. Then this solution will be diluted in Sabourauds Dextrose broth at a ratio of 1:20. 100 µL of this suspension will be incubated at 37 °C overnight in a sterile, polystyrene 96 well microtiter flat bottom plate, for production of biofilm.
After attachment phase, the non-adhered cells will be washed using Phosphate Buffered Saline. 200 µL of freshly prepared Yeast Nitrogen Broth will be added to each well, to facilitate biofilm formation. After 24 h incubation at 37 °C, XTT Reduction Assay will be performed. Negative control will be a well containing test medium alone without yeast cells. Reference strains will be included.
The biofilms will be washed with 200 microlitre of PBS to remove the adherent cells. Freshly prepared XTT- Menadione solution, mixed at a volume of 20:1 (42 µL) will be transferred to the wells along with PBS (158 microliter). The plates will be covered and incubated in the dark at 37 °C for 3 h.
100 µL of this solution will transferred to new 96 well microtiter plate and the colorimetric changes will be measured using microtiter plate ELISA reader.
Results: Receipt of some of the materials needed for the study have been delayed due to the pandemic. Hence results awaited.
Conclusions: The XTT reduction assay will be useful in measuring the metabolic activity of biofilm produced by different isolates of Candida auris.

P040 Evaluation of 11 DNA Automated Extraction Protocols for the Detection of the 5 Mains Candida species from Artificially Spiked Blood

Estelle Menu 1,2, Jordi Landier 3, Elsa Prudent 2, Stéphane Ranque 1,2 and Coralie L’Ollivier 1,2
  • 1 Aix Marseille Univ, IRD, AP-HM, SSA, VITROME
  • 2 Laboratoire Hospitalo-Universitaire de Parasitologie-Mycologie, IHU Méditerranée Infection
  • 3 SESSTIM, IRD, INSERM, Aix Marseille Université
Objectives: Molecular detection of Candida plays an important role in the diagnosis of candidemia, a major cause of morbidity and mortality. Sensitivity of this diagnosis is partly related to the efficiency of yeast DNA extraction. Candidemia diagnosis is often incorporated in a syndromic approach of bloodstream infection diagnosis. Therefore, it is essential to evaluate automated DNA extraction methods likely to be shared to detect the main agents of blood infections.
Materials & Methods: In this monocentric study, we investigated the suitability of eleven recent automated procedures for the extraction of Candida DNA from artificially spiked blood. Eight concentrations of artificially spiked blood were tested: 0 CFU/mL, 10 CFU/mL, 50 CFU/mL, 102 CFU/mL, 103 CFU/mL, 104 CFU/mL, 106 CFU/mL and 108 CFU/mL. We also compared the performance of these extraction protocols to detect the five main species implicated in candidemia: Candida albicans. Candida glabrata complex, Candida parapsilosis, Candida tropicalis and Candida krusei.
Results: The efficacy of the DNA extraction procedures to detect up to 10 CFU/mL of Candida spp. in blood samples ranged from 31.4% to 80.6%. The NucliSENSTM easyMAGTM procedure was the most efficient, for each species and each inoculum. Notably, it significantly outperformed the other procedures at the lower Candida inocula mimicking the clinical setting. Moreover, this study highlighted a heterogeneity in DNA extraction efficacy between Candida species. Up to five automated procedures were adequate for the DNA extraction of Candida krusei, whereas only one method yielded an adequate detection of low amount of Candida tropicalis.
Conclusions: This evaluation of 11 commercially available automated DNA extraction methods for the PCR diagnosis of candidemia, put within reach of laboratories about the choice of an appropriate methods in routine diagnosis. The NucliSENSTM easyMAGTM procedure displayed the best performances for detecting, even low concentration, of the five main Candida species DNA in whole blood, which complies with the requirement of the current syndromic diagnosis of bloodstream infections.

P041 Longitudinal Evaluation of Plasma Cytokine Levels in Patients with Invasive Candidiasis

Stefanie Wunsch 1,2, Christoph Zurl 1,2,3, Heimo Strohmaier 4, Andreas Meinitzer 5, Jasmin Rabensteiner 5, Wilfried Posch 6, Cornelia Lass-Flörl 6, Oliver Cornely 7,8,9, Gudrun Pregartner 10, Elisabeth König 1, Gebhard Feierl 11, Martin Hoenigl 1,12, Juergen Prattes 1,2, Ines Zollner-Schwetz 1, Thomas Valentin 1 and Robert Krause 1,2
  • 1 Division Of Infectious Diseases And Tropical Medicine, Department of Internal Medicine, Medical University of Graz
  • 2 BioTechMed-Graz
  • 3 Department of Paediatrics and Adolescent Medicine, Division of General Paediatrics, Medical University of Graz
  • 4 Center for Medical Research, Medical University of Graz
  • 5 Clinical Institute of Medical and Chemical Laboratory Diagnostics, Medical University of Graz
  • 6 Institute of Hygiene and Medical Microbiology, Medical University of Innsbruck
  • 7 Excellence Center for Medical Mycology (ECMM), Department I of Internal Medicine, Faculty of Medicine and University Hospital Cologne, University of Cologne
  • 8 Chair Translational Research, Cologne Excellence Cluster on Cellular Stress Responses in Aging-Associated Diseases (CECAD), Faculty of Medicine and University Hospital Cologne, University of Cologne
  • 9 Clinical Trials Centre Cologne (ZKS Köln), Faculty of Medicine and University Hospital Cologne, University of Cologne
  • 10 Institute for Medical Informatics, Statistics and Documentation, Medical University of Graz
  • 11 Diagnostic & Research Institute of Hygiene, Microbiology and Environmental Medicine, Medical University of Graz
  • 12 Division of Infectious Diseases and Global Public Health, Department of Medicine, University of California San Diego
Objectives: Interleukin (IL) 17A plays a decisive role in anti-Candida host defense. Previous data demonstrated significantly increased and time-dependent IL-17A values in candidemic patients compared to non-candidemic patients. The objective of the present study was the evaluation of IL-17A plasma levels and other cytokines involved in anti-Candida host defense as potential biomarkers for early anticipation of invasive Candida infection.
Materials & Methods: We evaluated levels and time courses of IL-17A, kynurenine, tryptophan, and other cytokines suggested to be involved in Candida-specific immunity (IL-6, IL-8, IL-10, IL-17F, IL-22, IL-23, interferon-γ, tumor necrosis factor-α, Pentraxin-related protein 3, transforming growth factor-β) in patients with invasive candidiasis (IC (other), IC (true)) compared to bacteremic patients (Staphylococcus aureus. Escherichia coli) and healthy controls (from previous 4 days up to day 14 relative to the index culture (−4; 14)). Statistical analyses were performed for the total study population (main analysis), as well as without immunocompromised patients or patients with hematologic malignancies (sensitivity analysis).
Results: IL-17A levels were significantly elevated in all patient groups compared to healthy controls (Figure 1). In patients with IC, the highest IL-17A values were measured around the date of index sampling (−1; 2) [median 8.8, IQR 5.4–17.3 pg/mL], compared to significantly lower levels prior and after sampling the index culture. Candidemic patients showed significantly higher IL-17A values compared to IC (other) at time interval (−1; 2) and (3; 7). No significant differences in IL-17A levels could be observed for IC patients compared to bacteremic patients. Interestingly, levels of TGF-β were shown to be significantly elevated in patients with IC (other) compared to bacteremic patients for time intervals (−1; 2), (3; 7) and (8; 14). In contrast, patients with true candidemia only presented significantly elevated TGF-β values when compared to patients with E. coli bacteremia [for time intervals (−4; −2), (−1; 2) and (3; 7)], but not S. aureus bacteremia. However, exclusion of immunocompromised patients and patients with hematologic malignancies (sensitivity analysis) resulted in significant differences of TGF-β levels between IC (true) and bacteremic patients (both S. aureus and E. coli) for time intervals (−4; −2), (−1; 2) and (3; 7), with significantly higher values in candidemic patients.
Conclusions: We did not observe a discriminative competence between fungal and bacterial infections for both IL-17A and kynurenine in this study. Following this, IL-17A may be valuable as a biomarker for either fungal or bacterial blood stream infection rather than solely for invasive Candida infection. Further, we detected significantly elevated TGF-β levels in patients with IC compared to bacteremic patients, proposing a potential significance of TGF-β for differentiation between bacterial and Candida infections. However, larger studies are warranted to investigate this association.
Jof 07 00916 i003
Figure 1. Boxplots of interleukin 17A (IL-17A) values of the investigated study groups for each time interval (A), and with focus on time interval (−1; 2) (B) for the total study population. IL-17A values (pg/mL) are depicted on the logarithmic scale. In the boxplots, median values are depicted as bold line and the box spans from first to third quartile; whiskers extend to a maximum of 1.5 times the interquartile range (IQR, third minus first quartile) out from the respective box end; all remaining values are indicated as dots. Time intervals represent study days. Time interval (−1; 2) includes blood samples collected one day prior until up to two days after collection of the index sample. IC = invasive candidiasis. IC (true) = patients with true candidemia. IC (other) = patients with candidemia of unclear significance (positive blood cultures from central veins only), proven IC other than candidemia, and patients with probable and possible IC. S. aureus = patients with S. aureus bacteremia. E. coli = patients with E. coli bacteremia.

P042 Development and Application of an Intercalating Dye-Based PCR for the Diagnosis of Mucormycosis

Juliette Guitard 1, Alexandre Godmer 2,3, Jeanne Bigot 1, Sandra Vellaissamy 4, Sophie Thorez 4 and Christophe Hennequin 1
  • 1 Sorbonne Université, Inserm, Centre de Recherche Saint-Antoine, CRSA, AP-HP, Hôpital Saint-Antoine, Service de Parasitologie-Mycologie
  • 2 Sorbonne-Université, Hôpital Saint-Antoine, Département de Bactériologie
  • 3 Sorbonne Université, INSERM, U1135, Centre d’Immunologie et des Maladies Infectieuses, Cimi-Paris
  • 4 APHP, Hôpital St. Antoine, Laboratoire de Parasitologie Mycologie
Objectives: Early and specific diagnosis is crucial to manage the therapeutic strategy of mucormycosis. The sensitivity of conventional diagnosis is limited and no fungal biomarker is currently available. Thus, molecular DNA detection appears as the most promising approach for this diagnosis. This study aimed to assess an in-house pan-Mucorales real-time PCR to detect a wide variety of Mucorales species.
Materials & Methods: The method relies on the optimization of the primers sequence and the use of a fluorescent intercalating dye in a PCR targeting the rDNA operon. Analytical performances were assessed using 17 Mucorales strains (8 genera, 11 species) and 17 non-Mucorales strains (5 genera, 10 species). Technical challenges were realized with an external quality control program and 23 sera drawn from at-risk patients with a definitive diagnosis of proven mucormycosis. A clinical evaluation of the method was performed after its routine use for a 24-month period.
Results: Analytical assessment showed a 100% sensitivity and specificity. The limit of quantification ranged between 28 and 218 fg/µL depending on the species tested. Results obtained with the external quality control program and with the 23 sera drawn from at-risk patients with a definitive diagnosis of proven mucormycosis were 100% concordant.
364 clinical specimens from 166 at-risk patients were tested. According to EORTC classification (without taking into account the PCR results), 1 patient presented a proven mold infection of unknown origin, 6 and 1 patients presented a proven and a probable mucormycosis, respectively. 126 patients presented a possible mucormycosis, among them 119 presented an alternative diagnosis to explain clinical signs, and 7 had no alternative diagnosis.
A PCR test was positive for 22 specimens from 11 patients with 7 proven/probable mucormycosis, 1 proven mold invasive infection and 3 possible mold invasive infections. Considering only probable and proven mold infection, both clinical sensitivity and specificity were calculated at 1. Considering the 7 possible mucormycosis infection with no alternative diagnosis, sensitivity and specificity were calculated at 73.3% (IC95: 48.1% to 89.1%) and 100% (IC95: 97.5% to 100%), respectively.
Furthermore, among the 10 patients with proven/probable Mucormycosis and tested for Mucorales qPCR on serum, only 2 had a positive result. Both had a positive direct examination in biopsy specimens and died 11 and 19 days with an uncontrolled mucormycosis infection. Among the 8 patients with negative serum qPCR, 4 survived, and 3 died with a controlled mucormycosis infection.
Conclusions: This in-house real-time PCR represents a fast and reliable adjunctive tool for the diagnosis of mucormycosis.

P043 Serum (1,3)-β-D-Glucan Cannot Reliably Exclude Pneumocystis Pneumonia in Patients with Hematological Malignancies

Yohann Le Govic 1,2, Baptiste Demey 1,2, Cécile Pauc 1, Céline Damiani 1,2 and Anne Totet 1,2
  • 1 Laboratoire de Parasitologie-Mycologie, Centre de Biologie Humaine, CHU Amiens-Picardie
  • 2 Agents Infectieux, Résistance et Chimiothérapie (AGIR), UR 4294, Université de Picardie Jules Verne
Objectives: Pneumocystis pneumonia (PCP) is a potentially life-threatening respiratory infection caused by the fungus Pneumocystis jirovecii. Accurately diagnosing PCP remains challenging, especially in HIV-negative patients who usually harbor lower pulmonary fungal loads than HIV-positive individuals. Given the invasiveness of the procedure employed for respiratory sampling and the expertise needed for interpreting P. jirovecii detection in the airways, there is a growing interest in using serum (1,3)-β-D-glucan (BG) assay as a screening test in the flowchart to diagnose PCP. Because of its high sensitivity, several studies have suggested that a negative result is sufficient for ruling out PCP. However, other reports indicated that BG testing has a limited sensitivity in HIV-negative PCP patients. The main objective of this study was to clarify the usefulness of serum BG as a tool to exclude PCP diagnosis in diverse HIV-negative patient populations. We also investigated the correlation between P. jirovecii burden in respiratory samples and serum BG levels.
Materials & Methods: We conducted a 10-year, monocentric retrospective study, of all HIV-negative adult patients with microscopically proven PCP and for whom a BG result was available. Serum BG levels (expressed in pg/mL) were measured using the commercialized Fungitell® assay (Associates of Cape Cod, Inc.). Pulmonary fungal loads (expressed in Ct) were determined by an in-house real-time polymerase chain reaction.
Results: A total of 39 HIV-negative patients were enrolled in the study. Of them, 11 (28.2%) presented with hematological malignancies (HM group). Among the 28 (71.8%) remaining patients without HM (non-HM group), the most common underlying condition for the development of PCP was solid organ transplantation (n = 16, 41%), followed by systemic disorders (n = 9, 23.1%) and cancers (n = 3, 7.7%). Overall, 34 patients tested positive for BG [sensitivity: 0.87 (95% CI: 0.73–0.94)]. This result is in line with previous publications that have studied BG as a diagnostic marker for PCP in HIV-negative individuals. Nevertheless, performances of this test were significantly different between the two patient groups, with a positivity rate of 7/11 [sensitivity: 0.63 (95% CI: 0.35–0.84)] in HM vs. 27/28 [sensitivity: 0.96 (95% CI: 0.82–0.99)] in non-HM (p = 0.017, Fisher’s exact test). Moreover, BG levels were significantly different between these two groups with a median titer of 211 pg/mL [IQR 1489] in HM vs. 3425 pg/mL [IQR 1891] in non-HM (p < 10−3, Mann-Whitney test). The fungal load was also significantly lower in the HM group with a mean Ct of 27.1 [range 19–34] vs. 21.8 [range 15–30] in non-HM patients (p < 10−3, Student’s test). Besides, serum BG level and fungal burden correlated poorly in all 39 patients, regardless of the underlying disease (Spearman’s correlation coefficient p = −0.37, p = 0.018).
Conclusions: For HIV-negative patients, the sensitivity of BG assay varies substantially according to the underlying condition predisposing to PCP. Especially, a negative result alone is not sufficient to eliminate a PCP diagnosis in HIV-uninfected patients with HM. Altogether, BG results must be interpreted carefully and need to take into consideration the various PCP risk factors.

P044 The Life and Death of Identification Methods in Mycology

Sybren De Hoog, Sarah Ahmed, Abdullah Al-Hatmi and Roxana G. Vitale
Radboud UMC
The high mortality and morbidity associated with fungal infections necessitate the use of accurate and fast diagnostic assays to facilitate appropriate antifungal treatment. The incidence and the spectrum of these infections have dramatically increased during the past decades, mainly due to growing populations at risk. Despite tremendous developments in available technologies, routine diagnostics has largely remained unchanged. Histology and direct microscopic observation of fungal elements are as still the basis for detection of prevalent species. Molecular identification tools such as isothermal amplification assays are applicable for limited species groups. Numerous techniques are available, but few have found wide application. Advances have been implemented with real-time PCR and Maldi-Tof, and some serological and lateral flow assays adapted for a limited number of diseases. For identification of less common opportunists, sequencing of ribosomal genes has received wide application, particularly identification of the plethora of filamentous fungi received great benefit from modern technology. A novel problem is multilocus phylogenetic taxonomy, which is driven close to the limit of detection while no diagnostic parameters are made available. Molecular methods require regular updating with curated databases. This also holds true for Maldi-Tof, which is already successfully applied in yeasts where barcoding gaps between species tend to be larger. An innovative general protein-based method, high-resolution accurate-mass spectrometry is promising but needs large-scale practical testing. The continuous increase in the number of clinically relevant fungi poses a great challenge for the development of a broad-spectrum identification: the list of 720 species treated in the 4th edition of the Atlas of Clinical Fungi grows with about 30–40 species each year.

P045 Biomarkers of Inflammation in Patients with Asthma with Aspergillus spp. Sensitization

Yana Kozlova, Ekaterina Frolova, Larisa Filippova, Aleksandra Uchevatkina, Oleg Aak, Ekaterina Burygina, Galina Solovjeva, Natalya Vasilyeva and Nikolay Klimko
North-Western State Medical University named after I.I. Mechnikov
Background: Exposure to Aspergillus spp. is considered an important risk factor for the development of severe asthma. Study of new immunological serum markers of asthma patients with Aspergillus sensitization will expand diagnostic capabilities and improve disease control.
Objectives: To assess the levels of conventional and additional markers of inflammation and to determine the features of immune response regulation in asthma patients with Aspergillus sensitization.
Methods and Materials: The study included 36 asthma patients with Aspergillus sensitization (Me age—49 ± 14 years), 57 asthma patients without Aspergillus sensitization (Me age—50 ± 15 years), and 25 patients with allergic bronchopulmonary aspergillosis (ABPA) (Me age—45 ± 16 years). ABPA diagnosis was made according R. Agarwal et al., (2013) criteria. The control group consisted of 30 healthy people, (Me age 45 ± 6 years). Levels of thymic stromal lymphopoietin (TSLP), thymus and activation-regulated chemokine (TARC), IL-8, number of eosinophils, levels of total IgE and specific IgE to A. fumigates were determined in the serum by enzyme immunoassays.
Results: In asthma patients with Aspergillus sensitization median values of total IgE and Aspergillus sIgE were 700.0 [200.0; 792.0] and 0.9 [0.55; 1.27] IU/mL, which are significantly higher than in asthma patients without Aspergillus sensitization (p = 0.0008 and p = 0.0001). The absolute number of eosinophils in asthma patients with Aspergillus sensitization was higher than in the control group (p = 0.000), and asthma patients without Aspergillus sensitization (0.35 [0.16; 0.53] 109/L vs. 0.29 [0.18; 0.48] 109/L; p = 0.34). The highest rates compared to all other groups were ABPA patients (p < 0.05). The levels of total IgE and Aspergillus sIgE were 1950.0 [1150.0; 2950.0] IU/mL and 2.20 [1.15; 7.13] IU/mL respectively, the absolute number of eosinophils was 0.52 [0.40; 0.96] 109/L.
The concentration of TSLP in the serum of the examined groups did not differ. Significant differences in the TARC levels were found in ABPA patients (718.0 [610.0; 907.0] pg/mg) in comparison with the asthma patients with Aspergillus sensitization (510.0 [333.0; 874.5] pg/mg, p = 0.03) and asthma patients without Aspergillus sensitization (202.5 [195.9; 256.0] pg/mg). The maximum concentration of periostin in the blood serum was recorded in patients with ABPA—31.89 [30.15; 40.87] ng/mL and was higher than in the asthma patients group (p = 0.0001) and the control group (p = 0.0000).
A positive correlation was found between the Aspergillus sIgE level with content of TARC, periostin and the number of eosinophils, and total IgE level (p < 0.001). A negative correlation was found between the levels of TARC and periostin and FEV1 index (p < 0.001).
Conclusions: The increased levels of TARC and periostin, along with conventional biomarkers of eosinophilic inflammation, indicates activation of the Th2 type of immune response in asthma patients with Aspergillus sensitization.

P046 Development of a Real-Time PCR Assay to Identify Cryptococcus neoformans and Cryptococcus gattii Species Complexes

Enoch Tay 1,2, Sharon Chen 1, Wendy Green 1, Ronald Lopez 1 and Catriona Halliday 1
  • 1 Centre For Infectious Diseases and Microbiology Laboratory Services, New South Wales Health Pathology
  • 2 Research Education Network, Western Sydney Local Health District
Objectives: Cryptococcus neoformans and Cryptococcus gattii are the principle causative agents of cryptococcosis. Differences in epidemiological and treatment approaches emphasize the importance of distinguishing between the two species complexes. Whilst culture, histopathology and cryptococcal antigen (CRAG) detection are sensitive and simple, molecular methods are potentially more rapid; however, commercial PCR assays do not distinguish between the species complexes. Here we developed a real-time PCR assay to detect and identify C. neoformans and C. gattii directly from clinical specimens.
Materials & Methods: We targeted the mitochondrial Cytochome B (CytB) gene, as it is multicopy with sufficient homology to detect both C. neoformans and C. gattii using a single primer pair, yet has sufficient variation to differentiate between the two species complexes by melt curve analysis. The assay was first tested on the eight major cryptococcal molecular types (VNI-IV and VGI-IV). The assay performance was then evaluated using 197 specimens (fresh, and paraffin-embedded tissue (FFPE), cerebral spinal fluid (CSF), induced sputum (IS), bronchoalveolar lavage (BAL) fluid and fine needle aspirates (FNAs)) from patients with cryptococcosis (n = 48) or alternate respiratory tract infections. Assay performance was compared with culture and other methods including panfungal (ITS-directed) PCR.
Results: The CytB-directed assay detected all 8 C.neoformans/C. gattii genotypes (limit of detection ~101 CFU/mL); there was no cross-reactivity with other respiratory pathogens. High resolution melt curve analysis demonstrated C. neoformans (VNI-VNIV) and C. gattii (VGI-VGIV) isolates had a melting point of 81 °C and 79 °C, respectively. Of 197 specimens, 46 tested positive for either C. neoformans (n = 31) or C. gattii (n = 15) (Table 1). PCR-negative specimens (n = 151) encompassed a range of specimens including IS and BAL submitted for Pneumocystis jirovecii infection. The assay sensitivity (95.8%) compares favorably with other diagnostic tests with only 2 specimens (one FFPE and CSF) from patients with cryptococcosis testing PCR-negative. Notably, the PCR (turn-around-time 4 h) enabled diagnosis and species identification in all 17 FFPE tissue samples vs. histology (13/17) and culture (0/17); panfungal PCR achieved diagnosis in 16/17 cases (turn-around-time-time ~72 h).
Table 1. Results of Cryptococcus-specific PCR compared with other diagnostic modalities.
Specimen TypeNumberCulture PositiveCryptococal AntigenHistologyPanfungal PCRTargeted PCR
C. neoformans
Targeted PCR C. gattii
FFPE Tissue17N/AN/A1316152
CSF1223N/A1066
BAL63N/AN/A324
FNA62N/AN/A533
IS30N/AN/A030
Not Specified21N/AN/A220
TOTAL468313373115
Conclusions: The Cryptococcus-specific PCR assay is a rapid (4 h) sensitive method for detecting and differentiating C. neoformans and C. gattii species complexes in clincial samples. The assay is compatible with use on non-sterile specimens which often contain other fungal flora.

P047 Diagnosis of Invasive Fusariosis by Detecting Circulating DNA: Retrospective Analysis of 10 Proven Cases

Sarah Dellière 1, Marcela Sabou 2, Cécile Angebault 3, Majorie Cornu 4, Samia Hamane 1, Marie-Elisabeth Bougnoux 5, Juliette Guitard 6, Françoise Botterel 3, Stéphane Bretagne 1 and Alexandre Alanio 1
  • 1 Hôpital Saint-Louis
  • 2 Centre Hospitalo-Universitaire de Strasbourg
  • 3 Hôpital Henri-Mondor
  • 4 Centre Hospitalo-Universitaire de Lille
  • 5 Hôpital Necker
  • 6 Hôpital Saint-Antoine
Objectives: Fusarium spp. are plant pathogens and opportunistic pathogen in severely immunocompromised (haematological malignancy, neutropenia, solid organ transplantation, …) and severely burned patients. Invasive fusariose often disseminates and mortality remains high partly due to delayed diagnosis in the absence of a positive culture. The aim of our study is to evaluate the detection of circulating Fusarium spp. DNA by quantitative PCR (qPCR) for early diagnosis of invasive infection.
Materials & Methods: This is a multicentric (6 centers) retrospective study that evaluates an in-house qPCR designed and optimised to identify all Fusarium specie complex in serum or plasma. A total of 10 patients diagnosed with proven fusariosis according to EORTC/MSGERC criteria between 2015 and 2021 were included. Patients with other invasive fungal diseases (aspergillosis, n = 4; mucormycosis, n = 4 and candidemia, n = 3) or without invasive fungal disease (IFD) (n = 10) were included as controls.
Results: No crossed-reactions were detected using DNA were detected using DNA extract from 81 opportunistic fungi. All Fusarium strains from five specie complexes (i.e., complex oxysporum, solani, fujikuroi, dimerum, incarnatum) known to be implicated in invasive fungal disease were detected. Limit of detection was evaluated to 3.2–32 femtogram/µL depending on the species. Circulating DNA was detected in 9 patients out of 10. Detection was possible up to 12 days (mediane = −5 [−12;7]) before the diagnosis was confirmed by positive blood culture or biopsy. Available biopsy (n = 2) of subcutaneous nodules from disseminated fusariosis allowed the amplification of Fusarium spp. with the qPCR. In two patients with follow up specimens, qPCR was still positive at day 3 and day 8 after introduction of voriconazole, respectively. Circulating DNA could not be detected in a patient with invasive fusariosis due to Fusarium verticilloides but no serum from the exact day of positive blood culture was available. However, extracted DNA from the strain isolated could be amplified and no mismatch was identified by sequencing the target. For specificity, qPCR was negative for all other IFD tested and IFD-free control patients.
Conclusions: We developed and validated a panFusarium qPCR assay in serum/plasma with a sensitivity and specificity of 90 and 100%, respectively. Considering the retrospective nature of this study using suboptimal quantity of stored serum/plasma leftovers, sensitivity is probably underestimated and will be further evaluated with a prospective study in the futur. Similarly to Mucorales qPCR, detection of circulating Fusarium DNA seems to be a non-invasive, sensitive and specific tool that could facilitates early diagnosis and treatment monitoring of invasive fusariosis.

P048 Usefulness of BD BACTEC Mycosis IC/F Vials in the Diagnosis and Monitoring of Fungemia

Laetitia Laroche 1, Victor Mercier 1,2 and Milène Sasso 1,2
  • 1 CHU Nîmes, Laboratoire Microbiologie
  • 2 MIVEGEC, Univ Montpellier, CNRS, IRD
Objectives: The objective of this study was to determine the usefulness of the BD BACTEC Mycosis IC/F vial (Becton Dickinson) in the diagnosis and monitoring of fungemia.
Materials & Methods: A retrospective study of all fungemias detected by BD BACTEC Mycosis IC/F vials and/or BACTEC™ Plus Aerobic and BD BACTEC™ Lytic Anaerobic vials was conducted between 2013 and 2020.The type of vials used with the time of positivity, the fungal species involved and the presence of an antifungal treatment were collected.
Results: Between 2013 and 2020, 275 fungemias were diagnosed with BACTEC™ Plus Aerobic/BD BACTEC™ Lytic Anaerobic and/or BD BACTEC Mycosis IC/F blood culture bottles.In these cases, 95.6% were candidemias, with Candida albicans isolated in the majority (50.9%). For 20.7% of fungemic patients (57/275), one or more BD BACTEC Mycosis IC/F vials were collected, for a total of 78 vials over this period. Fungemia was diagnosed in 42 patients with the BD BACTEC Mycosis IC/F vial (alone or in combination) and in 15 patients only with the BACTEC™ Plus Aerobic and/or BD BACTEC™ Lytic Anaerobic vials.
From the 78 BD BACTEC Mycosis IC/F vials, 56 were collected simultaneously with the BACTEC™ Plus Aerobic and BD BACTEC™ Lytic Anaerobic vials.
In 44.6% of cases (25/56), all vials collected simultaneously were positive for yeast.In these cases, the time to positivity was favorable to the use of the BD BACTEC Mycosis IC/F vial for the initial diagnosis of fungemia (without antifungal treatment), with a mean time to positivity of 12.2 h less (32.0 h vs. 44.2 h).However, for fungemia monitoring or in case of antifungal treatment, the BACTEC™ Plus Aerobic and BD BACTEC™ Lytic Anaerobic vials showed better sensitivity, indeed they were found to be positive a mean of 55.7 h before the BD BACTEC Mycosis IC/F vials (33.7 h vs. 89.4 h).
In 30.4% of cases (17/56), the BD BACTEC Mycosis IC/F vial was negative with BACTEC™ Plus Aerobic and BD BACTEC™ Lytic Anaerobic vials positive for yeast.Fifteen of these 17 vials were collected under antifungal treatment.
In 25% of cases (14/39), only the BD BACTEC Mycosis IC/F vial was positive for yeast, with the BACTEC™ Plus Aerobic and BD BACTEC™ Lytic Anaerobic vials either negative (n = 5) or positive for bacteria (n = 9).
Conclusions: This study demonstrated the usefulness of using BD BACTEC Mycosis vials for the diagnosis of fungemia by providing earlier diagnosis compared to BACTEC™ Plus Aerobic and BD BACTEC™ Lytic Anaerobic vials. However, for patients on antifungal therapy, the BACTEC™ Plus Aerobic and BD BACTEC™ Lytic Anaerobic vials are most appropriate.In addition, some fungemia were detected either only on the BD BACTEC Mycosis IC/F vial or only on the BACTEC™ Plus Aerobic/BD BACTEC™ Lytic Anaerobic vials showing the interest of the combined use of these types of vials in optimizing fungemia diagnosis.

P049 Prospective Evaluation of the GenMark Dx ePlex® Blood Culture Identification Fungal Pathogen Panel

Jeremy Meeder 1, Derek Moates 1, Stefania Carmona 2, Rachael A. Lee 3, Todd McCarty 3 and Sixto M. Leal, Jr. 1
  • 1 UAB Fungal Reference Laboratory, Department of Pathology, Division of Laboratory Medicine, University of Alabama at Birmingham
  • 2 Department of Medicine, University of Alabama at Birmingham
  • 3 Department of Medicine, Division of Infectious Diseases, University of Alabama at Birmingham
Objectives: The ePlex BCID Fungal Pathogen Panel (FP) utilizes electrowetting technology to detect the most common causes of fungemia (15 targets) in positive blood culture bottles within 90 min. Rapid detection of intrinsic resistance to fluconazole (Candida krusei) or echinocandins (Cryptococus neoformans, C. gattii, Rhodotorula), detection of organisms of public health significance (Candida auris), and rapidly progressive pathogenic molds (Fusarium) enables early optimization of antifungals and infection prevention measures.
Methods & Materials: In this prospective study, we evaluated the performance of the BCID-FP Panel compared to traditional standard of care culture and identification with the BioMerieux Vitek MS Matrix Assisted Laser Desorption Ionization (MALDI) Time of Flight mass spectrometry system. Samples submitted for standard of care testing in BioMerieux BacT/Alert resin FA/FN blood culture bottles on the BacT/Alert VIRTUO automated blood culture system with fungal elements on direct exam (n = 60) were included. These results were also compared against T2Candida® when available within +/− 24 h.
Results: The majority of fungi 58/60 (96.6%) identified by MALDI were represented on the FP, excluding C. pararugosa and C. nivariensis and most tests 56/60 (93.3%; 2 C. albicans, C. lusitaniae, C. parapsilosis) yielded valid results. The FP exhibited a positive percent agreement (PPA) of 54/56 (96.4%) for all samples and 54/54 (100%) for samples with organisms represented on the panel. Traditional culture yielded a single false positive C. lusitaniae. A subset of samples (n = 22) analyzed by both FP and T2 showed a PPA of 22/22 (100%) for the FP and 11/22 (50.0%) for the T2. The T2 yielded two false positive C. albicans/C. tropicalis (A/T) results and 10 false negative results in which both culture and the FP identified 3 C. albicans, 2 C. glabrata, 2 C. krusei, 2 C. parapsilosis, and 1 C. tropicalis. Detection of species intrinsically resistant to echinocandins (2 C. neoformans; 1 without a concurrent + antigen test) or fluconazole (3 C. krusei) represented opportunities for early optimization of antimicrobial therapy in 5/60 (8.3%) of samples.
Conclusions: The BCID-FP Panel provides rapid accurate detection of a broad range of fungal pathogens enabling high quality data driven optimization of antimicrobial therapy.

P050 Prospective Evaluation of Serum Mucorales Quantitative PCR for Diagnosis of Mucormycoses: The Modimucor Study

Laurence Millon 1, Denis Caillot 2, Ana Berceanu 1, Stephane Bretagne 3, Fanny Lanternier 4, Florent Morio 5, Valérie Letscher-Bru 6, Frédéric Dalle 2, Blandine Denis 3, Alexandre Alanio 3, David Boutoille 5, Marie-Elisabeth Bougnoux 4, Françoise Botterel 7, Taieb Chouaki 8, Amandine Charbonnier 8, Florence Ader 9, Damien Dupont 9, Anne-Pauline Bellanger 1, Steffi Rocchi 1, Emeline Scherer 1, Houssein Gbaguidi-Haore 1 and Raoul Herbrecht 6
  • 1 University Hospital of Besançon
  • 2 University Hospital of Dijon
  • 3 Lariboisière Saint-Louis Fernand Widal Hospitals, APHP
  • 4 Necker Enfants Malades Hospital, APHP
  • 5 University Hospital of Nantes
  • 6 Hôpitaux Universitaires de Strasbourg
  • 7 CHU Henri Mondor, AP-HP
  • 8 University Hospital of Amiens
  • 9 Hospices Civils de Lyon
Objectives: Early diagnosis and prompt initiation of specific antifungal treatment is essential to improve the prognosis of Mucormycosis. Our aim was to assess the performance of serum Mucorales quantitative PCR (qPCR) for the early diagnosis of mucormycosis.
Materials & Methods: Patient with clinical suspicion of invasive mold infection (n = 233, including 28 finally classified with mucormycosis) and patients diagnosed with mucormycosis (n = 15) were prospectively enrolled in nine teaching hospitals. Usual radiological and mycological procedures were used to investigate invasive mold infection. Serum were collected twice-a-week for Mucorales qPCR tests targeting Lichtheimia, Rhizomucor and Mucor/Rhizopus. Patients were classified having possible, probable or proven invasive mold infection according to EORTC/MSGERC criteria.
Results: Sensitivity, specificity, positive and negative likelihood ratios were 82.1%, 89.8%, 8.0 and 0.20, respectively. The first Mucorales qPCR-positive serum was observed 4 days in median (IQR, 0–9) before the sampling date of the first mycological or histological positive specimen, and one day in median (IQR, (−2)−6) before the first imaging sign. Negativity of Mucorales qPCR within 7 days after liposomal-amphotericin B initiation was associated with an 85% lower 30-day mortality rate (Adjusted Hazard Ratio = 0.15; 95% CI, 0.03–0.73; p = 0.02).
Conclusions: Serum Mucorales qPCR is a non-invasive technique with great performances that can help to trigger early targeted antifungal treatment. Follow-up of Mucorales DNA load in serum could also be helpful for therapeutic management. Our study argues for the inclusion of qPCR detection of circulating Mucorales DNA in the diagnostic strategy of mucormycosis, and in consensual definitions from EORTC/MSGERC.

P051 YeastOne and Micronaut-AM Antifungal Susceptibility Assays Comparison

Nicolas Pellaton 1, Guy Prod’hom 1, Dominique Sanglard 1, Frederic Lamoth 1,2 and Alix-T. Coste 1
  • 1 Institute of Microbiologie, University Hospital
  • 2 Service of Infectious Disease, University Hospital
Objectives: Fungi infections are an important cause of death worldwide. Antifungal susceptibility testing of yeast pathogens helps clinicians to better adapt patient treatments. One commonly used assay method in diagnosis is Broth microdilution susceptibility testing (BMST). BMST methods and criteria of interpretations are defined by two major consortia: CLSI and EUCAST. In this study, we compared three BMST methods: YeastOne (interpreted with CLSI criteria) read visually and MICRONAUT-AM (interpreted with EUCAST criteria), read visually and by spectrophotometer.
Materials & Methods: As BMST protocols differ following the consortia, Minimal inhibitory concentration (MIC) obtained by CLSI or EUCAST methods could not be compared. Thus, categories based on the number of MIC dilutions around breakpoint or ECOFF/ECV reference values were established to evaluate the accuracy between the 3 methods. Overall, 97 strains from 19 yeast species were measured for 8 antifungal drugs, for a total of 776 observations.
All the Candida albicans, glabrata, lusitaniae and auris strains, were previously analysed for antifungal resistance genes mutations, and were part of pairs or triplets of isogenic strains isolated from a single patient along treatment.
In addition, in order to evaluate repeatability and reproducibility of the MIC measurement, three strains: ATCC 22019 (C. parapsilosis), ATCC 6258 (C. krusei), and SC5314 (C. albicans) were measured 10 consecutive days and 5 times the same day with the three methods.
Results: In a first time, assigning MIC to categories, we realized that only 1/3 of the MIC measured could be assigned using breakpoint. Another 1/3 of the MIC could be assigned using ECOFF/ECV, and unfortunately, 1/3 of the MIC could not be assigned due to lack of criteria in EUCAST and/or CLSI. Overall, only 2/3 of the MIC measurement could be analysed. The accuracy of the categories, between the 3 BMST appeared to be relatively low, showing the difficulty to compare the BMST results.
In a second time, we analysed the results of the C. albicans and C. glabrata strains using the antifungal genes sequences as gold standard. We thus highlighted an already known candins susceptibility interpretation discrepancy between CLSI and EUCAST methods for C. albicans and C. glabrata. We also observed some differences of interpretation and categorization for azoles drug, which might be attributable to consortia differences, but also to reading difficulties due to tolerance phenomenon. However, globally, both methods detect diminution of antifungal susceptibilities, and acquisition of resistance for both candins and azoles, in the pair or triplet of characterized Candida strains.
In a third time, we observed a better reproducibility with Micronaut-AM (read visually or by spectrophotometer) as compared to YeastOne.
Conclusions: This study demonstrated, the valuable use of both type of BMST, essentially for C. albicans and C. glabrata, but highlighted the difficulty to conduct conclusive analyses without antifungal gene sequence data as gold standard.

P052 Serum Lateral Flow Assay with Digital Reader for the Diagnosis of Invasive Pulmonary Aspergillosis: A Two Center Mixed Cohort Study

Matthias Egger 1, Juergen Prattes 1, Jeffrey Jenks 3,4,5, Robert Krause 1, Eduard Schulz 2, Johannes Boyer 1 and Martin Hoenigl 1,3,4
  • 1 Division of Infectious Diseases, Medical University of Graz
  • 2 Division of Hematology, Medical University of Graz
  • 3 Division of Infectious Diseases and Global Public Health, University of California San Diego
  • 4 Clinical and Translational Fungal-Working Group, University of California San Diego
  • 5 Division of General Internal Medicine, University of California San Diego
Objectives: Among non-traditional risk groups, including critically ill patients in the intensive care units (ICU) and those with severe coronovirus disease (COVID-19) infection, invasive Apergillosis (IA) continues to be accompanied with high morbidity and mortality. Diagnosis is difficult due to unspecific clinical/radiological findings and low sensitivities of molecular tests and serum galactomannan (GM) testing, as well as varying turn around time. More rapid and accurate diagnostics are needed. We evaluated performance of the Aspergillus Galactomannan lateral flow assay (LFA), a novel point of care (POC) test for diagnosing IA, in serum specimens from a mixed cohort with and without invasive aspergillosis.
Materials & Methods: In a mixed bicentric cohort of 122 patients with clinical suspicion of IA (55% without hematological malignancies) and a GM ordered, 122 serum samples were retrospectively analyzed. Samples were collected between 2015 and 2021 at the University of California San Diego and the Medical University of Graz. The Aspergillus Galactomannan LFA was performed according to the manufacturer’s instructions. Digital readout was performed by an automated cube cube reader that was included with the test kits and displayed in optical density index (ODI). Aspergillus disease was classified according to the revised EORTC/MSG criteria, and for those with severe COVID-19 according to the ECMM/ISHAM criteria. LFA ODI cutoffs of 0.5 ODI and 1.0 ODI were compared by calculating sensitivity and specificity for proven/probable IA vs. no IA.
Results: The majority of patients were male (63% male vs. 37% female) and median age was 57 years (range 22–88). The LFA produced valid results in all samples. One patient fulfilled criteria of proven IA, 27 probable IA or SARS-Cov2- associated pulmonary aspergillosis (CAPA), and 87 did not fulfill criteria for IA or CAPA. Seven patients were non-classifiable. Underlying hematological malignancy was present in 45%. At a 0.5 ODI cutoff, sensitivity and specificity were 78.6% and 90.5%, respectively. When increasing the cutoff to 1.0 ODI, the LFA had a decreased sensitivity of 50%, but increased specificity of 96.6%. The serum LFA tended to be more discriminatory in patients with underlying hematological malignancies (AUC 0.853, 95%CI 0.750–0.977) vs. those without hematological malignancy (AUC 0.677, 95%CI 408–975). A total of 38% were receiving mold active antifungal prophylaxis or treatment at the time of serum sampling, but this did not impact discriminatory power of the LFA.
Conclusions: Our study is the first to evaluate LFA performance in serum specimens in a mixed cohrt of mostly non-hematologic malignancy patients and found 79% sensitivity and 91% specificity for IA by using a cut off of 0.5 ODI. Importantly, concomitant mold active prophylaxis or treatment did not impact diagnostic performance. The LFA from serum may serve a role as a rapid test for the diagnosis of IA. Prospective evaluation in a clinical setting would be valuable.
Jof 07 00916 i004
Figure 1. Receiver Operating Characteristics Analysis Curves for Serum Lateral Flow Assay for Diagnosing Proven/Probable Invasive aspergillosis or COVID-19 associated pulmonary aspergillosis vs. no aspergillosis in the overall Study Cohort.

P053 Application of MALDI-TOF MS for the Identification of Clinical Yeast Isolates: Comparison of the Autof ms1000 and Bruker Biotyper Platforms

Georgia Vrioni 1, Maria Drogari-Apiranthitou 2, Theodora Koliou 1 and Athanasios Tsakris 1
  • 1 Department of Microbiology, Medical School, National and Kapodistrian University of Athens
  • 2 4th Department of Internal Medicine, “Attikon” University General Hospital, National and Kapodistrian University of Athens
Objectives: Matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) has been established as a powerful tool for the fast and reliable identification of microorganisms, including yeasts. This study aimed to compare the performance of the recently developed Autof ms1000 (Autobio, Zhengzhou, China) with that of the Bruker Biotyper (Bruker Daltonics, Bremen, Germany) for identification of clinical yeast isolates.
Materials & Methods: A total of 87 yeasts recovered from various clinical specimens were used. The yeasts were identified at the species level with standard microbiological approaches including morphology and biochemical testing. Candida auris strains were identified by molecular method (Candida auris ITS2 gene, genesig® Standard Kit, PrimerdesignTM Ltd). The VITEK system (BioMerieux, version 8.02) was used for the identification of 21/87 strains. MALDI-TOF MS procedures were performed according to the manufacturers’ instructions. Library databases used were version 1.1.11 for Autof ms1000 and BDAL/8468 MSPs for Bruker Biotyper. Yeasts were transferred to the target plate by the formic acid method and by ethanol/formic acid extraction whenever results with both instruments were not reliable. Initial analysis of each strain was performed in duplicate, and the results with a higher range/score were used. Cutoff scores for reliable species/genus identification were 9.000–10.000/6.000–8.999 for Autof ms1000, and 2.00–3.00/1.70–1.99 for Bruker Biotyper.
Results: Both systems were able to identify all 87 yeast strains at the species level and the results obtained were identical (100% concordance). The only differences observed were in the score values. With the Autof ms1000 system 48/87 (55.2%) of the yeasts were identified at the species level with a high score (>9.000, reliable species identification), 37/87 were reliably identified only at the genus level, and 2 C. auris strains had a non reliable identification score. With the Bruker Biotyper 64/87 (73.6%) of the yeasts were reliably identified at the species level (score >2.00, reliable species identification), and 23/87 were reliably identified only at the genus level. When the results of the two MALDI-TOF MS platforms were compared with the VITEK system, identical results were obtained for 17/21 yeasts (80.9% concordance for both systems). VITEK failed to identify one C. lusitaniae, reliably identified by Bruker Biotyper. Three more strains, two identified as Sacharomyces cerevisiae and one as C. albicans by both MALDI-TOF MS systems, were identified as C. famata, C. sphaerica and C. ciferrii by VITEK, respectively. The Autof ms1000 system identified one of these strains reliably at the species level and three at the genus level. The Bruker Biotyper system reliably identified three of these isolates and one with reliability at the genus level.
Conclusions: Our study demonstrates that both, the Autof MS1000 and Bruker Biotyper systems can successfully identify most clinical yeast isolates, while performance is still highly dependent on the database and sample preparation protocols.

P054 Performance of MALDI-TOF MS for Routine Identification of Fusarium Clinical Isolates: Comparison of the Autof ms1000 and Bruker Biotyper Platforms

Georgia Vrioni 1, Theodora Koliou 1, Athanasios Tsakris 1 and Maria Drogari-Apiranthitou 2
  • 1 Department of Microbiology, Medical School, National and Kapodistrian University of Athens
  • 2 4th Department of Internal Medicine, “Attikon” University General Hospital, National and Kapodistrian University of Athens
Objectives: Fusarium species are rare but important human pathogens needing rapid and accurate identification. Yet their identification to the species level using phenotypic methods is difficult, requiring molecular sequencing. Matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) has been established as a powerful tool for the fast and reliable identification of microorganisms. This study aimed (i) to assess the accuracy of MALDI-TOF MS in the identification of Fusarium clinical isolates from Greece, and (ii) to compare the performance of the recently developed Autof ms1000 (Autobio Diagnostics, Zhengzhou, China) with that of the Bruker Biotyper (Bruker Daltonics, Bremen, Germany).
Materials & Methods: A total of 37 Fusarium strains recovered from various clinical specimens were used. Twenty-five (25/37) had been identified with molecular reference methods. MALDI-TOF MS procedures were performed according to the manufacturers’ instructions. Fresh colonies of the strains were transferred to the target plate by the formic acid method, or the ethanol/formic acid extraction whenever the initial results at species level were not relibable with both instruments. Cutoff scores for reliable species/genus identification were 9.000–10.000/6.000–8.999 for Autof ms1000 (Library database version 1.1.11), and 2.00–3.00/1.70–1.99 for Bruker Biotyper (BDAL Filamentous Fungi/577 MSPs). Analysis of each strain was performed in duplicate, and the results with a higher range/score were used.
Results: Identification results were obtained for 36 of the 37 Fusarium strains (97.3%), by both systems. With Autof ms1000 16/36 (44,4%) strains had a high identification score (>9.000) while with Bruker Biotyper 25/36 (69.4%) strains had a score of >2.00. The identification results with a non-reliable score were 5/36 (13.9%) for Autof ms1000 and 1/36 (2.8%) for Bruker Biotyper. However, 28/36 strains gave identical results by both systems, at least at the species complex (SC) level (77.8% concordance) and the differences were between the species F. proliferatum, F. verticillioides and F. oxysporum, known for their pattern similarities. Of the 25 molecularly identified strains, 16 (64%) were correctly identified by the Autof ms1000, 14 at species level and 2 at SC level. With Bruker Biotyper, 20/25 (80%) were correctly identified, 17 at species level and 3 at SC level. Three strains (1 F. metavorans and 2 F. brachygibbosum) could not be identified by either system, as they are new emerging species. Four F. verticillioides strains were misidentified, either as F. proliferatum (3 strains by Bruker Biotyper, 2 by Autof MS1000), both belonging to F. fujikuroi SC, or F. oxysporum (2 strains by Autof MS1000).
Conclusions: Both systems produced satisfactory results. The Autof MS1000 and Bruker Biotyper platforms could be equally utilised to identify clinical Fusarium isolates at SC level, although the Bruker Biotyper appeared to perform slightly better for the set of Fusarium strains used. Frequent updates of the mass spectrometry databases will enable more accurate identification of new emerging species, or species with similar patterns but potentially different antifungal susceptibility profiles.

P055 Adaption of an Histoplasma RTqPCR Assay for Rapid Diagnosis of Disseminated Emergomycosis

Aude Sturny Leclère 1, Tsidiso Maphanga 2, Dea Garcia Hermoso 1, Nelesh P. Govender 2 and Alexandre Alanio 1
  • 1 Institut Pasteur
  • 2 NICD
Objective: A new reverse transcriptase quantitative PCR (RTqPCR) assay was recently designed and validated in a French cohort of patients with suspected histoplasmosis (907 patients; 1319 specimens analyzed). In laboratory testing, the assay had a very low limit of detection (20 copies) and a 100% analytical specificity against 114 different fungal species including Coccidioides spp., Talaromyces marneffei, Paracoccidioides brasiliensis, Nanniziopsis obscura, and Emergomyces crescens. The clinical validation demonstrated a 98% sensitivity (43/44 patients detected) in EORTC/MSG-proven cases and 99% specificity. Moreover, 92% of patients with a progressive disseminated histoplasmosis in immunocompromised patients were detected in blood specimens using this RTqPCR assay. This assay allowed diagnosis of cases of Histoplasma capsulatum var. capsulatum and Histoplasma capsulatum var. duboisii.
Material and methods: We first aimed to assess the analytical specificity of this Histoplasma RTqPCR assay on closely-related fungi responsible for similar diseases in South Africa including emergomycosis and blastomycosis.
Results: The Histoplasma RTqPCR assay allowed detection of a standardized concentration of Emergomyces africanus, Emergomyces pasteurianus, Blastomyces percursus, Blastomyces emzantsi DNA (0.1 ng/µL) with ∆Cq values between 4 to 11 compared to Histoplasma DNA (Table). This difference means that the assay is able to detect Emergomyces and Blastomyces DNA but with performance decreased by 20 to 1000 times as compared to Histoplasma DNA detection. We then designed a RTqPCR assay at the same locus (mtSSU) with primers and probes specific to E. africanus and observed an increased specificity for E. africanus compared to Blastomyces spp. and Histoplasma spp. with a ∆Cq value of 7 to 12 Cq value (decreased performance by 200 to 10,000 fold for Blastomyces and Histoplasma DNA detection compared to Emergomyces DNA).
Conclusions: Using both RTqPCR assays in patients with suspected disseminated histoplasmosis or emergomycosis among people living with HIV may help distinguish between these clinically-similar diseases by analysis of the Cq value.

P056 Determining Cut-Off of Aspergillus-Specific Galactomannan Index in Tracheal Aspirate Samples in COVID-19 Associated Pulmonary Aspergillosis Patients from Pakistan

Joveria Farooqi, Syed Ahsan Ali, Muhammad Irfan, Sadaf Zaka, Imtiaz Soomro, Faheem Naqvi and Kauser Jabeen
Aga Khan Univeristy
Objectives: According to the consensus definition for COVID-19 associated pulmonary aspergillosis (CAPA), the microbiological criteria requires bronchoalveolar lavage fluid (BALF) for measurement of Aspergillus-specific Galactomannan Index (GMI), Aspergillus PCR or culture. In our setting, very few patients undergo bronchoscopy and BALF collection due to severe hypoxia in COVID-19 patients and biosafety concerns. Hence, we set out to determine the cut-off for GMI in easily accessed respiratory samples which could distinguish between CAPA and non-CAPA patients.
Methods: CAPA and non-CAPA patients were identified from hospital and laboratory database of Aga Khan University Hospital. Diagnostic criteria used were adapted from the 2020 ECMM/ISHAM consensus criteria by Koehler et al., modified to include isolation of Aspergillus species from TA and/or serum GMI >0.5, in the presence of clear radiological and clinical evidence and confirmed COVID-19 patients diagnosed on SARS CoV2 PCR to define possible and probable CAPA. GMI was measured using Platelia Aspergillus® (Bio-Rad Laboratories, Marnes-la-Coquette, France). ROC curve and Youden’s J statistic was used to determine the cut-off and its sensitivity and specificity. Frequencies and proportions computed and multiple linear regression model built to determine the increase in GMI with different covariates.
Results: There were 62 (62.6%) CAPA cases [26/62 (42%) probable CAPA and 36/62 (58%) possible CAPA] and 37 (37.4%) non-CAPA cases. Nineteen (31%) CAPA patients had both Aspergillus culture positive and serum GMI >0.5, while 36 (58%) CAPA patients had samples which were culture positive for Aspergillus species only and 7 (11%) CAPA patients had serum GMI >0.5 only. The cut-off for GMI was determined as 1.61 [Youden = 0.482, AUC = 0.755 (0.653–0.857), sensitivity 88.7% and specificity 59.5%] when both possible and probable CAPA were taken as cases. The GMI cut-off increased to 3.55 [Youden = 0.427, AUC = 0.736 (0.638–0.833), sensitivity 96.2%, specificity 46.3%] when only probable CAPA labelled as cases. At GMI of 4.5 in non-bronchoscopic lavage, as suggested by Koehler et al, sensitivity was 72.6%, specificity 62.2% and Youden 0.347 for all cases, while 88.5%, 50.7% and 0.391, respectively for probable cases only. The multiple linear regression model (adjusted R-square 0.288, p < 0.001) showed a GMI increase of 3.05 (95% CI: 1.30–4.79, p = 0.001) with probable CAPA case, 0.96 (95% CI: −0.72–2.63, p = 0.261) with possible case and 2.90 (95%CI: 1.29–4.51, p = 0.001) when Aspergillus species were isolated from the same sample.
Conclusions: The cut-off for GMI in tracheal aspirates was determined to be >1.6 to detect CAPA cases with a high sensitivity. The specificity remained low, which warrants further exploration with non-CAPA samples. This could be due to increased background rates of chronic pulmonary diseases and airway colonisation in our population.

P057 Genetic Characterization and Antifungal Susceptibility Profiles of Trichosporon Species Isolated from Iranian Clinical Samples

Fatemeh Ahangarkani 1, Kiana Abbasi 2, Jacques F Meis 3 and Hamid Badali4
  • 1 Antimicrobial Resistance Research Center, Communicable Diseases Institute, Mazandaran University of Medical Sciences
  • 2 Department of Microbiology, Zanjan Branch, Islamic Azad University
  • 3 ECMM Excellence Center for Medical Mycology, Centre of Expertise in Mycology Radboudumc/Canisius-Wilhelmina Hospital
  • 4 Department of Medical Mycology, School of Medicine, Mazandaran University of Medical Sciences
Objectives: Trichosporonosis is an emerging fungal infection caused by Trichosporon species, a genus of yeast-like fungi, which are frequently encountered in human infections ranging from mild cutaneous lesions to fungemia in immunocompromised patients. The incidence of trichosporonosis has increased in recent years, owing to higher numbers of individuals at risk for this infection. Although amphotericin B, posaconazole and isavuconazole are generally effective against Trichosporon species, some isolates may have variable susceptibility to these antifungals. Herein, we evaluated the species distribution, genetic diversity and antifungal susceptibility profiles of Trichosporon isolates in Iran.
Materials & Methods: The yeasts were identified by matrix-assisted laser desorption/ionisation time-of-flight mass spectrometry (MALDI-TOF MS). Phylogenetic analysis was performed based on amplified fragment length polymorphism (AFLP). The in vitro susceptibilities of eight antifungal agents were analysed using the Clinical and Laboratory Standards Institute broth microdilution methods.
Results: The isolates belonged to the species T. asahii (n = 20), T. japonicum (n = 4) and T. faecale (n = 3). A dendrogram of the AFLP analysis demonstrated that T. asahii and non-asahii Trichosporon strains (T. japonicum and T. faecale) are phylogenetically distinct. While voriconazole was the most active agent (GM MIC = 0.075 μg/mL), high fluconazole MICs (8 μg/mL) were observed for a quarter of Trichosporon isolates. The GM MIC value of amphotericin B for T. asahii and non-asahii Trichosporon species was 0.9 μg/mL.
Conclusions: The distribution and antifungal susceptibility patterns of the identified Trichosporon species could inform therapeutic choices for treating these emerging life-threatening fungi. Additional studies are needed for the understanding of epidemiology and antifungal susceptibility patterns of Trichosporon i n I ran. The current study is t he first report on Trichosporon s pecies in Iran. The p resented data on t he distribution, genetic diversity and antifungal susceptibility patterns of these Trichosporon i solates can inform therapeutic choices for fungi from this emerging life-threating pathogen.

P058 Non-Culture Based Approach to Detect Azole Resistance in Patients at Risk of Invasive Aspergillosis (ERESAA-BM Study): Preliminary Findings

Rose-Anne Lavergne 1,2, Florent Morio 1,2 and Patrice Le Pape 1,2
  • 1 Parasitology and Mycology Laboratory, Nantes University Hospital
  • 2 EA1155, Nantes University
Objectives: Azole resistance in Aspergillus fumigatus is a worldwide and worrisome problem. At our center, we previously evaluated the prevalence of azole resistance by in vitro susceptibility testing in cystic fibrosis patients, but no data are available in patients at risk of invasive aspergillosis (IA) linked to low sensitivity of conventionnal approach (culture) to detect Aspergillus from respiratory samples of these patients. The main objective of this study was to evaluate the benefit of a molecular approach to identify Aspergillus fumigatus and to detect molecular markers associated with environmental azole resistance in respiratory samples from patients at risk of IA.
Materials & Methods: From February 2020 to January 2021, BAL supernatants from patients at risk of IA were prospectively collected and stored at −20 °C. In this non-interventional study, patients at risk of IA were defined by the prescription of at least one Aspergillus galactomannan antigen (GM) dosage on serum or BAL, whatever the results. BAL were routinely processed according to conventional methods (direct examination followed by cultures +/− azole susceptibility testing +/− GM dosage). At the end of the collection step, all BAL supernatants were analysed by molecular approach: DNA extraction from 1 mL of sample using the Stabilized Saliva DNA® kit and Maxwell® instrument (Promega) followed by detection and identification of Aspergillus and TR34, L98H, Y121F and T289A mutations, using the AsperGenius® kit (PathoNostics). Results of routine cultures and molecular tests were then compared.
Results: During this one-year collection period, 143 BAL supernatants (n = 114 patients) were included. Underlying diseases included solid organ transplantation (n = 55), hematological malignancies (n = 33) or others situations at risk of IA (n = 26). Analysis of the first 36 samples (n = 31 patients) allowed to detect Aspergillus DNA in 6 samples from 6 patients. Of these 6 positive samples for Aspergillus DNA, 3 samples were positive for Aspergillus fumigatus (Ct from 34.6 to 39.6). By comparison, two samples were positive for Aspergillus in culture: 1 Aspergillus nidulans species complex, detected by the Aspergenius® assay and 1 Aspergillus fumigatus species complex not detected by the Aspergenius® assay (neither Aspergillus nor A. fumigatus PCR). None of the resistance markers (TR34, L98, Y121 and T289) could be amplified in the 3 A. fumigatus-positive samples. GM dosages were performed on 12 of the 36 BAL samples and all were negative (index < 0.5).
Conclusions: These preliminary results highlight that conventional cultures and molecular methods are complementary tools which, when combined are able to increase the detection rate of Aspergillus in patients at risk of IA, in line with the current guidelines. Molecular detection of resistance markers needs sufficient amount of A. fumigatus DNA. These preliminary results will be consolidated with the analysis of the 107 remaining samples (n = 83 patients).

P059 Accelerate Antifungal Susceptiblity Testing of Aspergillus fumigatus Isolates Sent to Mycology Reference Laboratories by Direct Inoculation of Spore Suspensions

Jochem Buil 1,2, Marlou Tehupeiory-Kooreman 1,2, Willem Melchers 1,2 and Paul Verweij 1,2
  • 1 Department of Medical Mycology, Radboud University Medical Center
  • 2 Radboudumc—CWZ Center of Expertise for Mycology
Background: Antifungal susceptibility testing (AFST) of clinical relevant A. fumigatus isolates is important to guide antifungal therapy, especially in regions were azole resistance is prevalent. However, the reference methods for AFST are not widely available. Sending isolates to mycology reference centers causes delay in obtaining the susceptibility results, as isolates need to be subcultered before performing broth microdilution. In order to accelerate AFST, we studied whether spore suspensions, that are sent in can be directly inoculated, thereby eliminating the subculture-phase.
Material/methods: We used two methods for AFST: In the standard “EUCAST method”, AFST was performed using spores from a maturated colony. In the “direct inoculation method”, AFST was performed using the spore suspensions that were either stored or sent from other laboratories directly without a subculturing phase. Three groups of isolates were analyzed. Group I: experimental analysis: 13 A. fumigatus isolates were selected of which 6 were azole resistant. Spore suspensions were prepared and AFST was performed daily after storing the isolates for 4 days at room temperature, and after 4 days for spore suspensions stored at 2–4 °C and at 28 °C. All measurements were performed in triplicate. Group II, retrospective analysis: 50 isolates that were sent to our laboratory as spore suspensions were tested using the direct inoculation method and stored at −70 °C in glycerol broth. The stored isolates were revived and AFST was repeated using the EUCAST method. Group III: prospective analysis: 30 isolates that were sent to our laboratory as spore suspensions were tested using the direct inoculation method and simultaneously using the EUCAST methods without storage at −70 °C. MICs based on the EUCAST and direct inoculation methods were compared.
Results: The MICs of azoles and amphotericin B for isolates from Group 1 strains from stored spore suspensions did not differ more than one twofold dilution step comparison to the standard EUCAST method. The susceptibility classification based on clinical breakpoints showed 99.9% concordance for azoles and amphotericin B. One isolate resistant (MIC 2–4 mg/L) for voriconazole, tested susceptible after 4 days storage in 1 replicate. In Group II, 100% concordance was seen for amphotericin B and voriconazole. For itraconazole, 5 strains that had MICs of 2–4 mg/L in direct inoculation method while the MIC was 0.5–1 mg/L in EUCAST method. For 2 isolates the MIC of posaconazole were 1–2 dilutions lower in EUCAST methods resulting in a change in interpretation. For Group III isolates, 99.2% concordance was found. One isolates with a voriconazole MIC of 2 mg/L using EUCAST methods had a MIC of 1 mg/L using direct inoculation.
Conclusions: We evaluated a strategy to accelerate AFST of A. fumigatus isolates sent to mycology reference laboratories. For isolates with MICs close to the breakpoints, small variations in measurements did result in a change in interpretation for individual drugs. However, this is also the case for repeated measurements performed in accordance to EUCAST guidelines. Our results indicate that the subculturing phase can be eliminated for spore suspensions up to 4 days for azoles and amphotericin B.

P060 Comparison of the Analytical Performances of Two Commercial Real-Time PCR Kits with an In-House Real-Time PCR Assay for Diagnosing Mucormycosis

Victor El Jammal 1, Charline Miossec 2, Damien Dupont 1, Martine Wallon 1, Meja Rabodonirina 1, Florence Persat 1 and Jean Menotti 1
  • 1 Lyon University Hospitals/Claude Bernard University
    2 Lyon University Hospitals
Objectives: The prognosis of patients with invasive mucormycosis depends on early diagnosis and treatment initiation. As conventional diagnosis relying on histopathological and mycological direct examination combined with mycological culture lacks sensitivity and/or yields delayed diagnosis, an in-house real-time PCR has been proposed as an additional diagnostic tool and has shown to yield earlier diagnosis (Millon et al., 2016). As two commercial real-time PCR kits recently became available for the diagnosis of mucormycosis, our aim was to assess their performances when compared to the home-made PCR assay to detect and quantify the main genera of Mucorales involved in human diseases.
Materials & Methods: The MycoGENIE® Aspergillus-Mucorales spp. real-time PCR kit and the Fungiplex® Mucorales PCR kit were compared to an in-house real-time PCR assay using hydrolysis probes targeting Mucor/Rhizopus, Lichtheimia, and Rhizomucor. A standard curve was generated for all assays with serial dilutions of Rhizopus arrhizus, Lichtheimia ramosa, Rhizomucor pusillus, Mucor circinelloides, Cunninghamella bertholletiae, and Syncephalastrum racemosum DNA.
Results: The lower limit of detection of all assays was assessed to be between 0.5 and 5 fg/µL of Rhizopus arrhizus. Mucor circinelloides, Lichtheimia ramosa, and Rhizomucor pusillus DNA, except for L. ramosa that was not detected by Fungiplex. The serial dilutions of R. arrhizus DNA yielded mean threshold cycles (Ct) 0.78 and 1.97 higher for Fungiplex and for MycoGENIE than for the in-house PCR assay, respectively. For M. circinelloides, mean Ct values were 0.12 and 3.39 higher than for the in-house PCR assay for Fungiplex and MycoGENIE, respectively. For R. pusillus, mean Ct values were 0.44 and 0.11 higher than for the in-house PCR assay for Fungiplex and MycoGENIE, respectively. For L. ramosa, mean Ct value was 0.73 higher for MycoGENIE than for the in-house PCR assay. Lichtheimia corymbifera was detected by all 3 assays. Cunninghamella bertholletiae was detected only by MycoGENIE. Syncephalastrum racemosum was not detected by the 3 assays.
Conclusions: Although the lower limit of detection of all three assays was globally quite close, some limits were observed, especially for L. ramosa which was not detected by Fungiplex. This could be due to an insertion/deletion or mismatches between L. ramosa sequence and the designed primers and/or probe. We also found quite higher mean Ct values than with the in-house PCR assay, especially for M. circinelloides and R. arrhizus with MycoGENIE. Although both kits were deemed to detect all Mucorales, C. bertholletiae was not detected by Fungiplex and S. racemosum was not detected by MycoGENIE and Fungiplex. The unavailability of the designed primers and probe sequences precludes the ability for mycologists to predict the species that could be detected by commercial kits. Mycologists should therefore verify the sensitivity of detection of the clinically relevant species so as to be aware of the limits of commercial PCR kits.

P061 Respiratory Symptomatic Patient with Adult Chronic Disseminated Paracoccidioidomycosis in the COVID-19 Era

Larry Luber Martínez Rosado
Latin American Research Team in Infectology and Public Health ELISAP, La Maria Hospital
Objetives: To present a clinical case of endemic mycosis presented as a respiratory symptomatic case that made it necessary to rule out COVID-19 and tuberculosis.
Methods: Case report.
Results: A 40-year-old man, farmer, with a history of heavy smoking and use of tetrahydrocannabinol (THC). He came to the clinic due to a clinical picture of 30 days of evolution due to odynophagia, halitosis, nocturnal sweating, unquantified weight loss, occasional dry cough. On physical examination he was feverish, whitish plaques were documented on the tonsils, and bilateral diffuse rales. The ELISA for HIV, the PCR for COVID-19 and the glycosylated hemoglobin were negative, the chest X-ray revealed generalized alteration of the lung parenchyma, thickening of the interstitium and patchy opacity in ground glass and subsegmental multifocal pneumonia in the right upper lobe segment. It was labeled as respiratory symptomatic, ruling out pulmonary tuberculosis. A community pneumonia scheme was indicated with ampicillin sulbactam plus clarithromizine, a microbiology was requested in sputum induced for tuberculosis, the evaluation by otorhinolaryngology revealed ulceronecrotic pharyngotonsillitis justifying tonsillectomy. The KOH validated in the tonsil biopsy was positive and the pathological anatomy showed severe acute and chronic inflammatory infiltrate, with granulomatous areas and multinucleated giant cells of the Langhans type surrounding areas of necrosis, special stains were performed, including methenamine silver being positive for structures consistent with paracoccidioidomycosis (Figure 1). Complementary studies such as immunodiffusion and complement fixation serology for fungi were reactive with a band of precipitate and reactive paracoccidioidin with dilution >64 respectively. Studies of tuberculosis and other mycoses were negative (Table 1). Management was started with itraconazole, scheduled for 6 months, therapy with which the patient responded favorably.
Conclusions: Paracoccidioidomycosis is a systemic systemic fungal disease endemic to territories, which occurs in a chronic and progressive manner that mainly affects the oropharyngeal mucosa, lungs and the reticuloendothelial system; performs both hematogenous and lymphatic dissemination, which is why any organ can be affected. This mycosis is acquired directly by inhalation of conidia from humid soils and high rainfall (1). In Colombia, the first case was described in 1949, with multiple presentations since then (2). Currently the world is going through a state of emergency due to the pandemic potential of SARS CoV2 COVID-19, the first case in our country was reported on March 6 and to date 3,432,422 million cases have been confirmed with 89–297 deaths, however, lethal endemic pathologies in our territory should not go unnoticed.

P062 Introduction and Evaluation of Fujifilm Wako β-D-Glucan Test in the Mater Misericordiae Hospital

Breda Lynch and Assumpta Killarney
Mater Misericordiae Hospital
Category: Diagnostics.
Objectives: Fungal infections carry a high morbidity and mortality, are difficult to diagnose and expensive to treat. β-D-glucan (BDG) is a serological test used in the diagnosis of fungal infections and was previously available to the Mater as an external laboratory reference test. The main objective of this project was to repatriate laboratory BDG testing to be performed in-house. The expected outcomes of this project were to improve diagnosis or out-ruling of fungal disease for patients, improve turn around time from current 109 days to less than 3 days and reduce unnecessary antifungal use.
Materials & Methods: The Wako BDG Test was validated for usage prior to equipment procurement. Once in place, staff training was completed and an education session of the use of BDG presented to the Clinical Microbiology (CM) and antimicrobial stewardship (AMS) team. In-house BDG testing service was established and data collected from patient testing in MMUH from February–September 2020 via retrospective analysis of clinical microbiology notes and digital records. Information gathered included test indication; ordering clinician; patient impact of result; AMS impact including financial savings, if any; rationalisation of therapy. Information was analysed and compared to international guidelines.
Results: Total number of samples 259:88 positive tests, 171 negative. 250 (96.5%) were under the guidance of the CM or Infectious Diseases team.
Expected and delivered outcomes of introduction of BDG in-house testing;
  • Improve diagnosis or out-ruling of fungal disease for patients.
    Achieved: Analysis demonstrates sensitivity 92.9%, specificity 99.3%, with a positive and negative predictive value of 96.3% and 98.6% respectively.
  • Improve turn-around time from current 109 days to less than 3 days.
    Achieved: TAT now average 1 day, range <1–7 days with only 21 of 259 results taking >2 days.
  • Reduce unnecessary antifungal use.
    Achieved: 32 patients had anti-fungal therapy rationalised based on a negative BDG result leading to a direct cost saving of €81,064.
Conclusions: BDG contributes to confirming the diagnosis of fungal infection: 25 patients had a positive BDG result which contributed to early diagnosis and treatment of a fungal infection.
BDG contributes to out-ruling fungal infections and rationalising therapy therefore is a valuable AMS tool. A total of 87 results contributed to a patient not being prescribed an empiric antifungal. This protected these patients from any potential adverse events that may have occurred. While there would be a cost-saving attributable to this, it is difficult to quantify.
With charity funding for equipment, we were able to process the tests in-house for €16,669.24 cheaper than sending externally. TAT for results improved from an average of 109 days to 1 day. Repatriation of BDG long term is cheaper for the laboratory as well as providing an improved service.
In conclusion, the introduction of BDG testing into MMUH has been a successful initiative that both improves patient care as well as being a financially worthwhile endeavor.

P063 Galactomannan Antigen Testing for Diagnosis of Invasive Aspegillosis in Pediatric Haematological Oncology Patients’

Annapurna Parida 1, Malini R. Capoor 1 and Amitabh Singh 2
  • 1 Department of Microbiology, Safdarjung Hospital and Vardhaman Mahavir Medical College
  • 2 Department of Pediatrics, Safdarjung Hospital and Vardhaman Mahavir Medical College
Objective: Undetected invasive aspergillosis (IA) is a life-threatening complication in immunocompromised and haematological malignancy paediatric patients. Biopsy culture for diagnosis of IA can do more harm than good to an already weakened patient. Non-invasive biomarker assays like galactomannan enzyme assay can expedite the diagnosis and treatment of IA. In this study the authors had tried to evaluate the role of Galactomannan immunoassay in diagnosis of IA as per revised EORTC/MSG 2019 criteria.
Material method: Serum of 96 consecutive cases of paediatric (age ranging 6 m to 14 years) haematological malignancy patients were followed prospectively after enrolment to record demographic, clinical, radiological and treatment characteristics. Clinical and mycological workup (potassium-hydroxide mount, fungal culture) of the patients was done to classify proven, probable and possible IA as per EORTC-MSG guidelines,2019. The serum GMI (galactomannan indices) were measured in terms of sensitivity, specificity, positive predictive value (PPV) and negative predictive value (NPV) and was validated with revised EORTC -MSG, 2019 of IPA. Results: Three of these revealed fungal hyphae on histopathology after biopsy. Forty-six patients were categorised into probable invasive aspergillosis when routine mycological findings were taken into consideration. On culture Aspergillus flavus in 71% (n = 33), followed by Aspergillus fumigatus 24% (n = 11), rest were Aspergillus niger 5% (n = 2). The maximal Youden index “J” was 60%, (95% confidence interval of 0.4167 to 0.6875) corresponding to a GM index of >1.008, demonstrating that a GM index of >1.008 (95% Confidence interval a >0.87 to >1.4315) was the best cut-off point to predict IA with sensitivity and specificity were calculated as 85.42% and 75.00% respectively.
Conclusions: GM EIA when done in addition to culture from nonsterile sites and in defined population in paediatric patients is a excellent point of care test for IA as seen in this study on haematological oncology paediatric patients. This study further highlights that revisiting the definition of probable category of EORTC is very important for better utility of GM EIA assay in overall management in paediatric oncology haematological patients.

P064 Comparison of Bordier Elisa Assay vs. Ldbio Ictigg/Igm Lateral Flow Assay for Diagnosing Chronic Pulmonary Aspergillosis: A Nigerian Experience

Tina Nwosu 1,2, Rita Oladele 2,3 and Jean-Pierre Gangneux 4
  • 1 Central Research Laboratory, College of Medicine, University of Lagos
  • 2 Medical Mycology Society of Nigeria
  • 3 Department of Medical Microbiology & Parasitology, College of Medicine, University of Lagos
  • 4 CHU Rennes, EHESP, Institut de Recherche en Santé, Insert, Environnement et Travail (Irset), UMR_S 1085, F35000, Universite Rennes
Objectives: Chronic pulmonary aspergillosis (CPA) is a known complication of pulmonary tuberculosis (TB). The detection of anti-Aspergillus antibodies is key to diagnosing CPA. Available techniques for the detection of Aspergillus IgG are limited and pose a great challenge in resource-limited settings in terms of affordability, skilled personnel, equipment and regular power supply. A point of care test will address most of these challenges. The objective of this study was to evaluate the performance of the LDBio ICT IgG/IgM lateral flow assay vs. that of the Bordier Elisa product in a field study in Nigeria.
Methods: Stored sera of 41 confirmed cases of CPA (from 3 sites in Nigeria) and 406 sera of healthy blood donors (from 9 sites representing the 6 geopolitical zones in Nigeria) were evaluated using both the Bordier Elisa (using cut-off value of 0.8 AU/mL, Bordier Affinity Products, Crisser, Switzerland) and the Aspergillus ICT IgG/IgM lateral flow assay (LFA) device (LDBio, Diagnostics, Lyon, France). Results were read both visually and digitally. R Statistical Computing Software version 4.0.2 was used for data analysis.
Results: Of the 41 serum samples tested in the CPA patient group, 24 tested positive by LDBio with 58.54% sensitivity (95% CI, 42.4% to 73.7%). In the non-CPA group, 403 of the 406 sera tested negative by LDBio with 99.3% specificity (95% CI, 97.9% to 99.9%). The predictive positive and negative values of the LDBio test were 88.9% and 95.9%, respectively. The gold standard (Bordier) test was positive for 41 of the 41 CPA serum samples tested with 100% sensitivity (95% CI, 91.4% to 100%). A comparison of the two tests showed that the LDBio test demonstrated lower sensitivity than the Bordier in detecting Aspergillus antibody (McNemar’s p-value <0.0001). However, both LDBio and Bordier show no significant difference in specificity (McNemar’s p-value = 0.0832) (Table 1). Results were in agreement for 427 of the 447 samples tested (95.5%) with a Cohen’s kappa coefficient of 0.68 (95% CI, 0.55 to 0.81), indicating good agreement between the LDBio and Bordier results. Youden’s J statistic calculated for the LDBio test results indicated a good balance between sensitivity and specificity, and the test had a high DOR of 190 (95% CI, 52 to 692).
Conclusions: The LDBio LFA test is a simple and rapid point of care test that can be implemented in field studies where Elisa is not available. A very good specificity and negative predictive value were observed in this study while the sensitivity was only of 58.54% compared to the Elisa when using a cut-off value of 0.8 AU/mL. The lower sensitivity of the LDBio LFA might be due to A. fumigatus being the a specie involved in maximum 50–60% of cases in Nigeria. Nevertheless, when combined with clinical features, the LFA can be used as a screening tool for CPA in settings such as ours, with an estimated cut-off of positivity of 1.0 AU/mL.

P065 Evaluation of the PneumoGenius® PCR Assay for the Detection of P. jirovecii DNA and DHPS Mutations in Respiratory Samples

Maël Roojee 2, Hélène Guegan 1, Solène Le Gal 3, J-P Gangneux 1 and Florence Robert-Gangneux 1
  • 1 Univ Rennes, CHU, Inserm, Irset (Institut de Recherche en Santé, Environnement et Travail)—UMR_S 1085, Rennes, France
  • 2 Laboratoire de Parasitologie-Mycologie, Centre Hospitalier Universitaire de Rennes, Rennes, France
  • 3 Laboratoire de Parasitologie et Mycologie, Hôpital de La Cavale Blanche, CHU de Brest, Groupe d’Etude des Interactions Hôte-Pathogène (ER, GEIHP), Université d’Angers, Université de Brest, Brest, France
Objectives: Pneumocystis pneumonia (PCP) is the most frequent fungal opportunistic infection in HIV-infected patients, and is of growing importance in HIV-negative patients. In this latter category of patients, the diagnosis mainly relies on PCR detection of fungal DNA on respiratory samples. This study aimed at evaluating the clinical performance of the PneumoGenius® real-time PCR assay (Pathonostics) on respiratory specimens relative to that of our in-house PCR assay. The PneumoGenius® assay is a commercial multiplex real-time PCR method, which detects the Pneumocystis jirovecii mitochondrial ribosomal large subunit (mtLSU) and two dihydropteroate synthase (DHPS) point mutations (codons 55 and 57), thus could be of interest to detect therapeutic failure.
Methods: In total, 206 respiratory samples from severely immunosuppressed patients sent to our lab for PCP diagnosis were retrospectively included. The patients were graded according to modified EORTC-MSG criteria as proven PCP (n = 82), probable PCP (n = 80), colonized (n = 36), and excluded (n = 8). All DNA were stored at −20 °C and re-tested with the Pneumogenius® assay, following the manufacturer’s instructions. To evaluate the accuracy of the DHPS mutant’s identification, an in-house PCR and Sanger sequencing were performed on selected samples (n = 34).
Results: The in-house PCR was positive for 198 samples, the Pneumogenius® assay was positive for only 182 of them (92% relative sensitivity). Four diagnostics of proven/probable PCP were missed by the Pneumogenius® assay (Sensitivity 97.5% for this sub-group); the PCR could be considered as “inhibited” in one case (absence of amplification of the internal control), and the mean Cq obtained for the 3 remaining samples was 37.5. For proven cases, the mean Cq obtained with the in-house PCR and the PneumoGenius® assay was significantly different (27.77 vs. 28.92, respectively, p < 0.05). Twelve negative results were obtained with patients diagnosed as colonized using the in-house PCR (mean Cq 36.25 ± 1.34 with the in-house PCR). No false positive results were observed with the 8 negative samples.
DHPS genotyping was successful for 147/182 positive samples with PneumoGenius®. Of the 34 samples which benefited from genotyping with both methods, at least one mutation was detected in 8, with full concordance between both techniques. Four patients (5 samples) were infected with two distinct Pneumocystis strains. Overall, mutations in codons 55 and 57 were observed in 4 and 6 strains, respectively. Two strains harbored a mutation on both codons. The 35 samples for which PneumoGenius® genotyping failed had a mean Cq of mtLSU amplification of 35.63 ± 1.63.
Conclusions: Pneumogenius® showed a good performance for genotyping, but was unable to diagnose PCP in one proven case and 2 probable cases with low Cq. As the mean Cq of amplification was higher than with the in-house PCR, this could explain the lack of detection of samples with low fungal loads. This lower sensitivity is overweight by a higher specificity, since colonization is less frequently detected.

P066 Comparison of Two Commercial Colorimetric Broth Microdilution Tests for Candida Susceptibility Testing: Sensititre YeastOne vs. MICRONAUT-AM

Sophie Philips 1,2, Frederik Van Hoecke 1, Emmanuel De Laere 1, Steven Vervaeke1, Roos De Smedt 1, Jerina Boelens 3, Deborah De Geyter 2, Denis Piérard 2 and Katrien Lagrou 4
  • 1 Department of Laboratory Medicine, AZ Delta Hospital, Deltalaan 1, 8800 Roeselare, Belgium
  • 2 Department of Microbiology and Infection Control, Vrije Universiteit Brussel (VUB), Universitair Ziekenhuis Brussel (UZ Brussel), Laarbeeklaan 101, 1090 Brussels, Belgium
  • 3 Department of Laboratory Medicine, Ghent University Hospital, Corneel Heymanslaan 10, 9000 Ghent, Belgium
  • 4 Department of Laboratory Medicine and National Reference Centre for Mycosis, University Hospitals Leuven, Herestraat 49, 3000 Leuven, Belgium
Objectives: Candida is the most common cause of invasive fungal infections. Antifungal susceptibility tests (AFST) are crucial to guide therapy. Two colorimetric broth microdilution AFST were compared, Sensititre YeastOne and MICRONAUT-AM for nine antifungal agents.
Materials & Methods: One hundred clinical Candida isolates were tested, representing a realistic population for susceptibility testing in daily practice. CLSI clinical breakpoints (CBPs) and epidemiological cut-off values (ECVs) were used for Sensititre MICs while for MICRONAUT the EUCAST CBPs and ECVs were used.
Results: The reproducibility characteristics were comparable. Voriconazole and itraconazole showed a low EA of respectively 64.6% and 72.7%. Posaconazole had a very low EA of 38.3%. For fluconazole, however, an EA of 98.0% was demonstrated. The EA of echinocandins was 84.8% for micafungin, 89.9% for anidulafungin and 94.9% for caspofungin. For 5-flucytosine and amphotericin B, an EA of respectively 94.9% and 100% was noted. Sensititre minimal inhibitory concentrations (MICs) were systematically higher than MICRONAUT MICs for all antifungals, except for itraconazole. Only fluconazole, micafungin, and amphotericin B had a categorical agreement of ≥90%. Other molecules ranged from 66.7% to 81.9%. For fluconazole, micafungin, and amphotericin B the susceptibility proportions were comparable. Susceptibility proportion of posaconazole and voriconazole was higher using the MICRONAUT system. For itraconazole and anidulafungin, the susceptibility proportion was higher using Sensititre.
Conclusions: It was not possible to determine the true MIC values or the correctness of a S/I/R result since both commercial systems were validated against a different reference method. These findings show that there is a significant variability in susceptibility pattern and consequently on use of antifungals in daily practice, depending on the choice of commercial system.

P067 Urine Aspergillus Antigen Detection as a Screen for Invasive Aspergillosis in Hematology-Oncology Patients

Robina Aerts 1, Kausik Datta 2,3, Johan Maertens 1 and Kieren A. Marr 2,3
  • 1 Department of hematology, University Hospitals Leuven
  • 2 MycoMed Technologies
  • 3 School of Medicine, Johns Hopkins University
Objectives: Available diagnostics for invasive aspergillosis (IA) require sampling for blood or bronchoalveolar lavage (BAL) fluid, limiting application for screening to detect early disease. We previously reported that novel antibodies recognizing small molecular weight glycans can be used in a lateral flow format as an aid to diagnose IA using urine. Johns Hopkins and MycoMed Technologies have now optimized an ultrasensitive diagnostic enzyme immunoassay, called MycoMEIA™, with validation data demonstrating sensitivity 95.2% (95% CI 76.2–99.9) and specificity 94.2% (95% CI 89.3–97.3) as an aid to diagnose IA in people with suspected and confirmed IA. Early positivity suggested potential utility as a screening tool in people with high risks.
Methods: To test performance as a screening assay, we analyzed sequential urine samples obtained from people with proven or probable IA (cases), and no IA (controls), obtained from people treated for hematologic malignancies and/or receipt of allogeneic blood or marrow transplant (BMT). Patients had undergone aggressive screening with serum GM EIA and BALs were performed with suspicion of IA. Urine samples had been collected twice weekly and stored frozen at −80 °C. Results were interpreted using a low index cut-off to define positivity in order to optimize sensitivity and negative predictive value (NPV) for screening application.
Results: 120 urine samples were analyzed from 11 cases (proven or probable IA) as well as controls. Using the screening index cut-off of 0.8, 10/11 cases and no controls had at least one positive assay, yielding 91% per-case sensitivity and 100% specificity. Urine was positive in 6/7 cases with positive serum GM EIA and 6/7 cases with positive BAL GM EIA. Positive MycoMEIA assay pre-dated diagnosis established with the aggressive conventional screening approach in 6/10 cases, at mean 24.2 (range 2–62) days. Positive MycoMEIA post-dated conventional diagnosis by 8 (range 4–12) days in 4 cases.
Conclusions: Urine screening with MycoMEIA performed well to identify early IA in high-risk hematology patients. Larger studies are being performed to evaluate analytical index cut-offs for further optimization of sensitivity and predictive values.

P068 Early Phenotypic Detection of Fluconazole-Resistant and Anidulafungin-Resistant Candida glabrata Isolates

Panagiota Christina Georgiou 1, Maiken Cavling Arendrup 3,4,5, Spyros Pournaras 1 and Joseph Meletiadis 1,2
  • 1 Medical School, National and Kapodistrian University of Athens
  • 2 Department of Medical Microbiology and Infectious Diseases, Erasmus Medical Centre
  • 3 Unit of Mycology, Statens Serum Institute
  • 4 Department of Clinical Microbiology, Rigshospitalet
  • 5 Department of Clinical Medicine, University of Copenhagen
Objectives: Candida glabrata is the Candida species that most rapidly develops acquired resistance to fluconazole and echinocandins thus challenging clinical management. Early detection of resistance is important for choosing optimal therapy. We therefore developed a phenotypic test based on EUCAST E.Def 7.3 protocol for rapid detection of fluconazole and anidulafungin resistant isolates utilizing the colorimetric dye XTT.
Materials & Methods: Thirty-one clinical C. glabrata isolates were included, 11 anidulafungin-resistant (EUCAST MICs ≥ 0.125 mg/L), 20 anidulafungin-susceptible (MICs = <0.06 mg/L), 16 fluconazole-resistant (MICs ≥ 32 mg/L) and 15 fluconazole-“I” (susceptible, Increased exposure) (MICs≤16 mg/L). For the rapid XTT assay, 0.5–2.5 × 105 CFU/mL of each isolate was added to RPMI1640 + 2% glucose medium containing 100 mg/L XTT + 0.78 μΜ MEN and 0.06 mg/L anidulafungin or 16 mg/L of fluconazole in 96-well flat bottom microtitration plates in a total volume of 200μL. A drug-free control was also included. All wells were incubated at 37 °C. The metabolic activity in each well was kinetically assessed by measuring absorbance at 450 nm for 12 h in a microplate reader (Tecan Infinite F200). Τhe differences in XTT OD absorbance between the drug-free and the drug-treated wells between fluconazole-resistant and fluconazole-I isolates and between anidulafungin-susceptible and anidulafungin-resistant isolates were assessed with student t-test at different time points and ROC curves were used in order to identify the best time point and the best cut-off, according to the % of specificity and sensitivity.
Results: The earlier time point with the highest area under the ROC (1.00, p < 0.001 for fluconazole and 0.99, p < 0.001 for anidulafungin) was 7.5 for fluconazole and 5.5 h for anidulafungin. At 7.5 h, the mean±SD XTT-absorbance in drug-free and drug-treated wells containing 16 mg/L fluconazole were 0.73 ± 0.14 and 0.67 ± 0.15, respectively for the fluconazole-resistant isolates and 0.72 ± 0.09 and 0.51 ± 0.08, respectively for fluconazole-I isolates. The XTT-absorbance differences of the 16 mg/L-containing well from the drug-free well were 0.08 ± 0.05 for the fluconazole-resistant isolates significantly lower than the 0.25 ± 0.06 for the fluconazole-I isolates (p < 0.0001). ROC curve analysis identified an XTT-absorbance difference between the 16 mg/L-containing well and the drug-free well of 0.157 at 7.5 h with 100% sensitivity and specificity in detecting fluconazole resistant strains. For anidulafungin after 5.5 h, the mean ± SD XTT-absorbance in drug-free and drug-treated wells were 0.39 ± 0.05 and 0.25 ± 0.06 for the anidulafungin-resistant and 0.37 ± 0.04 and 0.11 ± 0.03 for anidulafungin-susceptible isolates. The difference between the XTT-absorbance of drug-free and drug-treated wells were 0.102 ± 0.07 for the resistant and 0.266 ± 0.04 for the susceptible isolates, a significant difference with p = 0.0001. ROC curve analysis identified an XTT-absorbance difference between the 0.06 mg/L-containing well and the drug-free well of 0.186 at 5.5 h with sensitivity 100% and specificity was 88.89% in detecting anidulafungin-resistant strains.
Conclusions: A simple, cheap and fast phenotypic test was developed using the XTT dye with high specificity and sensitivity in detecting fluconazole-resistant and anidulafungin-resistant C. glabrata isolates within 7.5 h and 5.5 h, respectively. This method can generate phenotypic resistance results within the time frame of molecular tests.

P069 Diagnostic Value of Galactomannan Lateral Flow Device in Respiratory and Serum Samples for Patients with COVID-19 Associated Pulmonary Aspergillosis (CAPA)

William Hurt 1, Tihana Bicinic 1, Lewis White 3, Jonathan Youngs 1, Duncan Wyncoll 2, Yusuff Hakeem 4, Phillip Hopkins 5, Susannah Leaver 6, Matt Wise 7, Silke Schelenz 5 and Anna Goodman 2
  • 1 St. Georges University
  • 2 Guy’s and St. Thomas’ NHS Trust
  • 3 Public Health Wales
  • 4 University Hospitals of Leicester NHS Trust
  • 5 King’s College Hospital NHS Trust
  • 6 St. Georges University Hospitals NHS Trust
  • 7 University Hospital of Wales NHS Trust
Objectives: To evaluate the performance characteristics of the IMMY aspergillus lateral flow device in serum and respiratory samples for the diagnosis of pulmonary aspergillosis in intubated and ventilated patients with COVID-19.
Materials & Methods: ASpiFlu (ISRCTN51287266; IRAS 271269) is a prospective, multicentre, observational cohort study at 5 UK hospitals including 2 extra corporal membrane oxygenation (ECMO) centres, aiming to estimate the incidence of CAPA in ventilated patients with COVID-19, and to validate novel point-of-care tests for diagnosing CAPA in the ICU.
A diagnosis of pulmonary aspergillosis relies on one of the following: a positive Aspergillus culture from a deep respiratory sample, or a positive PCR/galactomannan antigen from a deep respiratory or serum sample. The sensitivity of culture is poor [1], and PCR testing and galactomannan EIA is usually only performed at specialist centres as send away tests, resulting in long turn around times with the potential to delay diagnosis. Lateral flow galactomannan testing has been show to be comparable to galactomannan EIA testing for the diagnosis of pulmonary aspergillosis in BAL fluid from neutropenic and non-neutropenic patients [2] and is implementable as a point of care test. We therefore plan to analyse its performance in the setting of CAPA on the ICU, where its use has the potential to improve time to diagnosis.
From March 2020–March 2021, 258 COVID19 patients were prospectively enrolled. Study sampling included 2 sera taken one week apart as well as any leftover respiratory samples (tracheal aspirates, non-directed bronchoalveolar lavage and bronchoalveolar lavage). Fungal cultures were performed at study sites as per standard of care. Galactomannan EIA, Aspergillus PCR and IMMY lateral flow testing will be performed at the Welsh mycology reference centre on all sera and respiratory samples in June–July 2021. CAPA was defined as proven, probable and possible according to 2020 ECMM/ISHAM Consensus Criteria [3].
Results: Patient enrolment is complete and retrospective sample testing is currently ongoing but will be complete by August 2021. Data on incidence will be reported at ECCMID 2021, we expect this to be between 5–10%. The sensitivity, specificity, negative and positive predictive value of the IMMY galactomannan lateral flow testing will be calculated against proven/probable and possible CAPA. Modelling will also be performed to evaluate the potential cost-effectiveness of testing when compared to conventional testing using galactomannan EIA and culture. This will include potential time saved to diagnosis as well as the impact on antifungal use, extrapolated from the clinical information collected for patients enrolled into the Aspiflu study.
Conclusions: Aspiflu is the largest prospective study of CAPA incidence and includes patients from multiple UK ITUs, including 2 ECMO centres. The number of samples (~180 respiratory and ~500 sera) ensures that we are well placed to report on test performance. Aspergillus PCR, and galactomannan antigen EIA will performed in parallel on every sample enabling comparison against other recommended testing modalities.
References
  • Meersseman, W.; Lagrou, K.; Maertens, J. Galactomannan in bronchoalveolar lavage fluid: A tool for diagnosing aspergillosis in intensive care unit patients. Am. J. Respir. Crit. Care Med. 2008, 177, 27–34.
  • Jenks, J.D.; Mehta, S.R.; Taplitz, R. Point-of care Diagnosis of Invasive Aspergillosis in in Non-Neutropenic Patients: Aspergillus Galactomannan Lateral Flow Assay vs. Aspergillus-specific Lateral Flow device test in Bronchoalveolar Lavage. Mycoses 2019, 62, 230–236.
  • Koehler, P.; Bassetti, M.; Chakrabarti, A. Defining and managing COVID-19 associted pulmonary aspergillosis: 2020 ECMM/ISHAM consensus criteria for reseach and clinical guidance. Lancet 2020, 21, e149–e162.

P070 Phenotypic, Genotypic and Proteomic Identification of Trichosporon Species: A Globally Emerging Yeast of Medical Importance

Luciana da Silva Ruiz 1, Bruna Rossini Lara 1,2, Bruno Braidotti de Camargo 2, Claudete Rodrigues Paula 3, Regina Teixeira Barbieri Ramos 3, Diniz Pereira Leite Junior 4, Hans Garcia Garces 2, Mariana Volpe Arnoni 5,6, Mônica Silveira 7, Viviane Mazo Fávero Gimenes 8, Lumena Pereira Machado Siqueira 8, Juliana Possatto Fernandes Takahashi 9, Márcia de Souza Carvalho Melhem 9, Mário Mendes Bonci 3, Virgínia Bodelão Richini-Pereira 1 and Laís Anversa 1
  • 1 Adolfo Lutz Institute (IAL)
  • 2 São Paulo State University (Unesp), Institute of Biosciences
  • 3 University of São Paulo (USP), School of Dentistry
  • 4 Faculty of Medicine, Federal University of Mato Grosso (UFMT)
  • 5 Irmandade da Santa Casa de Misericórdia de São Paulo
  • 6 Darcy Vargas Children’s Hospital
  • 7 Bauru State Hospital (HEB)
  • 8 University of São Paulo (USP), Institute of Tropical Medicine
  • 9 Adolfo Lutz Central Institute (IAL)
Objectives: The present study aimed to compared the phenotypic, genotypic and mass-spectrometry (MALDI-TOF) identification of 59 yeasts of the genus Trichosporon. MALDI-TOF, in particular, will be compared to a molecular technique (gold standard).
Materials & Methods: This research included 59 yeast samples of the genus Trichosporon, 44 of which were of human origin, four of animal origin and 11 of environmental origin. The samples, previously identified as belonging to the genus Trichosporon, are part of the Collections at the following Brazilian laboratories: Laboratory of Mycology and Parasitology, Adolfo Lutz Institute (IAL) CLR II, Bauru-SP; Laboratory of Pathogenic Yeasts, School of Dentistry, University of São Paulo, São Paulo-SP; Laboratory of Mycology, Department of Microbiology and Immunology, São Paulo State University, Botucatu-SP; Laboratory of Research, Federal University of Mato Grosso, Cuiaba-MT; and Institute of Tropical Medicine, University of São Paulo, São Paulo-SP. For phenotypic identification, all samples were initially cultured on chromogenic medium, by the method of exhaustion. The yeasts also had their macroscopic, microscopic, reproductive and physiological characteristics studied according to the methods recommended. Tests included slide microculture on corn meal agar and Tween 80, urease test, tolerance to 0.1% cycloheximide, growth at 37 °C, auxanogram (carbohydrate and nitrogen assimilation) and zymogram (carbohydrate fermentation). Species of the genus Trichosporon were identified with the keys described in the literature. The MALDI-TOF were employed in the study for proteomic identification and the results were expressed as scores; values ≥2000 were adopted for species-level identification, values between 1700 and 1999 were adopted for genus-level identification, and values <1700 were not considered reliable for identification. The strains were molecularly identified by rDNA IGS1 region analysis. IGS1 region amplification was obtained with primers 26SF and 5SR. The amplified products were purified and sequenced. Then, amplicons were visualized in Chromas 2.3 Technelysium software, aligned by MEGA 7 program, applied to BLASTn and compared with the sequences available at GenBank. Maximal identity over 98% was accepted as molecular identification of the species.
Results: Concordance level between the traditional phenotypic method and the molecular technique (gold standard) in the identification of all 59 Trichosporon samples was 59.3%. Identification concordance between MALDI-TOF spectrometry and the molecular technique was 71.2%. No isolate of environmental origin was identifiable by MALDI-TOF mass spectrometry, and 100% of such environmental isolates were discordant for IGS region sequencing and phenotypic characterization. Both comparisons evidenced greatest concordance in the identification of T. asahii. The species T. debeurmannianum, T. dermatis, T. venhuisii and T. insectorum were not properly identified by both MALDI-TOF and the phenotypic technique.
Conclusions: MALDI-TOF, in particular, seems to be appropriate to investigate yeasts of the genus Trichosporon; however, database updates are still necessary, especially for species that are not common in the clinical routine.

P071 Use of Serial Bronchoalveolar Lavage Fluid Aspergillus Galactomannan in Patients with Invasive Pulmonary Aspergillosis

Daniel ZP Friedman 1, Elitza Theel 2, Randall Walker 1, Raymund Razonable 1 and Paschalis Vergidis 1
  • 1 Mayo Clinic, Department of Medicine, Division of Infectious Diseases
  • 2 Mayo Clinic, Department of Laboratory Medicine and Pathology, Division of Clinical Microbiology
Objectives: Detection of Aspergillus galactomannan (GM) from serum and bronchoalveolar lavage (BAL) fluid can support the diagnosis of invasive pulmonary aspergillosis (IPA) in immunocompromised hosts. If positive, serum GM can be useful to monitor disease progression or improvement. No studies have investigated if changes in BAL GM can predict treatment response in a similar way to serum GM. Our aim was to describe the changes in BAL GM over time and determine if a serial change in BAL GM value correlated with clinical disease course while on antifungal therapy.
Methods: We performed a retrospective review of patients with a positive BAL GM collected January 2011 to February 2021. We identified patients from laboratory records and included those with a positive BAL GM and a follow-up GM collected within 7–100 days. Medical records were reviewed to confirm IPA diagnosis and to collect demographics, clinical characteristics, radiographic findings, therapy and outcomes.
We determined the patients’ response to therapy by comparing clinical symptoms and CT imaging findings from baseline to follow-up assessments. We used MSG/EORTC definitions to characterize the clinical response as a success or failure. GM change was considered concordant with clinical response: (i) if a decline of ≥0.500 in GM was observed in a patient with successful clinical outcome, or (ii) if an increase in GM was observed in a patient with clinical failure. Chi-square test, Student’s t-test or Mann-Whitney test were used to compare characteristics between patients with a decreasing vs. increasing GM and those with clinical success vs. failure.
Results: We found 218 patients who had serial BAL GM testing within the study period. Of those, 52 met criteria for IPA and had follow-up testing within 7–100 days. The mean age was 60.7 years (range = 11.4–80.5) and 67.3% (n = 35) were male. 98.1% (n = 51) of patients received immunosuppressive treatment in the preceding 60 days, 56.7% (n = 29) had a hematologic malignancy, 51.9% (n = 27) had severe neutropenia and 33.3% (n = 17) received a solid organ transplant. 46 patients (88%) had proven or probable IPA. The median baseline GM value was 3.483 (range = 0.606–3.750).
The median time to repeat GM measurement was 32 days (range = 7–89 days) and the meadian time to clinical reassessment was 49 days (range = 8–428 days).
Thirty patients (58%) had a decrease in BAL GM value by ≥0.500 and 13 patients (25%) had clinical success. Clinical success occured in 30.0% of those with decreasing GM vs. 18.2% in those increasing GM (p = 0.331). The median magnitude of GM decrease was 1.168 vs. 0.755 (p = 0.491) between those with clinical success and failure. Seventeen of 22 patients (77.3%) with an increase in GM had clinical failure.
Conclusions: In our cohort, a decrease in BAL GM was not predcitive of a successful outcome. However, stability or an increase in GM was more likely to occur in those with clinical deterioration. Discordant BAL GM response may reflect variability in bronchoscopist technique, sampling location or dilution effect. A standardized, prospective study would be most helpful to assess the use of serial BAL GM to predict clinical outcomes.

P072 Antibodies against Candida albicans Germ Tubes Recognize Potential Biomarkers of Invasive Candidiasis

Marta Bregón 1,2, Giulia Carrano 1, Ander Díez 1,2, Pilar Menéndez-Manjón 1,2, Iñigo Fernández de Larrinoa 3, Inés Arrieta 1 and Maria Dolores Moragues 1
  • 1 Department of Nursing, University of the Basque Country UPV/EHU
  • 2 Department of Immunology, Microbiology and Parasitology, University of the Basque Country UPV/EHU
  • 3 Department of Organic Chemistry, University of the Basque Country UPV/EHU
Objectives: Identification of proteins recognized by antibodies that react with superficial antigens of Candida albicans germ tubes (CAGTA), expressed in a cDNA phage library of Candida albicans growing as mycelia.
Materials & Methods: The mycelial C. albicans SC5314 cDNA library was harboured in Lambda Zap II phage, and was kindly provided by Dr P. Sundstrom and Dr W. Fonzi. The library screening was carried out with a CAGTA-enriched serum fraction of a White New Zealand rabbit infected with C. albicans SC5314. After two re-screening rounds, positive-clone inserts were amplified and sequenced.
Target proteins were identified with the BLAST tool and aligned with the BioEdit program. Information about the proteins was obtained through the databases UniProt and Candida Genome Database. Antigenic determinants on proteins were predicted with the Kolaskar-Tongaonkar algorithm (http://imed.med.ucm.es/Tools/antigenic.pl).
Results: The analysis of 1.5·106 lysis plaques forming units returned 82 positive clones, of which 29 were not in the correct reading frame. More than half of the 53 phages with in-frame coded proteins matched the hyphally-regulated cell wall protein (Hyr1), while others corresponded to enolase 1 (Eno1), cystathionine γ-lyase (Cys3), aminopeptidase 2 (Ape2) and the coatomer subunit gamma (Sec21) of C. albicans.
According to the UniProt and Candida Genome Database information, except for the coatomer subunit gamma and enolase, the other proteins are mainly located in the cell wall of the fungus and/or have been related with virulence, biofilm formation or the yeast-to-hyphae transition of C. albicans. Even though enolase is a cytoplasmic enzyme, it has also been found in the cell wall, and several studies support its utility as a biomarker for Invasive Candidiasis. All the proteins identified by CAGTA in this study showed antigenic regions that could be suitable candidates for immunodiagnostic purposes.
Conclusions: The CAGTA enriched serum fraction of an animal model of Invasive Candidiasis recognizes proteins expressed in a cDNA library of the fungus Candida albicans growing as mycelia.
Most in-frame codified proteins recognized by the CAGTA-enriched serum fraction are related with the C. albicans yeast-to-hyphae or the biofilm formation processes and could be suitable candidates as biomarkers for the diagnosis of Invasive Candidiasis.
Financial support: M. Bregón was recipient of a grant from the UPV/EHU (PIF19/316) and P. Menéndez-Manjón was recipient of a grant from the Basque Government. GEIFI research team was supported by the project IT913-16 from the Basque Government.

P073 Detection and Identification of Aspergillosis and Mucormycosis Etiologic Agents in Biological Samples of Patients Using Multiplex Real Time PCR

Svetlana Ignatyeva 1, Tatiana Bogomolova 1, Yriy Avdeenko 1, Olda Shadrivova 1, Sofia Khostelidi 1, Ylia Borzova 1, Ekaterina Desyatik 1, Olga Kozlova 1, Alisa Volkova 2, Marina Popova 2, Ylia Chudinovskikh 3, Iliya Zyuzgin 3, Olga Uspenskaya 4, Nikolay Klimko 1 and Natalya Vasilyeva 1
  • 1 I. Metchnikov North-western State Medical University, Kashkin Research Institute Of Medical Mycology
  • 2 I. Pavlov First Saint Petersburg State Medical University
  • 3 Petrov Scientific and Research Oncology Institute of the Ministry of Health of Russia
  • 4 Leningrad Regional Clinical Hospital
Objectives: The aim of this study was to evaluate a multiplex real time PCR with High Resolution Melt analysis (mHRM-RT-PCR) on clinical samples for simultaneous detection and identification of Aspergillus spp. and mucormycetes in biological samples of patients with mycosis.
Methods: We tested 47 BAL, 29 native tissue and formalin-fixed paraffin-embedded tissue samples from 59 patients with aspergillosis and 17 patients with mucormycosis in Saint-Petersburg between 2013 and 2020 yy. As controls, 34 tissue and 30 BAL samples were tested from patients without mycoses. Fungal DNA was extracted from clinical samples by a chloroform-isoamyl extraction method. DNA amplification was performed using Aspergillus- and mucormycetes-specific primers pairs separately and EvaGreen based mHRM-RT-PCR on Rotor-Gene 6000 cycler.
Results: In clinical samples from patients with aspergillosis and mucormycosis the mHRM-RT-PCR allowed to identify representatives of Aspergillus spp. to the genus and mucormycetes—to the species level: Rhizopus arrhizus, Mucor racemosus, Rhizomucor pusillus and Lichtheimia corymbifera. Direct microscopic examination of 38 BAL from patients with aspergillosis and 9 BAL from patients with mucormycosis was positive in 49% and 56% cases, respectively. Aspergillus spp. were isolated in 84% and mucormycetes in 89% cases. Sensitivity of PCR assay in BAL was 89%. In one patient mHRM-RT-PCR detected a mixed infection by Aspergillus and Rhizopus arrhizus. In patients with aspergillosis direct microscopy of 15 native tissue samples was positive in 80% cases. Only in 2 of 4 native tissue samples of patients with mucormycosis and positive direct microscopy culture was positive (L. corymbifera and R. arrhizus was isolated). mHRM-RT-PCR detected in 3 of 4 samples L. corymbifera and in 1 sample -R. arrhizus. PCR assay was positive in formalin-fixed paraffin-embedded tissue samples of 95% patients with aspergillosis and 100% patients with mucormycosis. mHRM-RT-PCR allowed to identify the representatives of mucormycetes: Lichtheimia corymbifera in 6 and Rhizomucor pusillus in 3, Rhizopus microsporus in 1 from 12 samples. In biological specimens of 2 patients the PCR assay detected a mixed infection by Aspergillus spp. + Rhizopus microsporus and Aspergillus spp. + Rhizopus arrhizus.The results of PCR assay in patients with mycosis and control patients correlated with results of microscopy and culture from BAL in 63 from 67cases (94%) and results of histological investigations from tissue samples—in 96% cases.
Conclusions: In patients with aspergillosis and mucormycosis the sensitivity of PCR assay depended according the type of biological specimens. The mHRM-RT-PCR may be a useful tool for detection of etiologic agents of mycoses, particularly in the case of a mixed infection by Aspergillus and mucormycetes.

P075 Molecular Confirmation of the Phenotypic Identification of Clinical Strains of non-albicans Yeasts

Theopisti Sarmourli, Argyri Togkousidou, Aikaterina Poulopoulou, Panagiotis Siasios and Timoleon-Achilleas Vyzantiadis
Department of Microbiology, Medical School, Aristotle University of Thessaloniki
Objectives: Fungal infections are increasingly recognized as a serious concern for human health, especially in immunocompromised patients and those hospitalised with underlying conditions. Over the last decades an increasing number of cases of infections with non-albicans yeasts, have been identified by the use of morphologiacla/phenotypic and/or molecular methods. More recently, Candida auris, a multidrug resistant yeast of great public health concern, has been recognised as a cause of invasive infections and often misdiagnosed as many diagnostic platforms were not able (at least previously) to identify it. The purpose of this retrospective study was the sequence-based species delineation of several yeasts strains, from the fungal collection of our laboratory, in an effort to confirm the previous non-molecular identifications and also to check for possible misidentifications of C. auris during the last decade.
Materials and methods: A total of forty-eight isolates from deep or even superficial specimens referred for mycological diagnosis to our laboratory during the last decade were selected for analysis. All yeasts found in the collection that could be misidentified (according to the literature) instead of Candida auris were included. These isolates were previously identified by the use of microscopy, culture on several mycological media (including chromogenic media) and at different temperatures (30 °C and 35 °C), germ tube testing and biochemical testing by API ID 32C, as Candida parapsilosis, C. lusitaniae, C. kefyr, C. guillermondii, C. famata or S. cerevisiae. There was not any Candida haemulonii. From the large population of C. parapsilosis, there were selected only those that in API ID 32C, although they had a very good percentage of identification (%id), they presented a T index lower than 0.90, while its optimal value is 1.0. All isolates were recultivated on malt extract agar and the fungal DNA was extracted by heating at 95 °C under buffered conditions, followed by strong agitation and centrifugation. The extracts were molecularly analysed by the amplification and sequencing of the internal transcribed spacer 1 or 2 (ITS1 or ITS2) region of the fungal ribosomal DNA (rDNA) and compared according to the BLAST® tool and ISHAM ITS database. The final identifications were deposited in GenBank database.
Results: All isolates’ phenotypical identifications were confirmed by the present molecular procedure and no misidentifications were revealed. The only differences concerned the changes in several species’ names that occurred during the last years, connected mostly to the fungal teleomorph. Additionally, it was proved that among all these probably doubtful identifications, there was not any Candida auris, although most of the species tested have been previously described in the literature as possible sporadic misidentifications of C. auris.
Conclusions: The identification of yeasts based on phenotypical characteristics has a good accuracy, and is cost effective and clinically relevant. Sequencing, on the other hand, is a confirmative method, but requires more hands-on time and is not available in most clinical laboratories. Candida auris was not identified among the strains analysed. This, combined to the small number of reports, might indicate that the existence of the fungus in our geographical area is still low.

P076 Performance of Aspergillus galaktomannan Lateral Flow Assay for Diagnosis of Invasive Aspergillosis in Adult Cancer Patients

Ozlem Alhan Guncu 1, Zeynep Ture Yuce 2, Mehmet Mucahit Guncu 3, Huseyin Nadir Kahveci 2, Asu Fergun Yilmaz 4, Zekaver Odabasi 1
  • 1 Department of Infectious Diseases and Clinical Microbiology, Faculty of Medicine, Marmara University
  • 2 Department of Infectious Diseases and Clinical Microbiology, Faculty of Medicine, Erciyes University
  • 3 Department of Medical Microbiology, Institute of Health Sciences, Marmara University
  • 4 Department of Hematology, Faculty of Medicine, Marmara University
Objectives: Invasive aspergillosis (IA) is associated with high mortality rates in cancer patients. The gold standard method for diagnosis of IA is a positive culture for Aspergillus in tissue biopsy, but biopsy is often not performed in patients with hematological malignancies. Galactomannan (GM) detection with enzyme-linked immunoassay (ELISA) is the most used non-culture method in screening and diagnosis for IA. Aspergillus galactomannan lateral flow assay (LFA) which is a cheaper and faster method than ELISA is promising for improving the diagnosis of IA. The performance of LFA in serum and bronchoalveolar lavage fluid (BALF) of cancer patients was evaluated in this multicentre study.
Materials & Methods: In this prospective multicentre study, we included 58 patients with hematological or oncological malignancies. All of the patients had nodule, cavity, air crescent sign, or lobar consolidation on their chest tomography. Only serum samples of 32 patients and serum and BALF samples of 26 patients were taken between 2019 and 2021 in two university hospitals in Turkey. GM ELISA (Platelia Aspergillus EIA, Bio-Rad®) and LFA (IMMY®) were studied from serum and BALF samples. All patients are grouped as ‘proven’, ‘probable’ and ‘possible’ IA according to the EORTC/MSG guideline published December 2019.
Results: The majority of patients had hematological malignancy (n = 48, 82%) and 13 patients of these group had bone marrow transplantation. According to EORTC/MSC criteria, cases were classified as proven (n = 2), probable (n = 20) and possible (n = 36). Twenty-one (36.2%) patients were receiving antifungal prophylaxis but only 4 patients had anti-mold prophylaxis (all were classified as possible IA). The study demonstrated a sensitivity of 81,8% and specificity of 91.6% at a 1.0 optimal density index (ODI) cut-off for LFA. When the cut-off point was 1.5 ODİ, the positive predictive value and specificity were found to be 100%, but the specificity of LFA dropped to 68% (Table 1). While 92.8% of patients with serum ELISA positive had LFA positive (13/14), 95.4% of patients with negative serum ELISA had LFA negative (42/44) at a 1.0 ODI cut-off for ELISA and LFA (Table 2).
Conclusions: Aspergillus galactomannan LFA seems as good as GM ELİSA for the diagnosis of IA in cancer patients. However, studies with larger samples are needed to determine the ideal cut-off point of LFA.

P077 Evaluation of the New Micronaut-AM System to Determine the MICs of Candida spp.

Christine Bonnal 1, Nikolett Szabo-Gyurtane 1, Sandrine Houzé 1 and Françoise Dromer 2
  • 1 Hôpital Bichat Claude Bernard
  • 2 Institut Pasteur
Objectives: The determination of antifungal MIC is often challenging because the reference methods (CLSI or EUCAST) rely on measuring growth of a defined fungal inoculum in a specific growth broth in the presence of different concentrations of the antifungal drug. These methodologies are time-consuming. Therefore, Etest method is often prefered in routine but also has some limitations, mainly due to the difficulty to read the results and the absence of breakpoints for certain antifungal drugs.
Micronaut-AM system (Merlin Diagnostika, GmbH, Berlin, Germany) is a new method used to determine the antifungal MIC (fluconazole, voriconazole, posaconazole, caspofungin, anidulafungin, micafungin, amphotericin B and 5-flucytosine) based on EUCAST technic associated with a colorimetric reading limiting the trailing growth effect and facilitating the reading. It is only validated for Candida spp. and Cryptoccus spp. The aim of our study was to compare the results obtained with Micronaut-AM and the EUCAST technique for Candida spp.
Materials & Methods: Strains of Candida spp. for which the antifungal susceptibility have already been measured with the EUCAST technic performed by the National Reference Center of Invasive Mycosis (Institut Pasteur, France) were included (anidulafungin was not available). Antifungal MICs of these strains at a concentration of 0.5 McFarland were measured by using Micronaut-RPMI-1640 growth medium completed with the AST-Indicator. Each antifungal is available in up to 11 concentrations. Growth of the fungi is indicated by a color change from blue to pink. The MIC was considered the lowest concentration leading to colorimetric changes after 24 h to 48 h of incubation at 35 °C (read visually). Results were interpreted using the EUCAST 2018 susceptibility breakpoints.
The results obtained by the two technics (Micronaut-AM and EUCAST) were compared by using the number of dilutions between the MICs measured for each antifungal and each strain. Results were considered as concordant if the difference of MIC values was −2, −1, 0, 1 or 2. When the MICs were discordant, the interpretation of the sensitivity of the strain to the antifungal (Susceptible or Resistant) was also evaluated.
Results: Twenty-one strains were studied: 9 C. albicans, 3 C. parapsilosis, 3 C. glabrata, 2 C. lusitaniae and 1 of each, C. krusei, C. tropicalis, C. kefyr, and C. metapsilosis. The MICs obtained by the 2 technics were concordant for 19/21 strains for voriconazole, amphtericin B, fluconazole, micafungin, 18/21 strains for 5-fluorocytosin, 17/21 for posaconazole, but only 14/21 for caspofungine. Anyway, it never led to a modified interpretation of the sensitivity of the strains. The Micronaut-AM was easy to perform and to read whatever the Candida species.
Conclusions: This evaluation confirms the interest of Micronaut-AM for determining antifungal sensitivity of Candida spp. It is easier to perform than current methodes (Etest and EUCAST) because the reagents are ready to use and offers a greater number of breakpoints to interprete the results. Moreover a photometric reading (Micronaut Skan) is also available with the Micronaut Software facilitating the interpretation. Complementary evaluations are needed for Cryptococcus spp. and rare Candida spp.

P078 Mycetoma in an Unusual Location, Nigeria

Iriagbonse Osaigbovo 1,2, Ikponmwosa Obahiagbon 1,2 and Dele Imasogie 1,2
  • 1 University Of Benin
  • 2 Teaching Hospital, University of Benin
Objectives: Mycetoma is a neglected tropical disease affecting skin, subcutaneous tissue and sometimes muscle, bone and contiguous organs. It may be of bacterial or fungal origin and typically affects the lower extremities. The objective of this report is to describe an unusual case of mycetoma in Southern Nigeria and the difficulties experienced in diagnosis.
Materials & Methods: An eleven year old school girl presented with a swelling on the nape of her neck of a year’s duration. The swelling consisted of multiple nodules, some with sinuses which on occasion drained purulent material. Her mother gave a history of onset about 2 weeks after she had a haircut in a barbing salon. There was no obvious trauma. The lesion began as a single ‘boil’ which gradually became multiple and recurrent. It was associated with itching. The swelling did not respond to antibiotics procured over the counter. She presented at the dermatology clinic and a diagnosis of carbuncle was made for which she was placed on Clindamycin for a week with no respite. She was then referred to clinical microbiology for review as a possible case of deep mycosis. Aspiration of one of the fluctuant nodules was done for microscopy and fungal culture and a skin biopsy was advised for both microbiology and histology.
Results: Aspiration yielded scanty seropurulent material. There were no grains seen or felt. Both Gram stained and Giemsa stained smears showed numerous polymorphonuclear cells, mostly neutrophils but with significant number of eosinophils and a few macrophages. No organisms were seen. Culture yielded no growth. Due to inavailability of funds, the patient did not do a biopsy but began a course of itraconazole 200 mg b.d prescribed by the dermatologist. On follow-up two weeks later, there was a marked improvement with regression of the lesion although some nodules remained. A biopsy was done at this time and sample sent for histology but not microbiology. Haematoxylin and eosin stained sections showed fibrosis in the dermis and granulomas made up of predominantly neutrophils. No fungi were seen on PAS. However, Ziehl Nielsen stained section showed an irregularly shaped grain with central clearing. A diagnosis of mycetoma was made possibly due to a Nocardia species.
Conclusions: This case of mycetoma is unusual because of the location at the nape of the neck. The aetiology is also unclear because microbiological analysis did not yield the causative agent. There was clinical response to itraconazole suggesting a fungal aetiology. However histopathological examination of a bipopsy taken from a healing lesion suggested an actinomycetoma, specifically one caused by Nocardia. Although results are not guaranteed from microbiological analysis, failure to send specimens for microbiology may hinder diagnosis. Improper tissue processing and inexperience may also hamper diagnosis especially as mycetomas are seen more in the central and northern states of Nigeria. Multidisciplinary approaches and application of newer techniques such as molecular methods may enhance the diagnosis of mycetoma in our setting.

P079 Development of Dermatophytes Specific Medium

Jihane Kabtani, Dounia Bergoug and Stéphane Ranque
IHU—Mediterranee Infection
Introduction: Dermatophytes are microscopic filamentous fungi, mainly characterized by their affinity for keratin. The species of the Trichophyton rubrum complex constitute the most common agents of dermatophytosis, which gave Trichophyton rubrum the position of the most worldwide spread dermatophyte. Dermatophyte’s culture is very important in the process of the mycological diagnosis, and the use of the reference medium Sabouraud, supplemented with antibacterials (chloramphenicol ± gentamicin) and cycloheximide (Actidione®), does not always prevent contaminations by saprophytic fungi. A lot of studies have attempted to solve the problem, without success.
Objectives: The aim of our study is to develop a specific culture medium for these keratinophils, with an inhibitory effect on the growth of Aspergillus fumigatus, which represents the major contaminant.
Methods and Materials: To achieving this, we used two different approaches. We first screened the activity of 9 vital dyes (Janus green B, Bromocresol purple, Amaranth, Brilliant cresyl blue, Nigrosin, Ponceau BS, Red congo, Orange II and Rhodamine B) on type strains of Trichophyton rubrum and Aspergillus fumigatus.
Then, in order to phenotypically characterize the two fungi, we performed phenotypic tests with the Biolog’s advanced phenotypic technology using different type of MicroPlates (Filamentous Fungi MicroPlates (Gen III) for carbon sources assimilation, PM 1 to 10 for pH/Osmolytes/Nitrogen/Phosphorus/Sulfur sources and PM 21 to 25 for fungi chemical sensitivity tests). With the purpose to find one or several substrates assimilated by the Aspergillus fumigatus and not by Trichophyton rubrum, and using it to have an optimized medium.
Results: Three dyes showed growth inhibition of Aspergillus fumigatus and maintenance of dermatophyte’s one. The association between these three dyes was not as effective as their individual use. Concerning the second approach, all the substrates assimilated by Trichophyton rubrum, were also by Aspergillus fumigatus.
Conclusions: The dyes approach was more relevant. For proving its efficiency, the optimized media with dyes were tested on other clinically relevant dermatophytes contaminating fungi, such as; Aspergillus niger, Aspergillus oryzae and Aspergillus tubingensis.
Keywords: Trichophyton rubrum; dermatophytes; Aspergillus fumigatus; contamination; culture; dyes; biology

P080 Clinical and Epidemiological Features of Patients with Co-Infection (Aspergillosis\Tuberculosis)

Irina Burmistrova, Alexandra Gracheva, Anna Panova, Tatiana Tiulkova and Irina Vasilieva
National Medical Research Centre for Phthisiopulmonology and Infectious Diseases
Aspergillosis is mainly diagnosed in chronic forms of tuberculosis with destruction of lung tissue and complicates its course.
Objective: to study the clinical and epidemiological features of co-infection (aspergillosis/tuberculosis) with lung damage.
Methods: We examined 101 patients with tuberculosis without HIV infection aged 21–83 years, who were treated in 2019–2020 in the clinic in our center. All patients underwent bronchoscopy with BAL(Bronchoalveolar fluid) sampling for microbiological and mycological studies. The groups were formed after the detection of aspergillosis (main, n = 53) and without it (control, n = 48). The average age in the main group was 46.3± in the control group—39.4 ± l (p > 0.05). In the main group, patients over 60 years of age were registered in 24.5%, and in the control group-in 12.5% of cases (p = 0.197). In both groups, men predominated by 58.8% and 72.9%, respectively (p = 0.083). The patients’ living conditions, social status, clinical forms of tuberculosis, the presence of destruction and damage to the bronchi, the registration group and concomitant pathology, the level of neutrophils and lymphocytes (%) were analyzed. For statistical processing, the exact Fisher test and the Student’s t-test with the Levin correction were used.
Results: Both groups were dominated by patients living in a city apartment (71.7% and 64.6%, respectively). People of retirement age were found in the main group in 20.8%, and in the control group-in 6.3% (p = 0.05). Representatives of other social groups met equally often. No differences were found in the structure of clinical forms of tuberculosis. Limited and widespread lung lesions did not differ in the study groups. The presence of destruction was found in 52.8% and 66.7% (p = 0.106), bronchial lesions in 33.3% and 36.0% (p = 0.871). We noted that co-infection (aspergillosis and tuberculosis) was detected in 47.2% of newly diagnosed patients, and tuberculosis lesions without aspergillosis occurred in half of the cases (p = 0.629), that is, we can assume a change in the pathomorphosis of the infection. Patients with chronic viral hepatitis (17.0% and 12.5%) and hypertension (7.5% and 12.5%) predominated among the comorbidities; diabetes mellitus, bronchiectatic disease and other diseases were registered in isolated cases in both groups. In the blood parameters, the level of neutrophils was 53.9 ± and 55.3 ± (p > 0.05), lymphocytes 29.3 ± and 28.0 ± (p > 0.05), respectively.
Conclusions: It was revealed that co-infection in 20.8% of cases was registered in persons of retirement age without clinical and laboratory signs of immunodeficiency. Registration of aspergillosis existed not only among patients with chronic tuberculosis, but also in newly diagnosed patients. This fact may indicate the pathomorphosis of the infection, the spread of aspergillosis in society. Other clinical and epidemiological features in patients with co-infection (aspergillosis/tuberculosis) were not revealed by us. Therefore, mycological examination should be carried out in all patients with tuberculosis of the respiratory system together with microbiological examination during bronchoscopy.

P081 Polyol Is an Unusual Marker of Malassezia spp. Revealing under MALDI-TOF-Mass-Spectrometry

Tatyana Bogdanova 1, Igor Riabinin 1,2, Andrey Alekseev 1 and Natalya Vasilyeva 1,2
  • 1 Department of Medical Microbiology, North-Western State Medical University n.a. I.I. Mechnikov
  • 2 Kaschkin Research Institute of Medical Mycology, North-Western State Medical University n.a. I.I. Mechnikov
Objectives: The aim of the study was the revealing of peaks in identification MALDI-mass-spectra of Malassezia cells, which is most likely to have a non-polypeptide nature.
Materials & Methods: 113 Malassezia spp. strains were isolated from skin of volunteers and domestic animals (dogs, cats) and identified according to Ramadan S., 2012. Cultures were grown on modified Leeming-Notman medium at 32 °C for 5–7 days for mass-spectrometry of cell biomass. Cultures’ materials were prepared according to the manufacturer’s protocol with double treatment with formic acid under “sandwich” scheme. MALDI-TOF-mass-spectrometry was performed on Autoflex speed TOF/TOF (Bruker Daltonik GmbH, Germany) in the MBT-mode. The resulting mass-spectra were processed in flexAnalysis.
Results: About 4.4% of the studied cultures had peculiar combinations of peaks in the low molecular weight range distinguishable up to about 3.5 kDa along with typical protein and peptide peaks (see Figure 1). The combinations had the form of rhythmically repeating signals describing by apexes of a somewhat distorted parabolic contour. The structure of such complexes resembled a trace from the fragmentation of a polymer compound. To clarify the structure of this substance, the measurements of the molecular masses differences of ions (distance between the peaks) were made. ΔMr values were about 18–32 Da. Annotation made it possible to establish that such fragments belong to the =CH2 and =CH-OH groups located irregularly.
Figure 1. Low-mass segment of MALDI-mass-specter from Malassezia sympodialis culture. MS-visualization in flexAnalysis.
Conclusions: The genus Malassezia including 18 species which are identifying correctly by DNA-sequencing. MALDI-TOF-MS-based strategy for malasseziae identification is perspective, but there’re some difficulties, including the selection of optimal cultivation mode, low completeness of commercial main-spectral-profiles databases, as well as the peculiar chemical composition of malasseziae cells. Based on the obtained results we determined the compounds that form peculiar peak complexes as polyols of possibly linear structure. Most likely they are the products of the polyunsaturated fatty acids hydroxylation. Among representatives of >40 micromycetes genera similar findings were seen only in single strains of Meyerozyma guilliermondii and Phialophora verrucosa. We consider this metabolite as the species- or strain-specific biomarker for MALDI-identification of Malassezia spp. The most enigmatic fact remains the appearance at the time of MALDI-ionization in MBT-mode of chemical energy of such magnitude that is able to break carbon-carbon bonds.

P082 Antifungal Zone Diameter and MIC Correlation and Categorical Agreement for Candida auris Isolates from Pakistan

Joveria Farooqi, Sadaf Zaka, Faheem Naqvi and Kauser Jabeen
Aga Khan University
Objective: We determined correlation of zone diameters (ZD) of fluconazole (FLU) and caspofungin (CAS) with their respective MICs and CAS ZD with anidulafungin (ANI) and micafungin (MCF) minimal inhibitory concentrations (MIC). We also determined categorical agreement between the above pairs.
Methods: Data on Candida auris isolates was retrieved from the Aga Khan University Laboratory database from January 2020–April 2021. First isolates of Candida auris per patient from blood culture or other clinically significant sites were selected for analysis. The identification of C. auris was based on a combination of colony morphology and biochemical identification on API 20C AUX and Vitek2 system. Antifungal susceptibility was performed by broth microdilution on Sensititre® YeastOne and interpreted according to CDC guidelines for FLU, CAS, MCF and ANI. Disc diffusion was performed using Oxoid® discs with 25 µg FLU and 5 µg CAS on Mueller Hinton Agar (Oxoid, UK) with 2% dextrose and methylene blue and results recorded on worksheets but not reported to the patient. Zone diameter interpretation of <12 mm was taken as resistant for both FLU and CAS from Nunnally et al., (JCM 2021).
Results: A total of 118 isolates were identified, with 76 unique isolates. There were 58 (76.3%) male patients, median age was 63.5 years (IQR: 42.5–75.5). Nine (11.8%) isolates were from the community, 74 (97.3%) originating from Karachi. Fourteen patients (18.4%) were admitted in the ICU, while 24 (31.6%) had central lines. The isolates were from urine [41 (53.9%)], blood [22 (28.9%)], central venous catheter tips [6 (7.9%)], pus and tissue [n = 5 (6.6%)], and ear swabs [n = 2 (2.6%)]. Susceptibilities on MIC were available for 74 isolates for all drugs, on ZD 68 for FLU and 36 for CAS. There were 63/68 (82.9%) categorised as FLU resistant on ZD and 57/74 (75%) on MIC, none as CAS resistant on ZD, 10/74 (13.2%) on MIC, 1/72 (1.4%) as MCF resistant, and none as ANI resistant.
The median (IQR) for FLU ZD was 0 mm (0), CAS ZD 23 mm (20–26.75), FLU MIC 48 µg/mL (32–256), CAS MIC 0.12 µg/mL (0.12–0.25), ANI MIC 0.25 µg/mL (0.12–0.25) and MCF MIC 0.12 µg/mL (0.06–0.12). Spearman correlation results were FLU ZD-MIC (−0.032, p = 0.798), CAS ZD-MIC (−0.225, p = 0.187), CAS ZD-ANI MIC (−0.207, p = 0.225), CAS ZD-MCF MIC (−0.245, p = 0.162). There were 16/17 (94.1%) major errors and 4/51 (7.8%) very major errors for FLU, agreement 70.5%, while it was 30/36 (83.3%) for CAS, all discrepancies being major errors. CAS ZD, however, showed 100% agreement with ANI and MCF as there were no ANI and MCF resistant isolates among the 36 tested on disc.
Conclusions: Unlike Nunnally et al, C. auris ZD of FLU and CAS do not correlate well with their MICs, nor CAS with MIC of ANI or MCF in isolates from our center. Categorical agreement is also low for FLU and CAS, but should be explored further between CAS ZD and ANI and MCF MIC for resistant isolates.

P083 Direct Method for Rapid Identification of Candida Species from Fungus-Positive Bottles by Matrix-Assisted Laser Desorption Ionization Time-Of-Flight Mass Spectrometry

Anna Malchikova and Galina Klyasova
National Recearch Center For Hematology
Objectives: Reduction of time to the identification of Candida from fungus-positive bottles is a predictor of survival in patients with candidemia. In the study, we evaluated in-house method for rapid identification of Candida species from fungus-positive bottles and then compared it with routine conventional culture-based identification.
Materials & Methods: Prospective study was performed from 2016 to 2020 at the National Research Center for Hematology, Moscow. During the study period, all blood cultures (BC) bottles obtained from hematological patients were incubated in the BACTEC FX system (Becton Dickinson, USA) for microorganism growth monitoring. When BC bottle was detected as positive, the blood culture broth was deposited on a glass slide to be subjected to Gram staining. If yeast cells were detected by microscopy, the in-house method was used for the identification of yeasts. For that, BC media (5–6 mL) was transfer from fungus-positive bottles into MONOVETTE Serum Z (Sarstedt, Germany) with inert gel. In-house method included series section steps consisted from centrifugation, physically separates the blood cells and adding of 0.1% sodium dodecyl sulfate [1]. Routine conventional culture-based identification on Sabouraud dextrose agar (Oxoid, UK) was used simultaneously with the in-house method.
Results: During the study period, 14 fungus-positive bottles were obtained. The in-house method resulted in 78.6% (11/14) and 64.3% (9/14) identification rate at the genus and species level of Candida, respectively (Table 1). The identification of Candida to the species level was proofed in all cases by routine conventional culture-based method. Median time from the start of vials incubation in BACTEC FX system to identification of Candida by in-house method was shorter than by conventional culture-based identification and composed 38 h 05 min vs. 60 h 54 min (p = 0.039). The time spending to the identification of Candida by in-house method was 57 min, while by using of conventional culture-based identification was prolonged to 37 h.
Conclusions: Our in-house method was found to be in a good agreement with routine conventional culture-based identification. This technique is quick and consistent to identify Candida from fungus-positive bottles in less than 60 min, has a low cost in its implementation and provides helpful information for physicians when it comes to target therapy.
Reference
  • Klyasova, G.A.; Malchikova, A.O.; Dzhulakyan, U.L. RF Patent No. 2 739 758, 2020.

P084 The Role of (1–3) -Β-D-Glucan in the Diagnosis of Invasive Aspergillosis in Patients with COVID-19 Disease

Anna Katsiaflaka 1, Aikaterini Oikonomou 2, Ioanna Voulgaridi 1, Dimitrios Papadopoulos 2, Sotirios Papaoikonomou 1, Panagiotis Papamichalis 2, Apostolos Komnos 2, Maria Mavrouli 3, Georgia Vrioni 3 and Athanasios Tsakris 3
  • 1 Microbiology Laboratory, General Hospital Of Larissa
  • 2 Intensive Care Unit, General Hospital of Larissa
  • 3 Department of Microbiology, Medical School, National and Kapodistrian University of Athens
Objective: Invasive aspergillosis is a well-defined clinical entity in immunocompromised patients. There are certain criteria for classification of the diagnosis as “proven”. Microbiological criteria and biomarkers can classify a diagnosis as ”possible” when they are present in combination with clinical evidence and radiological findings. COVID-19 disease often leads to acute respiratory failure with a variety of complications, one of which is invasive aspergillosis, possibly in the context of immune—paralysis due to hypoxia and treatment with corticosteroids and immunosuppressants.
Materials & Methods: Thirteen patients with COVID-19 disease admitted to an intensive care unit (ICU) of a secondary hospital were studied over a period of two months. There was a deterioration both in clinical condition and laboratory parameters of patients, with acute respiratory failure and findings consistent with possible invasive aspergillosis on computed tomography.
The diagnosis of COVID-19 in patients was made by SARS CoV-2 rRT- PCR. During their hospitalization in the ICU, repeated cultures of bronchial secretions, urine and blood were performed, none of which led to growth of fungi. With deterioration of respiratory function, a CT scan was performed, which showed “ground glass” image or pulmonary cavities, while in two patients there was additionally hemoptysis. In the differential diagnosis, possible invasive aspergillosis was suspected. Aspergillus DNA was detected in bronchial secretions and in serum (Standard Real-Time PCR detection kit for Aspergillus, Primerdesign™Ltd, genesig®kit) and galactomannan antigen (Platelia Aspergillus, Bio-Rad, Hercules, CA, USA) and (1-3)-β-D-Glucan (Dynamiker Biotechnology Co., Ltd., Tianjin, China) were detected in patients’ sera by ELISA.
In the GM immunoenzymatic Platelia Aspergillus method, positive samples were considered those with a cut-off index ≥0.5. In the Dynamiker Fungus (1-3)-β-D-Glucan spectophotometry assay, positive serum samples were considered those with β-D-Glucan >95 pg/mL and inconclusive those with β-D-Glucan 70–95 pg/mL.
Results: Of all patients included, four showed no positive markers and the respiratory deterioration was attributed to another etiology. Of all the other patients, three were detected with positive (1-3)- β-D-Glucan antigen and two with equivocal result but positive molecular analysis in clinical samples, while it is noteworthy that none of them detected a positive galactomannan aspergillosis index. As the case may be there was a positive or negative Real Time PCR for Aspergillus DNA in bronchial secretions and serum.
Conclusions: Patients with COVID-19 disease develop immunosuppression due to viral infection and treatment, thus having an increased risk of developing aspergillus infection which greatly increases the mortality rate. The diagnosis of invasive aspergillosis is based on clinical, laboratory and imaging criteria. Unlike most invasive aspergillosis cases, in which the fungus is detected or isolated in cultures and galactomannan antigen is detected, in patients with COVID-19 it appears that the “ground glass” CT image and the detection of β-D-Glucan antigen may promptly lead to appropriate initiation of antifungal treatment. A larger number of patients with COVID-19 and invasive aspergillosis is required to confirm whether (1-3)-β-D-Glucan antigen detection in these patients may be a useful biomarker in the diagnosis of invasive aspergillosis in the absence of galactomannan.

P085 Molecular Identification of Candida Species Isolated from Candiduria in Hospitalized Patients

Mojtaba Nabili 1 and Maryam Moazeni 2
  • 1 Department of Medical Laboratory Sciences, Faculty of Medicine, Sari Branch, Islamic Azad University, Sari, Iran
  • 2 Invasive Fungi Research Center, Communicable Diseases Institute, Mazandaran University of Medical Sciences, Sari, Iran
Objectives: The incidence of candiduria caused by Candida spp. has increased in recent years, particularly in hospitalized patients. Candiduria is most commonly caused by C. albicans, however during last decades an increase in non albicans species were also observed. The purpose of this study was determine the molecular identification of Candida species isolated from candiduria in hospitalized patients.
Materials & Methods: This cross-sectional study was conducted on 530 hospitalized patients at the selected Mazandaran Hospitals. Midstream urine sample was cultured on CHROMagar Candida culture medium. Molecular identification of common Candida species was carried out according to PCR-RFLP technique after MspI restriction enzyme digestion. C. albicans and C. parapsilosis species complexes were identified by amplification of the HWP1 and intein-containing vacuolar ATPase precursor genes respectively.
Results: The frequency of candiduria was estimated at 14% among hospitalized patients of whom (n = 65; 87.8%) patients were female and (n = 9; 12.2%) were male. The most common underlying diseases were diabetes (n = 36; 48.6%). The most common isolates were C. albicans complex (n = 44; 59.4%) followed by C. glabrata (n = 16; 21.6%), C. tropicalis (n = 10; 13.5%), C. Krusei (n = 3; 4%) and C. parapsilosis (n = 1; 1.3%).
Conclusions: In current study, conventional and molecular methods were used to identify Candida species and almost similar results were obtained. However, accurate identification of Candida spp. requires the use of molecular techniques such as PCR-RFLP, HWP1 and intein-containing vacuolar ATPase precursor genes. But we can use chromogenic methods such as CHROMagar Candida for diagnosis of Candida spp. in laboratories with limited resources.

P086 Diagnostic Performance of Unyvero Multiplex PCR in Pneumocystis jiroveci

Khaled Alobaid 1,2 and Nadia Alenezi 1,2
  • 1 Mycology Reference Laboratory, 06010 Bristol, UK
  • 2 Parasitology Unit, Jabriya 47060, Kuwait
Objectives: To evaluate the diagnostic performance of a commercial multiplex PCR (Unyvero, Curetis, Holzgerlingen, Germany) in the diagnosis of Pneumoystis jiroveci pneumonia (PCP) through comparison with direct immunofluorescent assay (Meriflour Pneumocystis, Meridian biosccience, Cincinnati, OH, USA)
Materials & Methods: 32 bronchoalveolar lavage (BAL) clincal samples submitted to Parasitology laboratory for PCP diagnosis were processed as follow: each BAL sample is divided into two portions. First portion is centrifuged at 2000 RPM per 10 min, then sediment is aspirated for further processing. In brief, two drops from the sediment are placed in a slide, prepared and treated with detection reagent containing monoclonal antibodies and then examined using fluorescent microscope. The second portion of BAL (180 µL uncentrifuged sample) is transferred to Unyvero sample tube, lysed, then placed in Unyvero respiratory cartilage which is inserted in the analyzer. Results are read after 4–5 h.
Immunofluorescent MicroscopyMultiplex PCR
Positive 106
Negative 2226
Total 3232
Results: Direct immunofluorescent assay has 100% sensitivity, while multiplex PCR has 60% sensitivity.
Multiplex PCR is 100% specific, while direct immunofluorescent assay 84% specific.
Conclusions: Multiplex PCR is more specific for the diagnosis of PCP, less subjective and provides fungal load which helps in accurate interpretation and facilitate prognostic assessment.

P087 Analysis of Proteinuria Data to Investigate the Prevalence, Magnitude and Etiology of Proximal Renal Tubulopathy in Patients with Hematoproliferative Disorders

Christoph Fux 1, Peter Lanz 1, Ramona Merki 2 and Mario Bargetzi 2
  • 1 Department of Infectious Diseases and Hospital Hygiene
  • 2 Department of Hematooncology, Kantonsspital Aarau
Objectives: Clinical experience suggests that patients with hematoproliferative disorders undergoing chemotherapy frequently have proximal renal tubulopathies (PRT) which occasionally leads to severe dyselectrolytemia or Fanconi syndrome. We investigate the hypothesis that PRT is frequent, but overlooked in routine surveillance, as it initially does not result in alterations of serum creatinine levels, the standard parameter used for renal monitoring. The aim of this study is evaluating the prevalence and magnitude of PRT in patients with hematoproliferative disorders before and under chemotherapy.
Methods and materials: Laboratory data collected at the Kantonsspital Aarau between 2011 and 2019 were used. Prevalence and magnitude of PRT were determined by urine protein profiles. PRT dynamics were analyzed relative to chemotherapies and aplasia. Additional factors including blood and urine parameters, nephrotoxic drug exposure, comorbidities and type of neoplasia were considered in multivariable analyses to define risk factors. Descriptive statistics were performed using STATA 12.
Results: We analyzed 145 patients (median age 60 years, 63% male) suffering from MDS (n = 9), AML (n = 76), ALL (n = 16), aggressive Lymphoma (n = 39), MM (n = 6) among others. PRT was found in 18/96 patients (19%) before, in 43/70 (61%) after the first and 21/24 (88%) after the second chemotherapy. Recovery was observed after both chemotherapies. α1-microglobulin showed fewer and lesser increases as measured by multiples of cutoff (MOC) than retinol-binding protein. The extent of PRT inversely correlated with serum potassium, phosphate and uric acid as well as the requirement for potassium substitution. PRT occurred without eGFR impairment. AML and associated chemotherapies correlated with PRT with an OR of 5.22 (p = 0.05).
Conclusions: Extensive potassium substitution required for patients with hematoproliferative diseases in aplasia is not only related to intestinal losses, but a consequence of relevant PRT, which is higly prevalent in this population. Tubulotoxic drugs such as Amphotericin B, aminoglycosides or Tenofovir TDF therefore have to be administred with great caution. Amilorid may be a therapeutic option to overcome hypopotassemia in this setting.

P088 First Trial Technique of Non-Invasive, In-Situ Fluorometric Detection of Onychomycosis

Saeideh Amani Ghayyoum and Behnam Mohammadi Ghalehbin
Department of Microbiology, Medical Parasitology & Mycology, School of Medicine, Ardabil University of Medical Sciences
Objective: Onychomycosis is the most common fungal infection of the nail that is caused by 3 different types of fungi including dermatophytes, yeasts and other molds. It causes near 30% of fungal infections of the skin and nails. Diagnosis of this infection is made by scraping the infected plate and laboratory tests and culture, which is the painful and long process for the patient and has bias in test results. And in cases where sampling is not done properly, it will lead to false negative results. The aim of this study is to compare common mycological diagnostic techniques with direct fluorescence induction in nail tissue without scrapping and to develop the new diagnostic method.
Method & Materials: At first we ask patients to wash and dry the nails and finger then put the infected nail in a clarifying composition for 5–10 min and in the suspension containing 1–2% calcofluoride resprctively. After that the finger placed inside the dark chamber of ONYCFLUO device. The process of detection revealed after short irradiation of ultraviolet light and in case of presence of fungi in the nail tissue fluorescent plate readers measure the light signals emmited by UV. The diagnostic results of fluorescence technique in nail tissue were compared with the results of direct light microscopy and analysed. For quality control cellulose and external chitin were removed.
Result: following the binding of calcofluor to the chitin of fungus cell wall exciting/emitting fluorescence at a wavelength of 370–475 nanometer will be generated which can be identified and reported by the sensitive spectrometer system of the device. Additional examination showed fluorescence emission spectrum of the calcofluor solution in the citrate-phosphate buffers (pH 7.30) was remarkably sharper and more detectable.
Conclusions: ONYCHFLUO as a fluorometric detection Device is applicable to use in physician offices and dermatology clinics, even veterinary centers for accelerating diagnostic approaches of Onychomycosis. No need for fluorescent microscopy and no need to scrapping of nail tissue through painful sampling, which was one of the difficulties in diagnosing this infection that consider as advantages of mentioned technique. Due to safety of ingredients the process is harmless on skin and it is not prevented by ethics.

P089 Multicenter Evaluation of the VirClia Galactomannan Assay on Bronchoalveolar Lavage Fluid from Patients with Hematological Malignancies

MD Jochem Buil 1,2, Sammy Huygens 3, Alexander Schauwvlieghe 5, Albert Dunbar 3, Marijke Reynders 6, Fatima Zohra Delma 1, Elizabeth de Kort 1,5, Willem Melchers 1,2, Bart Rijnders 3 and Paul Verweij 1,2
1 Department of Medical Microbiology, Radboud University Medical Center
2 Radboudumc-CWZ Center of Expertise for Mycology
3 Department of Medical Microbiology and Infectious Diseases, Erasmus University Medical Center
4 Department of Hematology, Radboud University Medical Center
5 Department of Hematology, Ghent University Hospital
6 Department of Laboratory Medicine, Medical Microbiology, AZ St-Jan Brugge-Oostende Hospital
Background: Culture and microscopy lack sensitivity to diagnose invasive aspergillosis (IA), and may require up to 7 days before the culture becomes positive. Biomarkers, such as galactomannan (GM) and Aspergillus PCR, have increased the sensitivity and reduced turn-around time. However, the emergence of IA in patients with severe influenza or COVID-19, has increased the need for on demand tests.
Recently several point-of-care assays became available that can be used both on single patient samples without the need to batch, such as Aspergillus lateral flow device tests. These tests are rapid but give semi-quantitative results. Recently the VIRCLIA® Galactomannan AG assay was developed which can be used on individual samples and provides a quantitative result within 1.5 h. This new assay detects GM by an automated chemiluminescence immunoassay.
Material/methods: BALf samples from patients with hematological malignancies or stem cell transplants were collected between January 2017 and July 2021 in 2 academic centers in the Netherlands (Radboud UMC and Erasmus UMC), and 2 centers in Belgium (UZ Gent and AZ St. Jan Bruges). Samples were taken as part of routine clinical care. Informed consent was obtained for the use of residual material for research purposes. Samples were stored at −70 °C until tested.
In the main analysis, patients were classified according the 2020 European Organization for Research and Treatment of Cancer Invasive Fungal Infections Cooperative Group (EORTC)/Mycoses Study Group (MSG) consensus definitions as having proven, probable or probable IA. Proven and probable IA were defined as cases, while possible IA and unclassifiable patients were used as controls. In the secondary analysis, GM was excluded as criterion to classify patients. All results were analyzed using the cutoff of 1.0 OID for Platelia, and 0.2 OID for VirClia.
Results: A total of 79 patients were included (39 patients with probable IA, 36 with possible IA, and 4 patients were not classifiable). The Platelia was positive in 24 samples, while the VirClia was positive in 30 samples (Table 1). Of the 7 Platelia negative, but VirClia positive samples, 3 patients had probable IA based on a positive Aspergillus PCR. Of the 4 other patients, 3 patients had a negative Aspergillus PCR, while no PCR was performed in 1 patient. The agreement (POS/NEG) between the Platelia and VirClia was 89%. The results of Platelia an Virclia are shown in Figure 1. The VirClia detected 69% (27/39) and the Platelia detected 59% (23/39) of patients with probable IA.
29 of 39 patients had a probable IA if GM was excluded as a mycological criteria. The VirClia detected 69% (20/29) of probable IA cases and the Platelia 62% (18/29).
Conclusions: The Virclia GM showed a good correlation with the Platelia. The sensitivity of the VirClia to detect IA was comparable to the Platelia, also after GM was excluded as mycological criterium. The VirClia is a promising new assay, which decreases the time to result compared to the conventional Platelia assay.

P090 Validation of Colibrí for Automated Preparation of MALDI-TOF Targets for Yeast Identification

Robbe Heestermans, Pauline Herroelen, Kristof Emmerechts, Kristof Vandoorslaer, Ingrid Wybo, Denis Piérard and Astrid Muyldermans
Department of Microbiology and Infection Control, Universitair Ziekenhuis Brussel, Vrije Universiteit Brussel (VUB)
Objectives: Invasive candidiasis in hospitalized patients is a growing challenge worldwide as it is associated with high morbidity and mortality. Given the increasing incidence of candidemia caused by non-albicans species, a rapid and reliable identification of the causative pathogen is of major importance to guide therapeutic choices. Recently, Copan (Italy) introduced the ColibríTM system for automatized colony picking and preparation of MALDI-TOF target plates. However, this system has not yet been validated for yeast identification.
Materials & Methods: Fifty Candida strains were selected to evaluate accuracy of ColibríTM: C. albicans (n = 7), C. glabrata (n = 9), C. parapsilosis (n = 7), C. tropicalis (n = 8), C. krusei (n = 2), C. guilliermondii (n = 6), C. dubliniensis (n = 9) and C. auris (n = 2). For each strain, a Sheep Blood Agar plate supplemented with X and V factors (HEM plate) and a Sabouraud agar plate (SAB plate) were inoculated and incubated by WASPlab® (Copan, Italy). After 18 h and 36 h of incubation, isolates were spotted in parallel by ColibríTM and manually from each culture plate onto a MALDI target plate (Bruker, Germany) with addition of formic acid. Acceptance criterium for identification (ID) by MALDI Biotyper® (Bruker, Germany) was set on 1.8.
Results: Sufficient growth after 18 h incubation was observed for 36/50 HEM and 44/50 SAB plates. Overall, using ColibríTM for colony picking, 86% of strains cultured on HEM plates were identified with an acceptable ID score compared to 81% manually. SAB plates showed inferior results for both ColibríTM (66%) and manually (61%). Further detailed results are provided in Table 1. When evaluating the accuracy of ColibríTM, there was an overall agreement of 86% for identification of strains on HEM plates between ColibríTM and the manual method after 18 h and 84% after 36 h. For SAB plates, an agreement of 77% after 18 h and 89% after 36 h was observed. With exception of C. dubliniensis and C. tropicalis, all included Candida species showed a 100% accuracy for ColibríTM on HEM plates. Detailed results for accuracy are shown in Table 2.
Conclusions: We observed a good agreement between ColibríTM and the manual reference method. These results demonstrate that ColibríTM is a reliable system for MALDI-TOF target preparation for yeast identification. The higher degree of standardization and lower hands-on time associated with its use means an important advantage for clinical microbiology laboratories in an era of increasing automatization.

P091 PCR-Based Detection of Azole Resistance in A. Fumigatus to Improve Patient Outcome. A Prospective Multicenter Study

Albert Dunbar 1, Sammy Huygens 1, Corné Klaassen 3, Willemien Zandijk 3, Alieke Vonk 3, Walter van der Velden 4, Paul Verweij 5, Jochem Buil 5, Nick de Jonge 6, Karin van Dijk 7, Bart Biemond 8, Aldert Bart 9, Anke Bruns 10, Pieter-Jan Haas 11, Astrid Demandt 12, Guy Oudhuis 13, Peter von dem Borne 14, Martha van der Beek 15, Saskia Klein 16, Peggy Godschalk 17, LFR Span 18, Martijn Bakker 18, Greetje Kampinga 19, Johan Maertens 20,21, Katrien Lagrou 21,22, Toine Mercier 20,21, Ine Moors 2, Jerina Boelens 23, Dominik Selleslag 24, Marijke Reynders 25, Jeanette Doorduijn 26, Jan Cornelissen 26, Alexander Schauwvlieghe 2 and Bart Rijnders 1
  • 1 Department of Internal Medicine, Section of Infectious Diseases and Department of Medical Microbiology and Infectious Diseases, Erasmus MC, University Medical Center
  • 2 Department of Hematology, Ghent University Hospital
  • 3 Department of Medical Microbiology & Infectious Diseases, Erasmus MC, University Medical Center
  • 4 Department of Hematology, Radboud University Center
  • 5 Department of Medical Microbiology, Radboud University Center
  • 6 Department of Hematology, Amsterdam University Medical Center, location VUmc
  • 7 Department of Medical Microbiology, Amsterdam University Medical Center, location VUmc
  • 8 Department of Hematology, Amsterdam University Medical Centers, location AMC
  • 9 Department of Medical Microbiology, Amsterdam University Medical Center, location AMC
  • 10 Department of Medical Microbiology, University Medical Center Utrecht
  • 11 Department of Medical Microbiology, University Medical Center Utrecht
  • 12 Department of Hematology, Maastricht University Medical Center
  • 13 Departmen t of Medical Microbiology, Maastricht University Medical Center
  • 14 Department of Medical Microbiology, Leiden University Medical Center
  • 15 Department of Hematology, Leiden University Medical Center
  • 16 Department of Hematology, Meander Medical Center, Amersfoort
  • 17 Department of Medical Microbiology, Meander Medical Center
  • 18 Department of Hematology, University Medical Center Groningen
  • 19 Department of Medical Microbiology, University of Groningen, University Medical Center Groningen
  • 20 Department of Hematology, University Hospitals Leuven
  • 21 Department of Microbiology, Immunology and Transplantation, KU Leuven
  • 22 Department of Laboratory Medicine and National Reference Centre for Mycosis, University Hospitals Leuven
  • 23 Department of Medical Microbiology, Ghent University Hospital
  • 24 Department of Hematology, AZ St-Jan Brugge-Oostende Hospital
  • 25 Department of Laboratory Medicine, Medical Microbiology, AZ St-Jan Brugge-Oostende Hospital
  • 26 Department of Hematology, Erasmus University Medical Center
Objectives: Invasive aspergillosis (IA) is the most common mould infection in patients treated for a haematological malignancy. Azole resistant Aspergillus fumigatus is increasingly reported and associated with high mortality. Phenotypic susceptibility testing of fungi is time-consuming, not widely available and cultures often remain negative. AsperGenius® is a commercial multiplex real-time polymerase chain reaction (PCR) that allows for simultaneous detection of A. species, A. fumigatus and A. terreus. In A. fumigatus PCR positive samples, the 2 most common azole resistance associated mutation patterns (RAMs) in the cyp51A gen (TR34/L98H- TR46/T289A/Y121F) are also detected. The PCR can be performed directly on broncho-alveolar lavage fluid (BALf) and thus diagnose azole resistance more frequently (i.e., in culture negative IA as well) and faster (if done ad hoc) compared with phenotypic testing. In this study we evaluated the clinical value of this PCR in patients with a haematological malignancy with suspicion of IA undergoing BALf sampling.
Materials & Methods: 10 centers enrolled patients in the Azole Resistance Management Study (AzoRMan). Patients with pulmonary radiological abnormalities suspected for an invasive fungal infection underwent BALf sampling for fungal culture, galactomannan (GM) and PCR testing. Only patients without antifungal therapy or on triazole monotherapy for <120 h were included. When no mutations were detected in the A. fumigatus cyp51A gen, triazole monotherapy was initiated or continued while the detection of resistance by culture or PCR led to a switch to liposomal amphotericin-B. The main objectives of the study were (1) evaluate the impact of PCR-based resistance testing on the management and outcome of patients with IA and (2) systematically evaluate the incidence of triazole resistance in A. fumigatus caused by the 2 most frequent triazole RAMs in patients with culture positive, as well as culture negative IA.
Results: 323 patients were enrolled and BALf was available in 321 patients. BALf GM was positive (OD ≥ 1.0) in 72/321 (22%) and <0.5 in 217/321 (68%), Table 1. Sufficient BALf remained for PCR testing in 295. Aspergillus species DNA was detected in 114/295 (39%) while A. fumigatus DNA could be demonstrated in 86 (29%). In those with a GM ≥ 1.0, the species PCR was positive in 45/62 (73%) vs. 53/203 (26%) when GM was negative (i.e., <0.5). In 86 patients with a positive A. fumigatus PCR, the resistance PCR was successful for both RAMs in 67/86 (78%). In 7/67 (10.4%) RAMs were documented, 4 with a TR34/L98H, 2 with a TR46/T289A/Y121F and 1 with a mixed wildtype/TR34 infection. In 2 of these 7, GM was <0.5 (1 also culture negative) and in 3/7the fungal culture was negative and therefore resistance was detected by PCR only.
Conclusions: Even in countries with a rather high prevalence of azole resistance, the systematic use of a cyp51A resistance PCR on BALf resulted in relatively few (3 of 295) additional cases of azole resistant A. fumigatus detected compared with culture-based testing alone. A stepwise approach in which GM and Aspergillus PCR testing is done first followed by resistance PCR when Aspergillus fumigatus DNA is detected appears reasonable. The clinical relevance of Aspergillus DNA that was detected in 26% of GM negative BALf samples requires further study.

P092 Mutation Analysis of the Squalene Epoxidase Gene of Dermatophytes in Dubai, Emirates, Using the DermaGenius® Resistance PCR Kit

Silke Uhrlass 1, Srikumar Goturu 2, Stephanie Dessoi 3, Shyam B. Verma 4, Yvonne Graeser 5, Daniela Koch 1, Hanna Muetze 1, Constanze Krueger 1 and Pietro Nenoff 1
  • 1 Laboratory of Medical Microbiology
  • 2 Dr. Joseph’s Polyclinic
  • 3 Dermatological Office Dres. med. Gassenmaier
  • 4 “Nirvan” and “In Skin” Clinics
  • 5 Charite—Universitätsmedizin
Objectives: Recalcitrant dermatophytosis due to terbinafine resistant dermatophytes are on the rise in India. The causative agent is mainly Trichophyton (T.) mentagrophytes ITS genotype VIII, which is re-classified as T. indotineae. This emerging pathogen spreads to other countries worldwide. The way of infection goes from India probably via Arab countries and the Middle and Near East region to Europe. The focus of the study was on investigation the prevalence of T. indotineae in Dubai based on precise molecular biological diagnostics of the causative dermatophyte species and genotyping based on sequencing of the fungal DNA. Resistance testing of terbinafine by a breakpoint agar dilution method, and sequencing of the squalene epoxidase (SQLE) gene was compared with results of the new developed DermaGenius® Resistance RT-PCR-Kit (PathoNostic B.V., The Netherlands).
Methods & Materials: Patients from Dubai, Emirates, were examined for dermatomycoses caused by dermatophytes. In November 2020, skin scrapings were taken from 75 patients in Dubai with suspicion diagnosis of a dermatophytosis. Cultural diagnostics on Sabouraud’s Dextrose Agar and inhouse PCR for dermatophytes was done. For confirmation of the suspected dermatophyte species, Sanger sequencing of the ITS regions of rDNA genes (mainly the regions ITS 1, 5.8 S rRNA, ITS 2) using universal primers V9G (5′-TTACGTCCCTGCCCTTTGTA-3′) and LSU266 (5′-GCATTCCCAAACAACTCGACTC-3′) was performed for all isolates. All cultures were analysed for mutations in the SQLE gene associated with terbinafine resistance by sequencing, and additional by the commercially available DermaGenius® Resistance Kit. The DermaGenius® Resistance RT-PCR-Kit detects the mutations at position 393 and 397 of the SQLE gene.
Results: By culture, from 31 out of 75 skin scrapings, a dermatophyte grew. Sequencing revealed, that 28 samples of 31 cultivated dermatophytes were T. indotineae, and 3 samples, only, were T. rubrum. SQLE gene sequencing of T. rubrum revealed one terbinafine resistant strain with Phe397Leu amino acid substitution. The other 2 T. rubrum strains were wild types without mutations. In the T. mentagrophytes group, 3 strains, only, were wild types. The remaining 25 strains showed mutations. The mutations of these 18 terbinafine resistant strains were located at the following positions: Leu393Ser (n = 1), Phe397Leu (n = 15), Gln408Leu (n = 1), and Phe415Cys (n = 1). Three out of 10 sensible strains were wild types. The remaining 7 strains revealed the Ala448Thr mutation and amino acid substitution. By the DermaGenius® Resistance RT-PCR-Kit, all dermatophytes and by sequencing detected mutations at positions Leu393Ser and Phe397Leu could be confirmed. From additional 29 PCR positive skin scraping samples (without cultural growth of a dermatophyte), all 29 dermatophytes confirmed and in 25 for the mutation analysis a valid result could be achieved by DermaGenius® Resistance RT-PCR-Kit. Terbinafine resistance was detected in 16 skin scraping samples, 9 samples were terbinafine sensitive.

P100 Fungal Contamination of the Water Distribution System in Lagos University Teaching Hospital

Kolapo Olawale 1, Folasade Ogunsola 1, Folake Peters 2 and Rita Oladele 1
  • 1 Department of Medical Microbiology and Parasitology, College Of Medicine, University Of Lagos
  • 2 Mycology Unit, Medical Microbiology Laboratory, Lagos University Teaching Hospital
Objectives: Fungal contamination of water and its attendant effects e.g., invasive fungal infections has been frequently reported. For infection prevention and control purposes, it is expedient to investigate for the presence of fungal contaminants in water utilized in the hospitals, since the ‘at risk’ populations are managed here. It is on this premise that the water distribution system of Lagos University Teaching Hospital was assessed for fungal contaminants.
Materials & Methods: 200 mLs of water each was taken from taps, showers, faucets and water storage tanks. Swab samples were also collected. The hospital sections categorized into low and high risk units. The membrane filtration method for water analysis was used. 100 mL of water sample was filtered through 0.45 µm pore size, 47 mm diameter membrane filter. The filter was placed on SDA plates supplemented with gentamycin and chloramphenicol; which were incubated at room temperature and at 37 °C. Pure colonies from subculture were identified using microscopic and morphological method of identification for fungi as described in existing literatures.
Results: One hundred and five (105) water and 49 swab samples were collected for analysis. There was 100% fungal contamination of the hospital water system. Low and high risk units had 25 and 18 different species of fungi isolated respectively. Labour ward and Modular theatre were the most contaminated of the units studied with 25.3% and 43.9% isolates count respectively. Cladosporium spp. was the most frequently isolated organism in the low risk units occurring in 7 of 9 units studied while Aspergillus was the most predominant genus with 5 species identified including niger (9.9%), terreus (4.4%), flavus (3.3%), fumigatus (8.8%) & versicolor (2.20%). Paecilomyces spp. had the highest percentage of occurrence (6/8) in the high risk units, while Aspergillus spp. followed closely with 3 species identified (flavus; 9.4%, fumigatus; 15.9%, niger; 10.3%), the Renal dialysis centre and theatre had the least contamination rates in the high risk units. Accidents and emergency theatre had the highest contamination rate of all the swab samples analysed. Aspergillus niger, Cephalosporium curtipes, Penicilium chrysogenum and Penicilium glabrum were each identified in 4 of 6 units from which swabs were taken from.
Conclusions: Our data points to water as a plausible source of infections in hospitals. A standard protocol for monitoring and regulation of fungi in water needs to be developed particularly for hospitals as a means of infection prevention and control.
Jof 07 00916 i005
Figure 1. Distribution of isolates in water samples from low risk locations.
Jof 07 00916 i006
Figure 2. Distribution of isolates in water samples from high risk locations.

P101 Environmental Yeasts, Pollution and Antifungal Resistance

Maria Lúcia Scroferneker 1,2, Danielle Machado Pagani 3, Fabiana Vieira Tormente 3 and Patricia Valente 2,3
  • 1 Postgraduate Program in Medicine: Medical Sciences, Universidade Federal do Rio Grande do Sul
  • 2 Department of Microbiology, Immunology and Parasitology, ICBS, Universidade Federal do Rio Grande do Sul
  • 3 Postgraduate Program in Agricultural and Environmental Microbiology, Universidade do Rio Grande do Sul
Objectives: Verify the presence of antimicrobials and pesticides in a south lagoon in Brazil and isolate, identify and test antifungal susceptibility of yeasts from this envinronemnt.
Materials & Methods: The samples were collected in the rainy season and dry season for two years, totaling four collections. The samples were spread in a selective medium containing antifungal (fluconazole, terbinafine, amphotericin B, or caspofungin). The same samples were tested for the presence of agricultural fungicides. Seventy-one yeasts were obtained, and 31 species were identified, subsequently tested for Minimum Inhibitory Concentration (MIC) following the CLSI M27–A3 protocol, and classified as resistant-like when the MIC value was equal to or greater than the breakpoint established for Candida spp.
Results: Fifty-five isolates were classified as resistant-like for fluconazole (triazole) (MIC 64–2048 µg/mL), 39 for terbinafine (allylamine) (MIC 4–256 µg/mL), 42 for amphotericin B (polyene) (MIC 1–128 µg/mL) and 48 for caspofungin (echinocandin) (MIC between 1–128 µg/mL). All isolates were resistant-like to at least one antifungal. In total, 62 isolates were classified as multidrug-resistant (MIC ≥ at the breakpoint for two or more antifungals). In the water samples, agrodefensive agents were identified, such as carbendazim (benzimidazole) and tebuconazole (triazole).
Conclusions: Fungi can cause systemic diseases, either primary or secondary. Fungal diseases are neglected, especially in developing countries. From the observations made, it is possible to infer that resistant yeast selection is taking place in this environment, possibly making it a reservoir of resistance genes. Knowing the effects of human actions on the environment is an important step towards prevention and preparedness to deal with possible outbreaks and pandemics.

P102 Isolation of Exophiala phaeomuriformis from an Aviation Kerosene Sample in Brazil

Maria Lúcia Scroferneker 1,2, Mariane Rodrigues Lobato 3, Fátima Menezes Bento 2,3, Alessandra Koehler 1, Amanda Carvalho Ribeiro 4 and Danielle Machado Pagani 3
  • 1 Postgraduate Program in Medicine: Medical Sciences, Universidade Federal do Rio Grande do Sul
  • 2 Department of Microbiology, Immunology and Parasitology, ICBS, Universidade Federal do Rio Grande do Sul
  • 3 Postgraduate Program in Agricultural and Environmental Microbiology, Universidade do Rio Grande do Sul. Universidade Federal do Rio Grande do Sul
  • 4 Graduation in Pharmacy, Universidade Federal do Rio Grande do Sul
Objectives: Identify the presence of black yeast species in aviation kerosene samples.
Materials & Methods: The aviation kerosone samples came from an aviation company in Porto Alegre, state of Rio Grande do Sul, Brazil. The fungi isolation was carried out using the modified ASTM D6974-09 Standard. In this procedure, 500 mL kerosene samples were filtered, in triplicate, under aseptic conditions, under vacuum, using a 0.22 μm membrane (Millipore). After filtering, the membranes were deposited in potato dextrose agar culture medium. The plates were incubated in an oven at 30 °C for seven days. After this period, the colonies were isolated in new culture media for purification of the isolates. Molecular identification was performed through the sequencing of ITS DNA regions. The profile of sensitivity to clinical antifungals was assessed following protocols M27-A3 of the Clinical and Laboratory Standards Institute (CLSI). The minimum inhibitory concentrations (MIC) of seven antifungal agents were determined: ketoconazole, itraconazole, posaconazole and voriconazole (16–0.03 μg/mL), terbinafine (0.5–0.001 μg/mL), caspofungin (8–0.015 μg/mL), and amphotericin (16–0.0313 μg/mL).
Results: We were able to isolate the black yeast Exophiala phaeomuriformis from the kerosene samples. The MIC values were the following: 125 µg/mL for ketoconazole, 0.25 µg/mL for itraconazole, 0.125 µg/mL for posaconazole, 0.25 µg/mL for voriconazole, 0.0156 µg/mL for terbinafine, >8 µg/mL for caspofungin and 2 µg/mL for amphotericin.
Conclusions: It is known that black yeasts are naturally associated with extreme environments rich in hydrocarbons, such as aviation kerosene. Pathogenic species such as E. xenobiotica and other species of the genus Exophiala has already been isolated from this type of samples. Our study was the first to isolate E. phaeomuriformis in kerosene samples. This black yeast is known to cause superficial mycosis in humans, but also deep infections mainly in the respiratory system. Our isolate was susceptible to five antifungal drugs (itraconazole, posaconazole, voriconazole, terbinafine and amphotericin), however highly resistant to ketoconazole and caspofungin. Considering the interest in using fungal isolates capable of degrading hydrocarbons to minimize environmental impacts, it is very important to select species that present this benefit without bringing risks to human health.

P103 Inventory of Filamentous Fungi and Yeasts Found in the Water and Sand of the Beach of Pier in Arecibo P.R.

Lourdes Echevarría
Pontifical Catholic University of Puerto Rico
In recent years, an increase in filamentous fungal and yeast infections has been observed. The water and sand of the beach were studied, for three weeks beginning in February, and culminating in March 2021. Objective: To know the diversity of filamentous fungi and yeasts in the water and sand of the beach, to determine if they are pathogenic to man and to know the mycological quality of the sand. Methodology: Samples were taken at three points equidistant from the water and the sand in sterile bags. The culture media were used: SDA, RBA, HardyCHROM and CHROMagar. For water analysis, 100 mL were filtered in triplicate and placed on each plate with the different culture media. For sand analysis, 1 gram was weighed in triplicate and spread on the plates with each culture medium. They were sheltered for 7 to 14 days at 25 °C. Colonies were counted and then isolated. Macroscopic and microscopic analysis was performed. Results: The water analysis determined the presence of three genus: Aspergillus, Rhizopus and Penicillium. Average yeast ranged from 21 CFU on CHROMagar and 12 CFU on HardyCHROM. The yeast species identified were C. albicans and C. tropicalis. The average of filamentous fungi was 12 CFU in RBA and 15 CFU in SDA. The fungal species identified in the water were A. ochraceus, A. flavus, A. parasitucus, A. niger, A. versicolor, P. citrinum, P. chrysogenum and R. oligosporus and R. stolonifer. Two genus were identified in the sand: Aspergillus and Penicillium. The genus Aspergillus was the one with the highest identification. Yeast average was: 19 CFU on CHROMagar, 20 CFU on HardyCHROM. The two yeasts identified were: C. albicans and C. tropicalis. The average of filamentous fungi in each culture medium was 30 CFU in RBA and 38 CFU in SDA. The filamentous fungi species identified in the sand were A. terreus, A. versicolor, A. niger, A. flavus, A. oryzae, A. fumigatus, P. monoverticillate and A. aculeatus. Conclusions: The quality of the sand was classified as average. There is a connection between filamentous fungi and yeasts identified in water and sand with clinical samples. Most of the fungi identified are human pathogens. Causing infections in different parts of your body.

P104 How Climate Changes Are Shaping Fundamental Niche of Cryptococcus gattii Vgi in Europe and Mediterranean Area

Massimo Cogliati, Maria Carmela Esposto, Anna Prigitano and Luisa Romanò
Università Degli Studi Di Milano
Objectives: In the present study, we analyzed how geographical distribution of the fungal pathogen Cryptococcus gattii VGI in Europe and Mediterranean area has evolved in the last four decades based on the climatic changes, and we tried to predict the scenario for the next decade.
Methods: Twenty-two occurrence points for C. gattii VGI isolates recovered from the environment were obtained by the Screen Project database, whereas temperature and precipitation datasets, from 1980 to 2019, were downloaded from WorldClim website. Species distribution analysis was performed by MaxEnt software.
Results: Niche modelling by Maxent analysis showed that recent climate changes have significantly affected the distribution of the fungus revealing a gradual expansion of the fundamental niche from 1980 to 2009 followed by an impressive increase in the last decade (2010–2019) during which the environmental surface suitable for the fungal survival was more than doubled. In the next decade, our model predicted an increase in the area of distribution of C. gattii VGI from the coasts of the Mediterranean basin towards the more internal sub-continental areas.
Conclusions: On the basis of these predictions, an increase of cases of cryptococcosis due to C. gattii VGI is expected in the next decade, therefore, a constant monitoring of the epidemiology of this fungal pathogen represents a crucial strategy to detect the onset of future outbreaks.

P105 Analysis of the pH-Dependent Secretion of Lipases by Candida albicans Isolates

Rocío Castro 1, Asier Ramos 1, Elena Sevillano 1, Guillermo Quindós 1, Elena Eraso 1 and Vladimir Kaberdin 1,2
  • 1 University Of The Basque Country Upv/ehu
  • 2 IKERBASQUE, Basque Foundation for Science
Objective: Candida albicans is an opportunistic fungal pathogen that can cause superficial or invasive infections. C. albicans is able to adapt and thrive under adverse conditions such as suboptimal pH, nutrient scarcity and limited oxygen supply common in some host microenvironments. Its pathogenicity is often associated with the production of virulence factors, among which some hydrolytic enzymes can play a major role in disease development. The aim of this study was to determine the effect of external pH and strain origin on the efficiency of extracellular lipase production.
Methods: Twenty-three Candida albicans isolates from different sites of infection (oral cavity (6), urine (5), vagina (4), skin (4) and blood (4)) were analysed. To detect lipolytic activity, the strains were grown on malt agar plates supplemented with Tween 80 and calcium chloride. The assays were performed at different pH (5, 6.5 and 7.5) of the medium and the halos formed around the colonies were further examined to calculate the corresponding Ez (enzymatic zone) indexes. Kruskal-Wallis and Dunn’s post hoc tests were performed. The data were considered to be statistically significant for p < 0.05.
Results: The lipolytic activity, initially assessed at pH 5, was observed for all C. albicans strains originated from oral cavity and skin lesions, while the occurrence of the lipase-secreting strains among the vaginal (75%), urine (25%) and blood (25%) isolates was considerably lower. At pH 6.5 and 7.5, only oral (66% and 50%, respectively) and skin (66.6% at both pH) isolates manifested lipolytic activities. In general, enzyme production at pH 5 was markedly higher regardless of the origin of the isolates. Furthermore, oral and skin isolates showed higher lipolytic activities at all pH compared to those that were obtained for C. albicans originated from other sites of infection. The most notable difference was observed between urine and skin isolates.
Conclusions: Production of lipase-like enzymes depends on pH and clinical origin of C. albicans isolates. Those from oral cavity and skin show significantly greater lipolytic activity than the rest of isolates and their activity was higher at low pH.
Funding: GIC15/78 IT-990-16 (Gobierno Vasco- Eusko Jaurlaritza)

P106 Effect of pH on Secretion of Proteases by Clinical Isolates of Candida albicans

Asier Ramos 1, Rocío Castro 1, Elena Eraso 1, Guillermo Quindós 1, Vladimir Kaberdin 1,2 and Elena Sevillano1
  • 1 University Of The Basque Country Upv/ehu
  • 2 IKERBASQUE, Basque Foundation for Science
Objectives: Candida albicans is a well-known opportunistic pathogen frequently isolated from different infection sites of the human body (skin, vagina, oral cavity or gastrointestinal tract). The development of candidiasis is often linked to the production of different virulence factors including various hydrolytic enzymes. Since the pH conditions of the infection sites vary from acid (vagina) to the neutral (skin) pH, the aim of this study was to develop alternative agar plate techniques and analyse the effect of pH on the secretion pattern of proteases produced by C. albicans isolates at different pH.
Materials & Methods: A selection of 24 clinical C. albicans isolates were analysed. The strains were previously isolated from different sites of infection including blood, oral cavity, skin, urine, and vagina. In addition, 2 Candida auris blood isolates along with Candida tropicalis NCPF 3111 and Candida albicans NCPF 3153 isolates were tested. The production of proteases at different pHs was tested on solid media containing bacteriological agar, yeast extract, yeast nitrogen base and a protease substrate (i.e., skim milk or Bovin Serum Albumin (BSA)). The pH of the media was adjusted to 5.0, 6.4, and 7.5, thus mimicking the pH range in different sites of infection. The plates were inoculated with 10 µL suspension of Candida cells in saline solution McFarland value: 0.7–0.8) and incubated at 37 °C for 5 (milk agar plates) or 7 (BSA agar plates) days. The capacity of the tested isolates to secrete proteases was assessed by the appearance and size of the halos formed around each colony.
Results: Plates containing skim milk as a substrate made it possible to detect protease secretion by all 24 C. albicans clinical isolates, whereas detection with BSA plates was possible only for one third of the strains. Moreover, protease production was generally more efficient at pH 5.0 compared to pH 6.4 or pH 7.5. In addition, there seems to be a correlation between the pH of the infection sites and the pH at which the cognate C. albicans isolates show maximal protease secretion.
Conclusions: Milk agar plates offer the best option to study the pH-dependent secretion of proteases by Candida spp. Moreover, lower pH seems to promote protease secretion activity, and the strains originated from the infection sites with low pH appears to have a broader substrate specificity.

P107 Lower Funneling Pathway in Scedosporium Species

Kévin Ravenel
University Of Angers
Objectives: Lignocellulolytic fungi that are able to degrade lignin have received a particular attention during the last decades. Recent studies evidence that similar enzymatic arsenal is required to degrade lignin, lignocellulose components and organic pollutants like aromatic hydrocarbons. A large number of fungi characterized as opportunistic pathogens are found in human-made environments and exhibit degrading abilities toward aliphatic and aromatic hydrocarbons. Moreover, for several pathogenic microorganisms, a link between capacity to degrade aromatic pollutants and virulence has been established.
Scedosporium are filamentous fungi usually soil saprophytes, that have been regularly reported as causing human infections, particularly in patients with cystic fibrosis. They are worldwide distributed and have been recovered in a wide variety of environments. All studies that have been conducted highlighted their common occurrence in polluted areas. Because of their limited susceptibility to current antifungals, a better understanding of their adaptative mechanisms to these environments is required.
Lignin degradation by microorganisms is initiated by extracellular oxidative steps and followed by intracellular metabolic degradation through the microbial funneling pathway. In fungi, four main aromatic intermediate compounds (protocatechuate, catechol, hydroxyquinol, gentisic acid) serve as substrates in the lower funneling pathway, where dioxygenases are key enzymes catabolizing the ring-opening step. This work was aimed to study these lower funneling pathway in Scedosporium species.
Materials and Methods: Orthologues dioxygenases from the literature were used to screen Scedosporium genomic data by tBLASTn (Basic Local Alignment Search Tool) searches. A comprehensive in silico analysis (i.e., alignments and phylogenetic analysis, genome organization) was performed to characterize these enzymes, and their genomic environment. Then, a focus on the gentisic acid pathway was done in order to validate the bioinformatic results. Growth studies and real-time PCR experiments were realized.
Results: Sixteen putative genes encoding ring-cleavage dioxygenase were identified on the reference strain S. apiospermum IHEM 14462. The bioinformatic analysis suggests that Scedosporium species are able to catabolize the main aromatic intermediates derived from lignin degradation (i.e., gentisic acid, hydroxyquinol, protocatechuate and catechol). Except for protocatechuate catabolism, the genes of the corresponding pathways are organized in cluster.
Then, the experimental part of the study focuses on the gentisic acid. Results confirm the ability of Scedosporium to grow on synthetic media containing lignin or the gentisic acid as the sole carbon source. Moreover, in these culture conditions, real-time PCR experiments demonstrated that the genes of the cluster were overexpressed.
Conclusions: Results obtained in this study confirm that Scedosporium species exhibit the enzymatic arsenal to degrade natural complex molecules and are capable to open aromatic rings. This may explain their presence in polluted environments. Considering the low susceptibility to current antifungal drugs of Scedosporium species, these metabolic pathway may constitute targets for the development of more potent antifungal.

P120 Demonstration of the Yeasticidal Efficacy of Povidone-Iodine–Based Commercial Antiseptic Solutions against Candida auris

Adélaïde Chesnay 1, Eric Bailly 1, Victor Evplanov 2, Filippo Favalli 3 and Guillaume Desoubeaux 1
  • 1 CHRU Bretonneau
  • 2 Mylan
  • 3 Meda Pharma
Abstract: Objectives: Candida auris is an emerging yeast pathogen with worldwide distribution and a great propensity for nosocomial spread. Recent reports have warned of the significant emergence of C. auris in several healthcare facilities. In order to stop its nosocomial transmission, use of antiseptics constitutes the first-line lever of action in the fighting against C. auris skin colonization. However, little is known about the efficacy of these products, and moreover no antiseptics are currently registered for use against C. auris. Material and methods: This study investigated the in vitro yeasticidal activity of povidone-iodine (Betadine®) against C. auris, and compared the findings to C. albicans and C. glabrata. Results: In all the samples, the fungal load was substantially reduced by ≥4.2 Log10 colony-forming units, according to the EN standard 1275:2005. Moreover even when largely diluted, povidone-iodine products still allowed sustainable decrease of the yeast viability below 0.1%. Conclusions: Overall, these results support the use of such commercial antiseptics in the context of colonization with this yeast.
Keywords: Candida auris; povidone-iodine; EN 1275

P121 New Insights in the Pathogenic Trichosporon Species Intraspecific Diversity: A Comparative Analyses of IGS1 Sequencing and AFLP Fingerprinting

Elaine Cristina Francisco 1,2, Chendo Dieleman 2, Eunice Then 2, Ferry Hagen 2,3,4 and Arnaldo Lopes Colombo 1
  • 1 Laboratório Especial de Micologia, Division of Infectious Diseases, Escola Paulista de Medicina, Universidade Federal de São Paulo
  • 2 Department of Medical Mycology, Westerdijk Fungal Biodiversity Institute
  • 3 Department of Medical Microbiology, University Medical Center Utrecht
  • 4 Laboratory of Medical Mycology, Jining No.1 People’s Hospital, Jining
Objectives: Trichosporon species are opportunistic human fungal pathogens able to cause several clinical manifestations. Over the past few years, the taxonomy has been extensively revised, and high intraspecific diversity was been described among clinical Trichosporon isolates. Molecular typing of Trichosporon is currently based on solely the IGS1 ribosomal DNA locus, while a large diversity has been observed within T. asahii and T. faecale, making the validation of these genotypes by robust molecular typing tools crucial to understand the epidemiology. In this study, we used amplified fragment length polymorphisms (AFLP) fingerprinting to assess the degree of intraspecific variability among clinically relevant Trichosporon species, comparing results with the IGS1 typing tool.
Materials & Methods: A total of 114 Trichosporon spp. and three related Trichosporonales genera isolates were tested. Clinical isolates (n = 66) were selected from the yeast culture collection at Laboratório Especial de Micologia, São Paulo, Brazil, and reference strains (n = 48) from the CBS yeast collection WI-KNAW. The accurate species identification was performed by sequencing the IGS1 region from the rDNA, and the genotypic characterization of T. asahii and T. faecale were achieved using reference genotype sequences deposited in the GenBank. The phylogenetic tree was carried out by the Neighbor-Joining method based on the Kimura two-parameter model with 1,000 bootstrap replicates in MEGA7. AFLP fingerprinting was performed using HpyCH4IV and MseI. Selective-PCR was carried out using HpyCH4IV (5′-FLU-GTAGACTGCGTACCCGTC-3′) and MseI (5′-GATGAGTCCTGACTAATGAT-3′), primer combinations. Raw data were analyzed in BioNumerics v7.6, and a dendrogram was created using the UPGMA method.
Results: AFLP fingerprinting recognized relevant genetic differences among the 114 isolates tested. Trichosporon asahii (n = 24; 9 genotypes), T. asteroides (n = 22; 5 genotypes), T. coremiiforme (n = 10; 2 genotypes), T. faecale (n = 35; 5 genotypes), T. inkin (n = 4; 3 genotypes), T. dohaense (n = 1), T. caseorum (n = 1), Trichosporon sp. (n = 1), and the Trichosporonales related genera [Apiotrichum spp. (n = 4; 4 genotypes); Cutaneotrichosporon spp. (n = 10; 7 genotypes); and Effuseotrichosporon spp. (n = 2; 1 genotype)], these 39 subgenotypes were distributed over 7 main clusters, indicating high genetic heterogeneity in majority of the species tested than IGS1 sequencing typing.
Conclusions: Compared to IGS1 sequencing, AFLP fingerprint provides a higher resolution for Trichosporon species typing. Our results indicate a discrepancy between the established IGS-based genotyping vs. higher genotypic diversity when using AFLP fingerprinting. These results might have implications for the taxonomy of Trichosporon.

P122 Codon Optimization and Promoter Selection Facilitates Use of Mucor circinelloides for Reporter Assays to Monitore Infection and Antifungal Efficacy

Ulrike Binder 1, Maria Isabella Navarro-Mendoza 2, Francisco Esteban Nicolas 2, Carmen Kandelbauer 1, Rebecca Pföstl 1, Ingo Bauer 3, Cornelia Lass-Flörl 1 and Victoriano Garre
  • 1 Insitute of Hygiene and Medical Microbiology, Medical University Innsbruck
  • 2 Fungal genomics and Molecular Biotechnology, University of Murcia
  • 3 Insitute of Molecular Biology, Medical University Innsbruck
Purpose: Invasive infections caused by mucormycetes are increasingly seen in the clinics and are still associated with unacceptable high mortality rates. In the covid pandemic these infections, mainly the rhinocerebral form, are being reported at alarming frequency in India. Still, little is known about the biology of the pathogens, the establishment and progression of the infection, antifungal resistance mechanisms and successful therapy. Therefore, we aimed to generate tools for (1) alternative methods of drug testing in vitro, (2) non-invasive monitoring of the infection in Galleria mellonella, (3) visualization of antifungal efficacy and (4) reporter based gene transcription assays.
Methods: Firefly luciferase, both mammalian or codon-optimized without the peroxisomal target sequence was cloned in the pMAT1477 vector under the control of different promoters. Linear plasmid was used to transfect M. circinelloides protoplasts of auxotrophic strains. Positive transformants were checked for gene integration by PCR and light emission was measured under various conditions. Selected strains were used to determine antifungal susceptibility, virulence potential and in vivo monitoring of mucormycosis in Galleria mellonella.
Results: Firefly luciferase was successfully expressed in M. circinelloides with a single integration and light emission could be measured by luminometer and visualized. Codon optimization was critical to enhance light emission, making these strains usable for real-time, non-invasive infection monitoring in insect and- in the future-murine models, and the testing of antifungal efficacy by means other than survival. Phenotype, virulence potential in G. mellonella and antifungal susceptibility are indifferent to the wild-type strains. Importantly, gene expression was differentially regulated in different media and in vitro vs. in vivo.
Conclusions: The optimization of bioluminescent Mucor strains allows for the visualization of temporal and spatial progression of infection by a non-invasive method in insect and murine models, and the testing of antifungal efficacy by other means than survival only. Furthermore, this tool can be used to visualize and measure differential expression of genes. Together, our data will give valuable new insights in the pathogenesis of Mucormycete infections.

P123 Candida auris Attributes Mediating Environmental and Host Survival

Stefanie Allert 1, Daniela Schulz 1, Philipp Kämmer 1, Peter Großmann 2, Thomas Wolf 2, Sascha Schäuble 2, Gianni Panagiotou 2, Sascha Brunke 1 and Bernhard Hube 1
  • 1 MPM, Hans-Knoell-Institute Jena
  • 2 SBI, Hans-Knoell-Institute Jena
Candida species are a major cause of invasive fungal infections. While Candida albicans, C. glabrata, C. parapsilosis and C. tropicalis are the clinically most dominant species causing life-threatening candidasis, C. auris recently emerged as a new species causing invasive infections with high rates of clinical treatment failures in various regions of the world.
To mimic the initial phase of systemic Candida infections with dissemination via the bloodstream, we used an ex vivo whole blood infection model. Similar to C. albicans, C. glabrata, C. parapsilosis, and C. tropicalis, C. auris is efficiently cleared from human blood, showing characteristic patterns of immune cell association, killing rates and induction of cytokines. A minor fraction of infecting C. auris is also able to survive human blood for several hours. Dual-species transcriptional profiling of Candida-infected blood revealed a rather uniform and conserved response against all five Candida spp. by human blood cells, while the fungal transcriptional profile was largely unique for each species, including C. auris. Its species-specific responses included adaptation and survival strategies, for example to counteract the defensive oxidative burst of blood immune cells, but also the expression of potential virulence factors, (drug resistance-associated) transporters and cell surface-associated genes.
In contrast to most other Candida species, nosocomial C. auris cells have been isolated from both patients and environmental niches. Therefore, we also analyzed this fungus under conditions mimicking the host or the hospital environment. We observed a higher stress resistance and long-term environmental survival rates of C. auris as compared to the other Candida spp. This likely increases the risk of contamination and distribution of C. auris in a nosocomial setting. Moreover, experimental in vitro infections of neutrophils with pre-starved C. auris cells suggest that environmental preconditioning of this fungus can have modulatory effects on the interaction with the human host.

P124 Rare Erg6 Modification in an Amphotericin B Resistant Candida auris Clinical Isolate from South Africa

Milena Kordalewska 1, Kevin D. Guerrero 1, Timothy D. Mikulski 1, Tony N. Elias 1, Rocio Garcia-Rubio 1, Nelesh P. Govender 2,3 and David S. Perlin 1
  • 1 Center for Discovery and Innovation, Hackensack Meridian Health
  • 2 Centre for Healthcare-Associated Infections, Antimicrobial Resistance and Mycoses (CHARM), National Institute for Communicable Diseases, a Division of the National Health Laboratory Service
  • 3 School of Pathology, Faculty of Health Sciences, University of the Witwatersrand
Objectives: Amphotericin B (AmB) is a polyene antifungal drug with broad spectrum activity against pathogenic fungi. In most Candida species, AmB resistance is rare in comparison to resistance to other antifungal drugs (azoles and echinocandins). Of concern, clinical isolates of Candida auris, a recently emerged nosocomial pathogen, were reported to have a higher prevalence of AmB resistance (up to 30%). However, underlying mechanisms of resistance were not identified.
The aim of this study was to analyze distribution of AmB minimal inhibitory concentration (MIC) values for C. auris isolates belonging to different geographic clades and decipher molecular resistance mechanism in isolates exhibiting elevated MIC values.
Methods: A total of 313 C. auris isolates representing five geographic clades (I—South Asian; II—East Asian; III—South African; IV—South American; V—Iranian) were investigated in this study. Antifungal susceptibility testing (AFST) with AmB was performed with Etest according to the manufacturer instructions. A tentative AmB MIC breakpoint of ≥2 mg/L, determined by the CDC, was used to categorize isolates as resistant to AmB. Ergosterol biosynthesis pathway genes ERG2 (C-8 sterol isomerase), ERG3 (C-5 sterol desaturase), ERG6 (sterol 24-C-methyltransferase), and ERG11 (lanosterol 14-α-demethylase) were amplified and sequenced. A wild-type ERG6 gene was replaced in a susceptible strain with a nourseothricin-linked ERG6 allele identified in an isolate with highly elevated AmB MIC (SA18) by using CRISPR/Cas9 system. AmB susceptibility was then determined for the transformed strain.
Results: The results of C. auris AFST and gene sequencing are presented in Table 1.
A total of 19 of 313 isolates (6.1%) exhibited AmB MIC values ≥2 mg/L and therefore were categorized as AmB-resistant. In 18 of these 19 isolates no mutations in ERG2, ERG3, ERG6, or ERG11 were found that could explain elevated AmB values. Only one South African isolate (SA18), which had highly elevated AmB MIC (6 mg/L) presented unique non-wild-type ERG6 genotype. ERG6 of SA18 is missing base pairs 52–543, resulting in a shorter Erg6 (deletion of amino acids 18–181). Replacement of a wild-type ERG6 with ERG6 of SA18 in a susceptible strain (AmB MIC = 0.5 mg/L) induced amphotericin B resistance (AmB MIC >32 mg/L).
Conclusions: Mutations in key genes of ergosterol biosynthesis, which can be linked directly to AmB resistance, are extremely rare. Only 1 of 313 clinical isolates screened (0.3%) had an ERG6 variant which induced AmB resistance in a wild-type strain. Mechanisms other than ERG6 mutations may also contribute to reduced AmB susceptibility in C. auris, although this remains to be determined.

P125 Terbinafine Resistance Testing of a Multitude of Dermatophyte Genera and Species Using a Simple Breakpoint Method

Silke Uhrlass, Daniela Koch, Hanna Muetze, Constanze Krueger and Pietro Nenoff
Laboratory of Medical Microbiology
Objectives: Terbinafine-resistant dermatophytes are spreading worldwide. For example, most of the strains of Trichophyton (T.) mentagrophytes ITS (Internal Transcribed Spacer) type VIII from India are in vitro and clinically terbinafine resistant. Today, this species is also found in Germany and Europe. What is new is that T. rubrum—isolated from local patients in Germany—may show terbinafine resistance in individual cases.
Methods & Materials: A total of 56 wild-type dermatophyte strains, isolated as part of the routine diagnostics of the Mölbis laboratory, were included in the study. The 28 investigated different dermatophyte species belonged to the genera Trichophyton (10), Microsporum (M.) (3), Epidermophyton (E.) (1), Nannizzia (N.) (7) und Arthroderma (A.) (7). Out of Trichophyton species, T. rubrum (2), T. verrucosum (1), T. violaceum (1), T. soudanense (1), T. erinacei (1), T. equinum (1), T. benhamiae (2), T. quinckeanum (2), T. interdigitale (4), and T. mentagrophytes (20) were examined. The following Microsporum species were included in in vitro testing: M. canis (5), M. ferrugineum (2), and M. audouinii (1). The genus Nannizzia included N. gypsea (1), N. fulva (1), N. persicolor (1), N. praecox (1), N. incurvata (1), N. nana (1), and N. perplicata (1). Out of genus Arthroderma, 7 species were tested: A. tuberculatum (1), A. quadrifidum (1), A. chiloniense (1), A. insingulare (1), A. eboreum (1), A. ciferrii (1), and A. crocatum (1).
In addition, 9 ITS genotypes were examined within the T. mentagrophytes/T. interdigitale complex: T. interdigitale type II (3), II* (1) and T. mentagrophytes type III (3), III* (4), IV (4), VII (4), VIII = T. indotineae (2), IX (1), and XXV (2).
In vitro sensitivity testing against terbinafine was carried out using a modified breakpoint method according to Yamada et al., (2017) and Ebert et al., (2020). Minimum inhibitory concentrations (MIC) <0.2 µg/mL are associated with in vitro sensitivity of the isolate, at MIC values ≥0.2 µg/mL, the strain is resistant to terbinafine in vitro.
Results: In vitro resistance to terbinafine was found within the T. mentagrophytes/T. interdigitale complex only for T. mentagrophytes ITS type VIII (currently, T. indotineae). All other genotypes are in vitro terbinafine sensitive. All other dermatophytes of the 5 genera are predominantly in vitro sensitive to terbinafine. One single strain of M. canis, however, had to be classified as in vitro resistant. Few strains were conspicuous with MIC values of 0.1 µg/mL, but not resistant. A. tuberculatum was also conspicuous with slightly reduced terbinafine sensitivity.
Conclusions: Terbinafine resistance is a new phenomenon and especially a clinical problem in dermatomycology. Currently, almost exclusively the isolates of T. mentagrophytes VIII (T. indotineae) from India are affected. Other genera, species, and genotypes of dermatophytes—in particular, T. rubrum as the most common isolated species in this country—are currently still in vitro sensitive to terbinafine.

P127 Use of Whole Genome Sequencing to Investigate Outbreaks and Study Population Structure of Saprochaete clavata among European Clinical/Environmental Isolates

Marie Desnos-Ollivier 1, Alexis Criscuolo 2, Françoise Dromer 1 and Geotrichum Investigation Group 1
  • 1 Institut Pasteur, CNRS UMR 2000, Molecular Mycology Unit, National Reference Center for invasive Mycoses & Antifungals
  • 2 Institut Pasteur, Bioinformatics and Biostatistics HUB—Mutualized Platform for Microbiology
Objectives: Saprochaete clavata (Magnusiomyces clavatus) is considered as a very rare pathogen worldwide. This species is intrinsically resistant to echinocandins and fluconazole. Since 2012 it has been identified as responsible for local and national outbreaks in France. Infections with S. clavata usually occur in patients with haematological malignancies and are associated with a very high global mortality rate. We recently showed that defective dishwasher should be considered as a source of contamination. The objective of the present study is to use whole genome data to study population structure of this emerging pathogen.
Methods: The whole genome of 189 clinical and environmental isolates recovered mainly in France but also in 9 European countries, between 2001 and 2021 was sequenced (P2M facility, Institut Pasteur), using a NextSeq 500 sequencer, Illumina.
Results: Determination of single nucleotide polymorphism (SNPs) positions among the genome of 12 Mb showed a low polymorphism suggesting a recent emergence of this species or a poor genome plasticity. The presence of clades previously identified as responsible for French outbreaks was confirmed, and new clades were also identified. The persistence of the same S. clavata clade over 8 years was also demonstrated in one hospital. Furthermore, environmental isolates, mainly recovered from dishwashers, and clinical isolates recovered during local outbreaks were genetically closely related confirming that dishwasher can be considered as the main source of contamination.
Conclusions: Our analysis highlights the fact that control measures such as control of the efficiency of dishwashers including correct temperature cycles, rigorous and thorough cleaning of dishes could be implemented in hospitals to limit the spread of S. clavata.

P128 Peptidorhamnomannan of the Cell Wall of S. brasiliensis Induces a Strong IL-1-Dependent Th1-Th17 Response

Brenda Kischkel 1,2, Jéssica C. dos Santos 1, Carlos P. Taborda 1, Leila M. Lopes-Bezerra 1, Leo A. B. Joosten 2 and Mihai G. Netea 2
  • 1 Department of Microbiology, University of São Paulo
  • 2 Department of Internal Medicine, Radboud University Medical Center
Objectives: Peptidorhamnomannan (PRM) is a component of the cell wall of Sporothrix spp. that is involved in the recognition of the fungus by human macrophages. Previous studies have shown that there are structural differences between the PRMs of S. brasiliensis (S.b PRM) and S. schenckii (S.s PRM). We hypothesize that these structural differences may be associated with the different strengths of pathogenicity observed among these species. Therefore, in this study we evaluated the mechanisms involved in the induction of cytokines by S.b and S.s PRMs.
Materials & Methods: Human peripheral blood mononuclear cells (PBMCs) were stimulated with S.b PRM, S.s PRM as well as heat-killed yeasts of S. brasiliensis, S. schenckii and Candida albicans as control stimulus. The profile of pro- and anti-inflammatory cytokine production was evaluated by ELISA. In addition, the cytokine production was assessed in the presence of specific inhibitors of pattern recognition receptors (PRRs), cytokines and their associated downstream and metabolic pathways.
Results: Exposure of PBMCs to S.b PRM resulted in the production of pro-inflammatory cytokines associated with innate immunity TNF-α, IL-6 and IL-1β at levels comparable to C. albicans, as well as induction of T-helper cytokines IFN-γ, IL-17 and IL-22. Surprisingly, S.s PRM induced the production of higher concentrations of interleukin-1 receptor agonist (IL-1Ra) than S.b PRM which in turn resulted in low production of T-helper cytokines, mainly IL-17 and IL-22. Stimulation of PBMCs with the whole organisms showed the same pattern of associated innate immunity cytokines induced by their respective PRMs, but at higher concentrations. Interestingly, S.b PRM induced up to 10 times more T-helper cytokines IFN-γ, IL-17 and IL-22 than S. brasiliensis, while S.s PRM induced levels comparable to S. schenckii. The induction of TNF-α, IL-6 and IL-1β by S.b PRM was associated with TLR4 and CR3 receptors. For S.s PRM, dectin-1 and CR3 was associated with the production of IL-1β and TNF-α, respectively. The blockade of the IL-1 receptor with rhIL-1Ra (anakinra) considerably impaired the induction of pro-inflammatory TNF-α, IL-6 and IL-1β and T-helper IFN-γ, IL-17 and IL-22 cytokines by S.b PRM, whereas for S.s PRM only the production of IFN-γ was not decreased in the presence of rhIL-1Ra. The glutaminolysis pathway was involved in the production of TNF-α, IL-6 and IL-17 by S.b PRM and S. brasiliensis, and TNF-α, IL-1β, IL-17 and IL-22 by S. schenckii. The addition of a glycolysis inhibitor, impaired the production of all cytokines evaluated by S.b PRM, S. brasiliensis and S. schenckii. Regarding S.s PRM, the production of IL-1Ra, IFN-γ, IL-17 and IL-22 decreased significantly.
Conclusions: Our results demonstrate that immune response induced by the S.b or S.s PRM are distinct. S.s PRM is marked by high concentrations of IL-1Ra. In in vivo models of aspergillosis this cytokine can increase the host’s susceptibility to fungal infection. S.b PRM induces a potent Th17 inflammatory response in a IL-1 dependent manner. This findings opens novel treatment strategies that aim to control the local inflammation process induced by S. brasiliensis infection through IL-1 inhibition.

P129 Emergence of Unusual and Multidrug-Resistant Candida Species in a Tertiary Care Set-Up

Priyanka Jangra, Malini Capoor, D K Gupta, B K Tripathi and HC Sachdeva
Vmmc and Safdarjung Hospital
Objectives: The aim of this study was to determine the species distribution and antifungal susceptibility pattern of candidemia cases in adult patients at a tertiary care hospital.
Materials and methods: Candida species identification was performed by phenotypic methods, Vitek (Biomerieux, France) and DNA sequencing. The antifungal susceptibility was performed by broth microdilution method as per CLSI M27-A4 guidelines 2017.
Results: Out of 1274 blood samples, 70 samples (5.5%) yielded the growth of Candida species. There was predominance of NAC spp. over C. albicans in candidemia patients. C. tropicalis (28.57%, 20/70) was the predominant Candida species followed by C. parapsilosis (22.85%, 16/70), C. glabrata (14.28%, 10/70), C. auris (12.85%, 9/70). Rare species among NAC spp. included C. auris, C. mesorugosa, C. lusitaniae, P. kudriavzevii and C. haemulonii were isolated. The most common predisposing factor for candidemia was urinary catheter (72.85%, 51/70) followed by increased period of hospitalization (42.85%, 30/70), diabetes mellitus (21.5%, 15/70), etc. The significantly associated risk factor associated with C. auris was diabetes mellitus (p = 0.02). The overall resistance was 22.57% to all antifungal drugs. The multidrug resistance (MDR) was noted in 5.71% of isolates.
Conclusions: Early identification of risk factors, Candida speciation and timely management are crucial for the outcome of candidemia cases. Non- albicans species was predominant over C. albicans depicting the change in the epidemiology and emergence of MDR Candida spp. like C. auris, C. glabrata, C. mesorugosa, C. lusitaniae, Pichia kudriavzevii (C. kruseii). This warrants routine antifungal susceptibility testing (AFST) and close monitoring. The knowledge of local epidemiological profiles of Candida spp., accurate species identification and their antifungal susceptibility are crucial for overall patient management.

P130 First Detection of TR46/Y121F/T289A Cyp51 Mutation in Aspergillus fumigatus Isolate in the Russian Federation

Galina Klyasova, Anna Malchikova and Svetlana Khrulnova
National Recearch Center For Hematology
Objectives: Invasive aspergillosis remains a major problem in immunocompromised individuals. Resistance of Aspergillus fumigatus to one or more triazoles has been reported for the last years. The aim of the study was to evaluate the antifungal susceptibility for clinical A. fumigatus isolates.
Materials & Methods: Retrospective evaluation of antifungal susceptibility for A. fumigatus isolates from bronchoalveolar lavage (BAL) fluid in pts with invasive pulmonary aspergillosis was performed. All isolates were obtained from hematological pts admitted to National Research Center for Hematology (Moscow) between 2016 and 2020. All A. fumigatus species were identified by morphology, matrix-assisted laser desorption ionization time of flight mass spectrometry. The azole-resistant strains were identified by ITS, β-tubulin, calmodulin and actine gene sequencing. Antifungal susceptibility for A. fumigatus to voriconazole, posaconazole, itraconazole, amphotericin B, caspofungin, anidulafungin was carried out by Sensititre YeastOne Y010 AST Plate (Thermo Scientific, Waltham, MA, USA). The MIC of antifungal agents were read according to the CLSI (2020). Cyp51A was sequenced to establish the most common resistance mechanisms embedded in azole-resistant A. fumigatus.
Results: A total of 35 A. fumigatus were tested, of them 2 (5.7%) isolates had elevated minimum inhibitory concentrations (MIC) to voriconazole >8 μg/mL. The azole-resistant strains were identified as A. fumigatus sensu stricto by ITS, β-tubulin, calmodulin and actine gene sequencing. The first voriconazole-resistant A. fumigatus was isolated in 2017, the second—in 2020. Both voriconazole-resistant A. fumigatus were susceptible to other anifungal agents. Analyzes of Cyp51A gene of the two confirmed voriconazole-resistant A. fumigatus species revealed TR46/Y121F/T289A mutation in one isolate. Second isolate was positive for I242V mutation.
Characteristics of pts with invasive pulmonary aspergillosis caused by voriconazole-resistant A. fumigatus are presented in Table 1. Both pts under went allogeneic hematopoietic stem cell transplantation. Previous voriconazole regarding was used in one patient.
Conclusions: This is first report from Russia regarding detection of voriconazole-resistant A. fumigatus caused by TR46/Y121F/T289A mutation which is predominated in the world. The other potential resistance mechanism was caused by I242V mutation of the Cyp51A gene.

P131 First Case Report of Bloodstream Infection by Candida blankii, in a Neonate from Pakistan

Summiya Nizamuddin
Shaukat Khanum Memorial Cancer Hospital and Research Center
Objective: Invasive candidiasis is a cause of high morbidity and mortality in neonates. Recently, an outbreak of candidemia was reported due to the rare multidrug-resistant yeast Candida blankii in an Indian neonatal unit. We report the first case report of a blood stream infection caused by Candida blankii in a neonate, from Pakistan.
Materials and methods: Blood cultures grew C. blankii in a full term neonate, who was admitted in the Neonatal Intensive Care Unit of a small peripheral hospital in Punjab, Pakistan. Blood culture sample was received at the laboratory of the Shaukat Khanum Memorial Cancer Hospital and Research Centre. C. blankii was isolated on culture. Identification was confirmed on the Vitek MS. Antifungal susceptibility testing was performed by the Vitek 2 fungal susceptibility card.
Results: C. blankii candidemia was confirmed via the MALDI-TOF and was informed immediately. The child was admitted in the neonatal unit following sepsis. The C. blankii strain was found to be resistant to fluconazole. The child was hence, treated with amphotericin. The neonatal unit team was duly informed to implement all infection control measures and be vigilant for any other neonates developing candidemia. However, no other cases of candidemia were seen.
Conclusions: The case report highlights of sporadic isolation of a rare and uncommon yeast, C. blankii, with reduced susceptibility to antifungal agents in nosocomial fungaemia. Genomic analysis of this strain would be required to analyze relatedness to the Indian strains.

P132 Preliminary Data on Aspergillus flavus Epidemiology in France

Lise Bertin 1, Stéphane Bretagne 2, Karine Sitbon 2, Jean-Pierre Gangneux 3 and Fanny Lanternier 1,2
  • 1 Necker Hospital, Aphp
  • 2 Institut Pasteur
  • 3 University and Hospital Center of Rennes
Objectives: Invasive aspergillosis is mainly known through Aspergillus fumigatus, which essentially causes lung damage. Other aspergillus species are also a source of various infections in humans. Among those, Aspergillus flavus is the main pathogen of Ear-Nose-Throat (ENT) localizations (sinus, ophthalmologic, auricular). It can also be the cause of cutaneous or lung infections.
Due to its lower frequency, few clinical cases and meta-analyzes are reported and this pathogen remains poorly understood.
Materials & Methods: We studied risk factors, localizations and prognosis of A. flavus infections. For this purpose, we studied here 54 cases recorded since 2012 in its database by the French National Reference Center for Invasive Mycoses and Antifungals (NRCMA) as part of its surveillance assignments (RESeau de Surveillance des Infections Fongiques invasives en France, RESSIF).
Results: Our preliminary results found two major risk factors: blood malignancies (29/54, 53%) mainly acute leukemia under corticosteroid or immunosuppressive therapy and type 2 diabetes (14/54, 26%). We also observed 9 cases of various solid organ transplant (kidney, heart or lung) under immunosuppressive therapy (2/9 with type 2 diabetes associated), 2 patients suffering from major burns, 1 case with type 1 diabetes and 1 case of drugs induced neutropenia.
In agreement with previous studies, A. flavus predominantly affects the lungs (72% of cases) or/and ENT system (34% of cases) with frequent extension to the skull base.
The lung was the main localization in patients suffering from blood disorders (25/29, 86%), in contrast to patients with diabetes for whom it was mostly the ENT system (12/14, 85.7%).
The global mortality was high, 53% mortality at 3 months, higher than that recorded for A. fumigatus infections. The most severe forms include disseminated disease and lung localization.
Conclusions: These preliminary results uncover two main patterns for A. flavus infections in France, highly dependent of the underlying conditions.

P133 Investigating Candida auris in West Africa

Oluwademilade Agbalaya 1, Gabriel Adeleke 1, Abdul-Wahab Ettu 2 and Rita Oladele 1
  • 1 Department of Medical Microbiology and Parasitology, College Of Medicine, University Of Lagos
  • 2 Marigold Hospital, Surulere
Objectives: Candida auris is an emerging pan resistant pathogen globally, and has been reported to cause outbreaks in a number of ICUs in Japan, India, USA, South Africa. It is of particular importance in resource limited settings such as ours where there is poor availability and accessibility of drugs needed to treat its infections. Candida auris was identified in 4 blood culture samples from 4 different hospitals in Nigeria using Vitek® 2 Compact. Three of the patients were in the ICU and one was a critically ill patient in a Gyneacological ward. The objective of this work was to investigate the potential reservoirs of the organism in the patients’ environment.
Materials & Methods: Two hospitals gave consent for environmental investigation which was carried out using the environmental surveillance toolkit adapted from CDC’s website. Swabs were collected from relevant environmental sources according to the toolkit’s guidance. The collected samples were then cultured on Saboraud Dextrose Agar slants at 37 °C for 24 to 72 h. Identification of yeast isolates was carried out using the Biomerieux Vitek® 2 Compact, and data analysis was done using Microsoft Excel.
Results: A total of 141 swab samples were collected from both sites, 60(42.5%) of the samples yielded growth. There were 9 yeast isolates: Candida rugosa 3(33.3%) from a bedside locker, mattress and a pulse monitor; Cryptococcus laurentii 2(22.2%) from an axilla and groin composite skin swab and a sink. Candida albicans 1(11.1%) was from a bed railing, Candida lusitaniae 1(11.1%) was from a bedside locker, Candida parapsilosis 1(11.1%) and Candida tropicalis 1(11.1%) was from drug carts. There were 20 mold isolates from bed railings (14;70%), drug carts (3;15%), bedside lockers (1;5%), matress (1;5%) and a sphygmomanometer (1;5%). There were 31(22%) bacteria isolates. No Candida auris was isolated in this study. Three patients died and one has been discharged wihout having had any antifungal therapy.
Conclusions: Candida auris was not isolated from the patients’ environment and this is not surprising, we lacked the resources to do this, like the environmental sponge sticks, circulating stomacher and the Candida auris Chromagar. Interstingly, quite a significant number of molds were isolated from bed rails, but not surprsing because we have a tropical climate and the ward windows are open down. It is imperative that in view of possible outbreaks of Candida auris, these resources be made available in our setting. Educating clinicians is also critical to curtail possible outbreaks.

P134 Invasive Osteoarticular Infections from the French Scedosporiosis/Lomentosporosis Observational Study (SOS): No Mortality with Long Term Antifungal Treatment and Surgery

Damien Blez 1, Didier Bronnimann 2, Dea Garcia-Hermoso 3, Fanny Lanternier 1,3 and French Mycoses Study Group
  • 1 Assistance Publique-Hôpitaux de Paris (APHP), Hôpital Necker-Enfants Malades, Université de Paris
  • 2 Hôpital Saint André
  • 3 Unité de Mycologie Moléculaire, CNRS, French National Reference Center for Invasive Mycoses & Antifungals, UMR 2000, Institut Pasteur
Objectives: Little is known about localized osteoarticular Scedosporiosis (LOS). Most of the data come from case reports and small case series. Here we present an ancillary study of the nationwide French Scedosporiosis Observational Study (SOS), describing 18 well documented consecutive cases of LOS between January 2005 and December 2015.
Materials & Methods: All adult patients diagnosed with LOS defined by osteoarticular involvement without distant foci reported in SOS were included. All cases were carefully reviewed to exclude eumycetomas and malignant otitis.
Results: 17 proven and 1 probable LOS were analyzed. All patients had trauma or an underlying disease as predisposing condition. Ten out of 18 patients had an underlying disease (2 had only diabetes while the others were immunocompromised). Fourteen out of 18 patients had prior related trauma that could account as potential inoculation. The anatomical sites involved were joints (44%), long bones (28%), spine (17%) and thoracic wall (11%). The most common clinical manifestation was pain (87%), followed by abscess (44%), swelling joint or limb (39%), cutaneous fistulization (39%) and fever (33%). Involved species were S. apiospermum (n = 10), S. boydii (n = 4), L. prolificans (n = 3) and S. dehoogi (n = 1). The species distribution was unremarkable except for the S. boydii bones and joints infections (BJI) that were associated with healthcare inoculations. The management was based on medical and surgical treatment for 72% of the patients. One patient did not receive antifungals and four patients did not undergo surgery. The median duration of antifungals was 7.6 months. Patients received voriconazole in 94% of cases. All patients were eventually cured or stabilized on antifungal therapy. Three patients (17%) required suppressive therapy, one patient underwent limb amputation. Compared to other invasive Scedosporiosis (n = 73) in the SOS database, localized osteoarticular disease was associated with less haematologic malignancies (0% vs. 46%), more traumatic inoculations (78% vs. 8%), required more often surgical management (78% vs. 41%) and had lower 3-months mortality (0% vs. 32%) (p < 0.05).
Conclusions: Despite an overall good clinical outcome compared to other invasive Scedosporiosis, LOS was associated with a heavy morbidity due to extended courses of antifungals, multiple surgeries and repeated hospitalizations. This underscores the importance of raising awareness of this disease and the need to improve the knowledge about its optimal management.

P135 Kazachstania Slooffiae, an Emerging Pathogen to Watch out for?

Ana Cristina Gallotti 1, Maria Soledad Cuétara 1, Maria del Mar Lombera Garcia-Corona 2, Ignacio Pinilla 3, Alberto Nieto 4, Jorge Ligero Lopez 1 and Oscar Zaragoza 5
  • 1 Microbiology department. Severo Ochoa University Hospital
  • 2 Digestive unit. Severo Ochoa University Hospital
  • 3 Department of Pathology. Severo Ochoa University Hospital
  • 4 Microbiology department. Badajoz University Hospital
  • 5 Mycology Reference Laboratory of National Centre for Microbiology
Introduction: Kazachstania slooffiae formerly known as Candida slooffiae is a member of the Kazachstania telluris species complex, which includes Kazachstania bovina, Kazachstania pintolopesii, Kazachstania slooffiae, Kazachstania heterogenica y Kazachstania telluris. It has been isolated from horse and porcine gut. Fatal cases in animals have been described but little is known about its role as pathogen in humans.
We report a case of an elderly man who is followed by the digestive unit due to esophageal dilation, a gastroscopy was performed obtaining samples for microbiology and anatomopathology, and K. slooffiae was isolated.
Case report: 80-year-old male patient, with a previous history of prostate cancer, consulted for progressive dysphagia and was initially evaluated with a barium gastroduodenal study that showed a significantly dilated oesophagus. An upper endoscopy was requested. The mucosa was covered with a whitish irregular layer, apparently thick. Biopsies of the oesophageal mucosa demonstrated a paved non-keratinizing mucosa with a polymorphonuclear inflammatory infiltrate and the PAS stain showed fungal structures.
The biopsy sample was seeded onto Sabouraud dextrose agar and incubated at 35 °C. Colonies were shiny, cream-colored with lobate margins. The identification was performed with the MALDI-TOF MS analysis of the MALDI Biotyper instrument equipped with MALDI Biotyper software version 4.1.14, obtaining Kazachstania slooffiae score of 1.71. Fungal identification was confirmed in the Mycology Reference Laboratory of the National Centre for Microbiology by sequencing the internal transcribed sequence from the ribosomal DNA. ITS region was amplified by PCR using ITS1 (5′TCCGTAGGTGAACCTGCGG3′) and ITS4 (5′TCCTCCGCTTATTGATATGC3′) oligonucleotides. Finally, the PCR products were sequenced using ITS1 and ITS4 oligonucleotides using the Sanger protocol. Correct identification was confirmed using the database of the ITS sequences of the Mycology Reference Laboratory of the National Centre for Microbiology using Infoquest software (version 4.5, BioRad).
Antifungal susceptibility testing was performed using Sensititre® YTAMYUCC panel (Thermofisher® Scientific). This showed MICs (πg/mL) to amphotericin B 0.25, fluconazole 0.25, posaconazole 0.015, voriconazole 0.008, itraconazole 0.015, isavuconazole 0.008, anidulafungin 0.06, micafungin 0.03 and caspofungin 0.125.
The patient underwent a 10-days fluconazole treatment, after which he described an important clinical improvement and no longer complaint for dysphagia.
An endoscopy was repeated after a month of the end of the treatment and biopsies were taken. No more fungal structures were seen and microbiological cultures were negative.
Discussion: K. slooffiae is an uncommon yeast. As far as we know, there has been only one previous case in humans. In our patient, being the only pathogen seen and cultured in the oesophageal biopsy, supported the empirical treatment with fluconazole. Based on the good clinical-histological-mycological response we believe that this yeast was responsible for the clinical picture of our patient.
Conclusions: This case reflects that there are no uniformly non-pathogenic fungi: any fungus can cause infection in a sufficiently immunocompromised host and should never be dismissed out of hand as a contaminant.
These new species might lead to issues with identification and antifungal susceptibility reason why clinicians should be aware of infections with uncommon yeast species and consider confirmation through DNA sequencing.

P136 Screening of Agriculture Fungicides to Inhibit the Growth of Emerging Fungal-like Pythium insidiosum

Hanna Yolanda 1,4, Tassanee Lohnoo 2, Thidarat Rujirawat 2, Wanta Yingyong 2 and Theerapong Krajaejun 3
  • 1 Section for Translational Medicine, Faculty of Medicine, Ramathibodi Hospital, Mahidol University
  • 2 Research Center, Faculty of Medicine, Ramathibodi Hospital, Mahidol University
  • 3 Department of Pathology, Faculty of Medicine, Ramathibodi Hospital, Mahidol University
  • 4 Department of Parasitology, School of Medicine and Health Sciences, Atma Jaya Catholic University of Indonesia
Objectives: Pythium insidiosum is a fungal-like microorganism, belongs to the class Oomycete. This organism causes the life-threatening disease, called pythiosis, in humans and animals, usually manifested as arteritis, keratitis, and granulomatous cutaneous ulcers. The disease has been increasingly reported worldwide. P. insidiosum morphologically resembles filamentous fungi that are frequently misdiagnosed as fungal infection in a clinical setting. The antifungals drugs are less effective against P. insidiosum due to the lack of drug-target ergosterol biosynthesis enzymes. An effective anti-P. insidiosum drug is needed for the treatment of pythiosis. Currently, a handful of agriculture fungicides show inhibitory effects against a broad range of plant-pathogenic oomycete organisms. This study aims to screen such fungicides for a non-toxic chemical that can inhibit the growth of P. insidiosum.
Materials & Methods: Screening of 24 agriculture fungicides that exhibit inhibitory activity against plant-pathogenic oomycete through the PubChem database revealed 6 chemicals (i.e., mandipropamid, fluopicolide, cyazofamid, fenamidone, oxathiapiprolin, and dimethomorph) lack adverse characteristics, such as irritation, corrosion, acute toxicity, and health hazard. These agriculture fungicides were initially evaluated for inhibitory effect against 3 phylogenetical distinct strains of P. insidiosum (i.e., strains CBS101555, P38, and ATCC90586) isolated from humans and animal with pythiosis in Thailand, Brazil, and United States. A radial growth assay was employed for the in vitro susceptibility analysis. Each chemical was tested against P. insidiosum in 3 biological replicates, using the concentration range of 0.25–128 μg/mL. The percentage of the colony’s radial growth of the treated organism was calculated in relation to the untreated control. The microscopic changes of the microorganisms were recorded.
Results: Fluopicolide, cyazofamid, and fenamidone showed solid inhibitory activity that reduced the P. insidiosum growths by at least 70% compared to the control (Figure 1). Their MICs were 8, 16, and 64 μg/mL, respectively. The microscopic examination of P. insidiosum exposed to 0.5 μg/mL of fluopicolide or cyazofamid demonstrated ballooning hyphal tips and frequently branching spiral hyphae, respectively (Figure 2). Mandipropamid, oxathiapiprolin, and dimethomorph showed no significant inhibition against P. insidiosum.
Conclusions: Fluopicolide, cyazofamid, and fenamidone exhibited good inhibitory activity against P. insidiosum. Further studies are needed to confirm the anti-P. insidiosum effect, investigate the safety, and explore their antimicrobial mechanism.

P137 Respective Roles of the Transcription Factors Tac1 and Mrr1 in Candida auris Azole Resistance

Jizhou Li 1,2, Alix T Coste 1, Daniel Bachmann 1, Dominique Sanglard 1 and Frederic Lamoth 1,2
  • 1 Microbiology Institute, University Hospital Lausanne
  • 2 Infectious Diseases Service, Department of Medicine, Lausanne University Hospital and University of Lausanne
Objectives: Candida auris is an emerging yeast pathogen, which has attracted worldwide attention because of its ability to develop multidrug resistance and to cause nosocomial outbreaks. Remarkably, development of fluconazole resistance is a hallmark of C. auris. Several mutations in the azole target gene ERG11 were found to play a role in C. auris azole resistance. Moreover, overexpression of the drug transporters Cdr1 and Mdr1, resulting from gain-of-function mutations in the transcription factors Tac1 (Tac1a and Tac1b) and Mrr1, may contribute to azole resistance. The objective of the study was to investigate the respective and combined roles of Tac1 and Mrr1 in C. auris azole resistance.
Methods: Single and double deletions of TAC1 and MRR1 were performed by CRISPR-Cas9 in one C. auris isolate from clade III (III.8). Antifungal susceptibility testing was performed for assessment of the minimal inhibitory concentrations (MIC) of fluconazole (FLC) and voriconazole (VOR) by standard microbroth dilution method. CDR1 and MDR1 expression was measured by quantitative reverse transcription PCR (RT-qPCR).
Results: Double deletion of TAC1a and TAC1b in the C. auris III.8 isolate (III.8 tac1a/tac1b strain) resulted in a 2-fold MIC decrease for FLC (512 to 256 g/mL) and VOR (2 to 1 g/mL). Deletion of MRR1 (III.8 mrr1 strain) led to the same effect with a 2-fold MIC decrease for both FLC and VOR. Simultaneous deletion of TAC1a/b and MRR1 (III.8 tac1a/tac1b/mrr1 strain) resulted in a 4-fold MIC for both FLC and VOR compared to the parental III.8 strain (FLC: 512 to 128 g/mL; VOR: 2 to 0.5 g/mL). RT-qPCR showed that TAC1a/b deletion resulted in a 1.36-fold increase of CDR1 expression (p = 0.025) without significant change of MDR1 expression, while MRR1 deletion resulted in a 13.44-fold decrease of MDR1 expression (p = 0.0002) without impact on CDR1 expression (Figure 1). Both individual effects (modest CDR1 overexpression and important MDR1 repression) were observed in the III.8 tac1a/tac1b/mrr1 strain.
Conclusions: This study shows the respective and combined roles of the transcription factors Tac1 and Mrr1 in C. auris azole resistance. Notably, double TAC1 and MRR1 deletion resulted in a significant and higher decrease of azole resistance compared to the single deletions.

P139 COVID-19 Associated Disseminated Mucormycosis in a Young Obese Non-Diabetic Asian Male

Vidya Krishna 1, Jaymin Morjaria 2, Rona Jalandari 4, Fatima Omar 4 and Sundeep Kaul 2,3
  • 1 Department of Infectious Diseases, Immunology and BMT, Great Ormond Street Hospital
  • 2 Department of Respiratory Medicine, Royal Brompton and Harefield Hospital, Guy’s and St. Thomas Hospital NHS Foundation Trust
  • 3 Department of Intensive Care, Royal Brompton and Harefield Hospital, Guy’s and St. Thomas Hospital NHS Foundation Trust
  • 4 Department of Cardiology, Royal Brompton and Harefield Hospital, Guy’s and St. Thomas Hospital NHS Foundation Trust
Objectives: COVID associated mucormycosis(CAM) has gained attention after the recent outbreak in India. While rhino-orbital cerebral is the commonest presentation reported, especially in diabetics, we present a case of disseminated mucormycosis in a non-diabetic young obese Asian male. There was no ante-mortem clue to mucormycosis in spite of extensive workup. We wish to highlight the importance of this unique presentation of disseminated mucormycosis as a thrombo-embolic disease and systemic sepsis which can be difficult to differentiate from severe progressive COVID-19 disease. To the best of our knowledge, this is the first documented case of disseminated mucormycosis in COVID-19.
Materials & Methods: A 22-year-old obese (BMI-44 kg/m2) Asian descent male, with known hypothyroidism, was hospitalised in April 2020 with a right anterior cerebral artery (ACA) stroke and severe COVID-19 pneumonitis. He had no prior history of diabetes mellitus and his average blood glucose during his ICU stay was 8.4 mmol/L. He had multi-organ dysfunction involving lungs, kidneys, liver, brain and pancreas requiring mechanical ventilation and renal replacement therapy (CVVHDF). He subsequently developed pulmonary thrombosis, haemorrhagic transformation of his cerebral infarct, and pericarditis as identified by appropriate imaging modalities.
He had recurrent episodes of vasoplegic shock with persistent lymphopenia, raised inflammatory markers (CRP >300 mg/Land Pro-calcitonin >100 ng/mL), D-dimers and troponin levels. Infective workup including a broncho-alveolar lavage and fungal biomarkers [serum 1,3-β-D-glucan (BDG) and galactomannan (GM)] were negative.
He received hydroxychloroquine, azithromycin, meropenem, teicoplanin, tigecycline, caspofungin and steroids along with systemic anti-coagulation and anti-platelet therapy. Despite broad spectrum anti-microbial therapy, he succumbed to the disease 20 days after the illness onset. Autopsy findings revealed disseminated mucormycosis in his lungs, pericardium, hilar nodes and cerebral capillaries in the infarct zone showed fungal thrombi with vasculitis and cerebral invasion. Severe COVID 19 pneumonia, haemorrhagic pancreatitis and steato-hepatitis were also reported.
Results: Our patient’s clinical and laboratory parameters demonstrated persistent sepsis with multi-organ dysfunction. He had negative bacterial and fungal workup with no response to empirical broad-spectrum anti-microbial therapy. His clinical course was attributed to progressively severe COVID-19 disease until the autopsy revealed associated disseminated mucormycosis. He did not have any radiology or microbiology indicative of mucormycosis, and thrombo-embolic manifestations were thought to be consistent with severe SARS-CoV-2 infection.
We hypothesize that the primary site of mucormycosis infection in him was the lung, as has been often reported in the literature, with local migration to the mediastinum and haematogenous spread to the brain.
Conclusions:
  • In critically ill COVID-19 patients in septic shock unresponsive to conventional anti-microbial therapy with features of immune dysregulation and thrombosis, there should be a high index of suspicion for invasive mycoses including mucormycosis especially when BDG and GM are negative. Empirical amphotericin may be a therapeutic option to consider.
  • There is a need for novel and efficient biomarkers and diagnostic assays to help in early diagnosis of mucormycosis.
  • Conducting more post mortem studies in severe COVID patients will help identify the exact spectrum of CAM.

P140 Delineation of the Direct Contribution of Mutations in Candida auris ERG11 and TAC1B to Triazole Resistance alone and in Combination

Jeffrey M. Rybak, Katherine S. Barker and P. David Rogers
St. Jude Children’s Research Hospital
Objectives: Candida auris is an emerging fungal pathogen of great clinical concern. Greater than 90% of all C. auris isolates exhibit high-level fluconazole resistance with MIC typically as high as or even exceeding 256 mg/L. While it has previously been shown that mutations in both ERG11 and TAC1B are common among fluconazole-resistant clinical isolates of C. auris, the extent to which these mutations, alone or in combination, impact MIC to each of the triazole antifungals remains unknown. The objective of these studies is to determine the direct contribution of mutations in C. auris ERG11 and TAC1B to triazole resistance alone and in combination.
Materials & Methods: Two clinical isolates of C. auris exhibiting multi-antifungal resistance and harboring mutations in both ERG11 and TAC1B, one from Clade 1b (Isolate B) and one from Clade 1c (Isolate C), were used in these studies. Each of these isolates exhibit combinations of fluconazole-resistance associated genotypes previously reported among multiple clinical isolates from different countries of origin (Isolate B: ERG11Y132F and TAC1BA583S, Isolate C: ERG11K143R and TAC1BA640V). A Cas9-mediated genetic manipulation system was used to replace mutations of interest in C. auris ERG11 and TAC1B with the wildtype sequence (matching the B8411 clade I reference). MIC for triazole antifungals were determined by broth microdilution.
Results: In Isolate B, introduction of the ERG11WT genotype resulted in a 32-fold reduction in fluconazole MIC (128 vs. 4 mg/L), while introduction of the TAC1BWT genotype decreased fluconazole MIC by 4-fold (128 vs. 32 mg/L). Changes in voriconazole MIC were similar to those of fluconazole, while isavuconazole, itraconazole, and posaconazole MIC remained largely unchanged. In Isolate C, introduction of the ERG11WT sequence in place of the mutation encoding K143R lowered fluconazole MIC by 8-fold. MIC for voriconazole, isavuconazole, and posaconazole were reduced 2-fold, while itraconazole MIC remained unchanged. By contrast, introduction of the TAC1BWT sequence in place of the mutation encoding A640V alone was sufficient to lower MIC for all 5 clinically available triazoles by 8 to 32-fold. Introduction of the wildtype sequence for both ERG11 and TAC1B in Isolate C resulted in a 128-fold reduction in fluconazole MIC, while MIC of the other triazoles were similar to those observed upon introduction of the wildtype TAC1B sequence alone.
Conclusions: These studies demonstrate that mutations in C. auris ERG11 and TAC1B both contribute to the high degree of fluconazole resistance observed among clinical C. auris isolates. Additionally, the contribution of specific mutations in either of these genes vary significantly, with the mutation encoding the A640V substitution in TAC1B alone most significantly increasing resistance to the entire triazole class. Further research is needed to determine if this difference in impact on triazole resistance extends to other ERG11 and TAC1B mutations.

P141 Chronic Disseminated Bipolaris Phaeohyphomycosis from Prolonged Hazardous Indoor Exposure to Documented Airborne Stachybotrys and Bipolaris

Irene Grant and Ameet Kamat
Integrative Medicine Group
Objectives: Case Report describing prolonged course of chronic Bipolaris infection, Methods and Materials: Prospective Medical Care and photographic timeline.
Results: Within a year of living with a collapsed bathroom ceiling, recurrent water/sewage intrusion and elevated airborne Stachybotyrs and Bipolaris spores, a 27 year-old female developed widespread ulcerative cutaneous/oral lesions, a rapidly growing 15 cm black nodular necrotic liver mass occupying 70% of the R. lobe, which at surgery was adherent to the vena cava and diaphragm and presumptively diagnosed as focal nodular hyperplasia without any fungal studies done.
Over the next 10 years she developed progressive relapsing multisystem symptoms with disfiguring subcutaneous face-scalp swelling and induration, diffuse ulcerations with pox- keloid-like scarring, chronic nasal bloody discharge with bloody tissue “chunks”, granulomatous rhinosinusitis, nasal osteochondritis, chronic scalp and neck lymphadenitis, diffuse scalp alopecia, 2–3” hairline recession, striking hair change [straight blond to curly jet black], dark olive green-blue-grey oral thrush, swollen red-purple soft-palate and throat, recurrent fluctuating neurological symptoms with neurocognitive impairment, twitching, foot drop, choreiform movement disorder, paresis, CSF lymphocytosis and a putamen basal ganglia lesion.
Cellular and adaptive immunodeficiencies were repeatedly documented: lymphopenia, Eosinophilopenia [undetectable], low CD3 (Mature T memory cells), CD8 Lymphocytes (T suppressor cells), CD16+CD56 Natural Killer Lymphocytes, Low CD19+ lymphocytes (B cells), and Low IGG subclass 3.
She received numerous empiric treatments over the next 10 yrs from multiple physicians for multiple unproven diagnoses (leukcocytoclastic vasculitis, Raynaud’s, Sjogren’s, Systemic Lupus Erythematosus, PANDAS, chronic EBV, “sero-negative” Lyme disease, seronegative tick borne disease, lepromatous leprosy, Sjogren’s, chronic EBV, leukcocytoclastic vasculitis, granulomatous sinusitis, encephalitis, and Leishmaniasis).
In Year #6 nasal fungal culture documented filamentous Aspergillus-like spp. “Not fumigatus, flavus or niger”. Partial improvement in skin and neurological occurred with courses of voriconazole, and later albendazole.
Every re-exposure to moldy indoor environments, steroids, and methotrexate acutely triggered further deterioration, flaring neurological symptoms. Symptoms temporarily abated with repeated sinus surgical resections and partially responded to Amphotericin irrigation, and voriconazole or albendazole.
In Year #10, nasal hawk-bill deformity developed with fronto-ethmoid mucoperiosteal thickening and a polypoid mass that grew despite broad-spectrum antibacterial therapy. At microscopy showed inflamed granulomatous tissue, foreign body giant cell reaction, nasal Septum Bone Cartilage with many white blood cells, yeasts, molds, and rare thin Branching Gram Positive rods on gram stain; septated hyphae on KOH, and Candida lipolytica and Bipolaris on culture. Strikingly obvious clinical improvement in all symptoms occurred within 3 weeks of intravenous liposomal Amphotericin. Clinical course complicated by renal toxicity. Recurrences occurred with interruption in antifungal treatment.
Photograph Time of Physical Findings to be provided.
Conclusions: Bipolaris infection requires definitive diagnosis and prolonged monitoring to be effectively treated.

P142 Highly Drug Resistant Mucormycosis in a COVID Infected Patient

Khaled Alobaid 1, Sara Mazloum 2 and Abdullah Al-Hatmi 3
  • 1 Mycology Reference Laboratory, Mubarak Al-Kabeer Hospital, Kuwait
  • 2 Microbiology Unit, Medical Laboratory Department, Jaber Al Ahmad Hospital
  • 3 Natural & Medical Sciences Research Center, University of Nizwa
Introduction: During it’s second year, SARS CoV2 have continued to infect a huge number of people causing considerable morbidity and mortality. The presence of secondary fungal infections such as candidemia and aspergillosis in critically COVID 19 infected patients pose diagnostic and therapeutic challenges and seem to worsen the patients outcome. Recently, mucormycosis related cases have been reported in different geographic regions. We report here for the first time a case of mucormycosis in a COVID 19 infected patient.
Case report: An-85-year old man, who is known to have diabetes, hypertension and ischemic heart disease, was admitted with pneumonia one week after being infected with SARS CoV2. His chest X ray showed diffuse bilateral infiltration. He was treated with ceftriaxone 1 gram once daily, methylprednisone 1 mg/kg once daily, and oxygen therapy 5 L. One week later, he developed a stroke and was shifted to ICU for ventilatory support. Methylprednisone was replaced by dexamethasone 6 mg once daily. An endotracheal aspirate was sent for culture which grew a mould next day. Few days later, he developed acute renal impairment and septic shock requiring inotropic support. The mould was identified as Rhizopus arrhizus and the patient was started on liposomal amphotericin B 50 mg once daily. However, the patient died few days later. Antifungal susceptibility testing performed by E test revealed very high MICs against amphotericin B (>32 µg/mL) and posaconazole (>32 µg/mL).
Discussion: Although the apparent coexistence of COVID 19 and mucormycosis is debatable and is currently subjected to a critical analysis, the reported cases so far, reveal a significant morbidity and mortality. Our patient was diabetic and had received steroids, and both are known risk factors for mucormycosis. In addition, his old age, occurrence of COVID 19, and new onset stroke have resulted in a poor outcome. What is more frightening, is the presence of multidrug resistance associated with the etiological agent: Rhizopus arrhizus. The case calls for comprehensive and critical analysis in mucormycosis associated COVID 19 cases to understand pathogenesis and epidemiology of such dreadful coinfection. In addition, antifungal susceptibility testing should be standard of care especially in invasive infections.

P143 A Monocentric Outbreak of Saprochaete clavata Seen in COVID-19 Pandemic

Irem Nida Akkoyun 1, Ozlem Alhan Guncu 1, Nurcan Duman 2, Arzu Ilki 2 and Zekaver Odabasi 1
  • 1 Department Of Infectious Diseases and Clinical Microbiology, Marmara University
  • 2 Department Of Medical Microbiology, Marmara University
Objectives: Saprochaete clavata (formerly Geotrichum clavatum) is a yeast-like filamentous fungus that is usually first seen as fungal growth with pseudohyphae formation in blood cultures. S.clavata isolates are usually resistant to echinocandins and have high mortality rates.
Materials & Methods: We describe 7 cases of S.clavata infections between March–May 2021 in Marmara University Hospital. All yeast strains from blood, respiratory, and urine specimens were grown on blood agar at 37 °C for 48 h in aerobic conditions. These strains were subcultured onto Sabouraud dextrose agar (SDA) and incubated at 30 °C and 37 °C for 48 h in mycology laboratory. S clavata formed dry cottony colonies with frosted glass appearance on the agar, macroscopically (Figure 1). In microscopic examination true fragmented hyphae, pseudo-hyphae, and arthroconidia formations were determined (Figure 2). Isolates were identified by MALDI-TOF MS (Vitek MS, BioMerieux, Marcy-l’ÉtoileFrance).
Results: The clinical characteristics and therapeutic agents of patients are summarized in table-1. Five of seven patients were hospitalized in the intensive care unit and the other 2 patients were hospitalized in hematology ward. The source of fungal isolates was; 4 “blood”, 3 “urine” and 2 “deep tracheal aspirate”. Four patients had fungemia, two patients were diagnosed with upper urinary tract infection, and one possible fungal pneumonia. Six patients had the Covid-19 infection. Three patients had hematological malignancy and were under anti-mold prophylaxis included in their chemotherapy regimens. All patients were taking a high dose of steroids and broad-spectrum antibiotics. One patient died on the day of fungal blood growth without receiving any antifungal treatment, all other 6 patients were treated with the combination of liposomal amphotericin B and +/− voriconazole. The treatment of two patients with acute leukemia was completed 14 days after the first negative blood cultures.
Conclusions: S.clavata infection represents a life-threatening mycosis in immunosuppressive patients and first time in literature we showed an outbreak of S.clavata in Covid-19 patients. The use of high-dose steroids in the treatment of Covid-19 is probably the most important risk factor for the development of S.clavata infection.

P144 COVID-19 Associated Mucormycosis: Mixed Mucorales Infection

Harsimran Kaur 1, Rimjhim Kanaujia 1, Shivaprakash M Rudramurthy 1, Naresh K Panda 2 and Arunaloke Chakrabarti 1
  • 1 Department of Medical Microbiology, PGIMER
  • 2 Department of Otolaryngology, PGIMER, India
Objectives: To describe five cases of COVID-19 associated mucormycosis (CAM) caused by two different Mucorales.
Materials & Methods: Endoscopic nasal scrapings/biospy from the patients suspected of mucormycosis before and after surgery were subjected to calcoflour white potassium hydroxide (KOH) microscopy and culture on Sabouraud dextrose agar (SDA) incubated at 25 °C and 37 °C and brain heart infusion (BHI) agar incubated at 25°C. Culture was identified phenotypically by lactophenol cotton blue preparation. Detailed history of the patients was obtained from their medical records.
Results: We identified five cases of CAM where more than one type of Mucorales were obtained in one or more samples. (Table 1) The mean age of the patients was 39 years and male: female ratio was 3:2. All these patients had history of diabetes (two recently diagnosed and rest ranging from 2–9 years). They presented with symptoms after 1–29 days of diagnosis of COVID-19. All patients presented with symptoms of rhino-orbital mucormycosis (ROM) namely facial/orbital pain, facial/orbital swelling, toothache and headache. The duration of symptoms ranged from 1–4 days. Direct microscopy of preoperative and post operative samples of all patients showed presence of aseptate, ribbon like hyphae (Image 1). All except one grew single species of Mucorales in preoperative samples [Rhizopus arrhizus (n = 2); Apophysomyces variabiliis (n = 1); Lichtheimia corymbifera (n = 1) and Rhizopus homothallicus and R. arrhizus (n = 1)] Concurrent growth of two different Mucorales was noted in postoperative samples of four patients [R. arrrhizus and R. homothallicus (n = 2); A. variabiliis and L. corymbifera; R. arrhizus and Mucor spp. (Image 2)] while one patient who grew L. corymbifera in preoperative sample showed growth of R. homothallicus in post-operative sample. All patients were managed surgically (maxillectomy or orbital exenteration) and with liposomal amphotericin B 3–5 mg/kg/day. One patient expired while others continue to improve.
Conclusions: Mixed infection by more than one Mucorales in CAM is unique. The emergence of Mucorales (R. homothallicus) other than the commonest R. arrhizus in India and the occurrence of dual infection warrants epidemiological investigation. Diabetes remains the most important risk factor for CAM in India. The interaction of Mucorales and SARS-CoV-2 might further provide some insight into emergence of CAM in India.
Image legends
  • Image 1: Calcoflour white potassium hydroxide mount showing flourescing aseptate, ribbon like hyphae of Mucorales (×400)
  • Image 2: Sabouraud dextrose agar showing mixed culture of R. arrhizus (greyish black fluffy growth on the left) and Mucor spp. (yellowish black fluffy growth in left and right tubes).
Table 1. Demographic, clinical and mycological details of cases of mixed Mucorales infection.
Age/SexResidenceDiabetes DurationSymptomsSymptoms Post COVID-19 Diagnosis (Days)ManagementOutcomeSampleSmear/Culture
123/MUttarakhandRecentToothache, left orbital pain, swelling × 3 days29Maxillectomy and OE, L-AMBImprovingNasal scrapingAseptate
L. corymbifera
Post-opAseptate
R. homothallicus
235/FUttar Pradesh8 yearsHeadache, toothache, left orbital pain, swelling × 4 days1Maxillectomy and OE, L-AMBImprovingNasal scrapingAseptate
R. arrhizus
Post-opAseptate
Mucor spp., R. arrhizus
332/MHaryanarecentRight facial pain, orbital swelling × 3 days2Maxillectomy and OE, L-AMBExpiredNasal scrapingAseptate
A. variabilis
Post opAseptate
L. corymbifera, A. variabilis
462/MHaryana9 yearsRight facial pain, swelling × 1 day1Maxillectomy, L-AMBImprovingNasal scrapingAseptate
R. arrhizus
Post opAseptate
R. homothallicus, R. arrhizus
541/FHaryana2 yearsRight orbital pain, swelling × 4 days1Maxillectomy, L-AMBImprovingNasal scrapingAseptate
R. homothallicus, R. arrhizus
Post opAseptate
R. homothallicus, R. arrhizus
Abbreviations: L-AMB: Liposomal Amphotericin B; OE: Orbital exenteration; Post-op: Post-operative sample.

P145 Candidemia Clonal Outbreak Caused by Emerging Fluconazole-Resistant Candida parapsilosis Isolates during the SARS-CoV-2 Pandemic in a Northern Italy Hospital

Valentina Lepera, Andrea Zappavigna, Chiara Gorrini, Roberta Schiavo, Irene Peroni, Lorena La Vergata, Claudia Cordini, Gabriella Tocci, Paolo Gigante, Domenico Caleca, Giulia Bandieramonte and Giuliana Lo Cascio
Unit of Microbiology, Department of Clinical Pathology, “Guglielmo da Saliceto” Hospital
Objectives: Candida parapsilosis (CPA), the most common species of Candida non albicans isolated from bloodstream infections, although usually susceptible to azoles, had been recently reported as an emerging multi-resistant yeast. Azoles play an important role in the therapeutic management of invasive candidiasis. In recent years, Candida isolates with acquired resistance to azoles have been reported more and more frequently. Therefore, antifungal susceptibility testing and the detection of mutations in resistance genes are becoming increasingly important to detect antifungal resistance and determine the underlying resistance mechanisms. Fluconazole prevents fungal cell growth by inhibiting 14-α-demethylase, which is responsible for the production of an ergosterol precursor and is encoded by the gene ERG11. As the current SARS-CoV-2 pandemic has evidenced that COVID-19 patients are more susceptible to secondary fungal infections, the aims of this study were: (1) to evaluate the incidence of invasive infection due to fluconazole-resistant CPA (CPA-R) strains during the SARS-CoV-2 pandemic, (2) to detect mutations in resistance genes of azole-resistant strains by sequencing, focusing on mutations and/or alterations of the ERG11 gene.
Materials & Methods: This study was conducted at the “Guglielmo da Saliceto” Hospital, Piacenza, Northern Italy in order to investigate the antifungal susceptibility to fluconazole of CPA isolates in blood cultures in two different periods: period 1 (March 2019–January 2020; control period) and period 2 (March 2020–January 2021; SARS-CoV-2 pandemic). Yeast identification was performed by using MALDI-TOF MS (Vitek MS, bioMérieux, France) and antifungal susceptibility was evaluated by using the Vitek2 system (bioMériueux, Marcy L’Etoile, France) and confirmed with Sensititre Yeast One YO10 (Thermofisher Scientific, Waltham, MA, USA) microdilution broth. ERG11 gene of the isolates was analyzed by sequencing according to Sanger method.
Results: The comparative evaluation revealed a 26.9% increase of C. parapsilosis blood isolates and a 160% increase of CPA-R strains in the period 2. Among the patients with CPA-R infection, 98.8% (11 of the 13 cases) had a diagnosis of COVID-19. Moreover, two possible clusters were observed analysing the temporal distribution of CPA-R strains during SARS-CoV-2 pandemic period: the first from April to June 2020 with 7 CPA-R strains and the second from December 2020 to January 2021 with 4 CPA-R strains. These clusters appear to follow a pattern overlapping the epidemiological waves of SARS- CoV-2 pandemic in Piacenza. The preliminary evaluation of ERG11 gene sequences in the isolated strains allowed to highlight the presence of Y132F mutation.
Conclusions: The observed increase in both infection and resistance rates among CPA blood isolates during period 2 and the presence of two clusters could be linked to COVID-19 from different points of view: severe COVID-19 infections expose patients to invasive secondary fungal infections and the spread of multidrug resistant strains likely escaped from control due to extraordinary involvement of infection control teams in the containment efforts of SARS-CoV-2 pandemic in Piacenza, one of the most affected Italian cities. The presence of the same mutation in the whole of the strains suggests the existence of a spreading cluster. Further investigations will be performed by NGS sequencing in order to confirm our suspicion.

P146 Molecular Epidemiology and In Vitro Susceptibility of 70 Respiratory Isolates of Paecilomyces spp.: A Multicenter Study

Lorra Monpierre 1, Nawel Aït Ammar 1, Anne-Cécile Normand 2, Isabel Valsecchi 3, Juliette Guitard 4, Arnaud Riat 5, Antoine Huguenin 6, Christine Bonnal 7, Boualem Sendid 8, Lilia Hasseine 9, Hélène Raberin 10, Loïc Favennec 11, Stéphane Ranque 12, Renaud Piarroux 2, Eric Dannaoui 13 and Françoise Botterel 1
  • 1 Henri Mondor Hospital APHP
  • 2 La Pitié-Salpêtrière Hospital
  • 3 UPEC
  • 4 Saint-Antoine Hospital
  • 5 Geneva University Hospital
  • 6 CHU Reims
  • 7 Bichat Hospital
  • 8 CHU Lille
  • 9 CHU Nice
  • 10 CHU Saint-Etienne
  • 11 CHU de Rouen
  • 12 CHU Marseille
  • 13 HEGP
Objectives: Paecilomyces spp. is a rare emerging fungal pathogen where P. lilacinus and P. variotii are the mostly species reported. Over the past few years, taxonomic revision of this fungus shown that P. variotii represents a species complex while P. lilacinus corresponds to a different genus namely Purpureocillium lilacinum. The aims of this study were to investigate the molecular and proteomic identification of clinical Paecilomyces spp. isolates and to determine their antifungal susceptibility profiles.
Materials & Methods: Seventy Paecilomyces spp. isolated from respiratory patient’s samples were collected from eleven university hospitals in France and Switzerland. Species identification was performed by ITS, D1/D2 and β-tubulin sequencing gene and by Matrix Assisted Laser Desorption Ionisation-Time Of Flight (MALDI-TOF). Protein spectra were analyzed by Brucker® Microflex-LT spectrometer (using both the MALDI Biotyper v3.0 and MSI v1 references databases), and by LT2-Andromas® spectrometer. For antifungal susceptibility, minimal inhibitory concentrations (MIC) or minimal effective concentrations (MEC) were determined for 8 antifungal drugs (4 azole, 1 polyene and 3 echinocandins drugs).
Results: Among the 70 Paecilomyces spp., identified by ITS sequencing, 25 (36%) were P. variotii stricto sensu, 18 (26%) P. formosus and 27 (38%) P. lilacinum. No strain has been responsible for an invasive fungal infection. The identification concordance between ITS and Microflex using Biotyper and MSI references databases was 65.7% and 97.1%, respectively. Concordance with Andromas was 92.9%. These differences mainly concerned P. formosus, which was misidentified by MALDI-TOF. The D1/D2 and β-tubulin gene sequencing are in progress. All P. lilacinum had high amphotericin B MICs and echinocandins MECs unlike P. variotii and P. formosus. Azoles MICs were variable (Table 1).
Conclusions: In our study, MALDI–TOF MS proved to be a rapid, reliable, and logistically simplified alternative to sequence-based analysis for the routine identification of Paecilomyces spp. Antifungal susceptibility is variable depending on the species. Therefore, identification is essential for management of invasive infection.
Table 1. Susceptibility of Paecilomyces isolates to antifungals by EUCAST.
Species VCZPCZIVZICZAMPCASMYCANI
P. variotii
Stricto sensu
(n = 25)
Range (mg/L)0.03–80.015–80.06–80.06–80.06–80.03–80.015–0.50.015–1
GM (mg/L)5.1790.1004.8880.5740.4181.7670.0470.068
P. formosus
(n = 18)
Range (mg/L)1–80.015–24–80.03–80.125–80.03–80.015–80.015–8
GM (mg/L)7.1270.0527.6980.7600.3810.9550.0970.077
P. lilacinum
(n = 27)
Range (mg/L)0.12–80.015–80.5–80.5–88–88–88–88–8
GM (mg/L)0.4490.6152.4756.8178888

P147 Isavuconazole for the Treatment of Patients with Possible Coronavirus Disease-Associated Aspegillosis (CAPA): A Single-Center Matched Case-Control Study

Vasso Georgakopoulou 1, Antonios Markogiannakis 1, Dimitris Basoulis 1, Angeliki Tsifi 2, Athanasios Kakasis 2, Nikolaos V. Sipsas 2 and Maria N. Gamaletsou 2
  • 1 Medical School of Athens, Laiko General Hospital
  • 2 Pathophysiology Department, Medical School of Athens, Laiko General Hospital
Objectives: The aim of this analysis was to assess differences in baseline clinical characteristics, selected biochemical markers and 30-day mortality in a group of patients with possible coronovirus disease-associated aspergillosis (CAPA) who were treated with isavuconazole compared with COVID-19 patients without CAPA in a matched case-control study conducted in General Hospital of Athens “Laiko”, a 535-bed tertiary hospital.
Materials & Methods: Sixteen among 1200 (1.3%) consecutive patients admitted in six COVID-19 clinics (5 internal medicine and 1 ICU), during the second phase of the pandemic in Greece (January–May 2021) were diagnosed with possible (15 patients) or confirmed (1 patient) CAPA. All 16 patients were treated with isavuconazole (isavuconazole treatment group-ITG). All patients in the ITG were matched with two patients presenting with common characteristics (sex, age, hospitalized in the same clinic and in the same time-period). In the analysis we have included a number of baseline characteristics: age, severity of illness, risk factors for coronavirus disease (e.g., obesity, diabetes, treatment with immunosuppressive agents), specific biochemical markers: white blood cells (WBC), C-reactive protein (CRP), number of lymphocytes, ferritin and X-ray score and finally the 30-day mortality. Associations between isavuconazole use for CAPA and other clinical/laboratory factors were investigated using univariable and multivariable conditional logistic regression models. Probability of death within 30 days from hospital admission was investigated using logistic regression models. P-values less than 0.05 were considered statistical significant.
Results: Regarding the use of isavuconazole for possible or confirmed CAPA, univariable analyses revealed a significant difference in favor of isavuconazole use in more severely ill patients (p = 0.031; Table 1). Moreover, isavuconazole was administered more frequently in patients who had more risk factors for severe COVID-19 (p = 0.04). Finally there was a notable trend towards using isavuconazole in patients with higher ferritin levels (p = 0.05). There was no statistically significant difference in the use of isavuconazole with regards to other variables: WBC, CRP, number of lymphocytes and X-ray score (Table 1). The patients who were treated with isavuconazole had a higher 30-day mortality compared to the control group (p = 0.007; Table 2). Other factors associated with increased 30-day mortality were the severity of illness (p < 0.001), age (p = 0.036), lymphopenia (p = 0.008) and possibly elevated ferritin levels (p = 0.075; Table 2). The only variable found to be statistically significant in multivariable analysis was the level of lymphocytes (OR = 0.78 per 100/mL; p = 0.022) whereas a trend was observed regarding number of risk factors (OR = 2.53 per 1 additional factor; p = 0.057).
Conclusions: In this study, we noticed that the use of isavuconazole as a treatment for possible or confirmed CAPA was highly associated with increased disease severity, higher ferritin levels and higher number of risk factors for severe COVID-19. Therefore, the patients who were treated with isavuconazole had a higher 30-day mortality compared to the control group. An increased 30-day mortality was also related to the severity of illness, number of risk factors and degree of lymphopenia. These findings are in accordance with the data that have been published to date.

P148 Exploring the Diversity of Yeast-like Prototheca Microalgae in Aquatic Environments: Comments on the Taxonomy and Description of Three New Species

Tomasz Jagielski and Mateusz Iskra
University of Warsaw
Objectives: The Prototheca genus (Trebouxiophyceae) comprises unicellular, nonphotosynthetic, yeast-like microalgae, associated with rare yet potentially very serious infections of animals and humans, collectively referred to as protothecosis. In animals, the disease most commonly affects dairy cattle, resulting in (sub-)clinical mastitis, while in humans the predominant manifestations are linked to cutaneous, articular, and systemic involvement. The taxonomy of the Prototheca genus has long been controversial and frequently revised. Recent studies based on the phylogenetic analysis of the apocytochrome B-coding sequence data have established a new taxonomic classification system of the Prototheca algae, installing within the genus a total of 15 species.
Although the Prototheca algae are believed to be ubiquitous in nature, since the mid-1980s, no studies have investigated in depth their environmental habitat. The purpose of this study was to explore the occurrence of Protothecae in a wide range of natural and artificial aquatic environments and demonstrate the species diversity of the algae by using a molecular taxonomic profiling approach.
Materials & Methods: In total, 362 samples were collected from freshwater and artificial water reservoirs across Poland over a 2-year period (2018–2020). Liquid and semisolid samples were spread on the Prototheca Isolation Medium (PIM) plates, either directly or after 48-h pre-incubation in liquid PIM. Plates were incubated at 30 °C for 2–5 days. Colonies suspected of being Prototheca spp., upon macro- and micromorphology observations, were subjected to species-level identification, by using PCR-sequencing of the CYTB gene. To better recognize the phylogenetic relatedness, ribosomal DNA sequencing was performed on selected Prototheca isolates. The assimilation profiles of new species were examined using API®20C AUX system (bioMérieux, France).
Results: Of the samples collected, 51 (14%) yielded Prototheca growth with P. wickerhamii being the most frequently isolated species (17 or 33.3%), followed by P. pringsheimii (12; 23.5%), P. cerasi (7; 13.7%), P. bovis (5; 9.8%), P. ciferrii (3; 5.8%), P. cookei (2; 3.9%), and P zopfii (1; 1.9%). Based on the CYTB gene and rDNA phylogenies, four isolates, designated PK1, PK2, PK6, and W3, were conspicuously different from all other Prototheca species described so far. Their CYTB gene sequences showed less than 88% similarity to each other and less than 96% to all other Prototheca species. Colonies of those strains were creamy-white, slightly raised, with a smooth surface and even margins. Each strain was of butyrous consistency except W3, whose colonies were clearly slimy. Upon auxanography, all strains utilized glucose, galactose, trehalose, whereas glycerol was assimilated only by W3 and PK2. Furthermore, PK1 grew much more slowly than the remaining isolates. The combined geno- and phenotyping concluded in the proposal of three new Prototheca species, namely Prototheca lentecrescens, Prototheca fontanea, and Prototheca vistulensis.
Conclusions: After four decades, this is the first study to explore thoroughly the occurrence of Prototheca spp. in water sources. Unexpectedly, Prototheca were isolated at a relatively low rate. This is in contrast to a common belief of environmental ubiquity of the algae. However, finding three novel species among so few strains recovered speaks of important species diversity of the Prototheca algae.

P149 Fungal Empyema Thoracis an Emerging Entity, a Case Series from Pakistan

Nousheen Iqbal 1, Aqusa zahid 2, Kausar Jabeen 2 and Muhammad Irfan 2
  • 1 Jinnah Medical and Dental College and Aga Khan Hospital
  • 2 Aga Khan Hospital
Objectives: Fungal empyema is a rare entity which is associated with high mortality. It is mostly seen in immunocompromised host. However there is little data available on fungal empyema from our country on pathogenesis, risk factors, treatment and outcome.
Materials & Methods: A retrospective observational study was done on proven fungal empyema cases in admitted patients at Aga Khan hospital Karachi Pakistan during January 2018 to May 2021.
Results: Total 26 patients were diagnosed, 16 (61.5%) were male. Mean age was 43.58 ± 20 years, common underlying comorbid was diabetes 10 (38.4%), folowed by hypertension 9 (34.6%), Malignancy 6 (23.07%) and 4 (15.38%) liver disease. Candida spp. Isolated in 18 (69.23%) patients [commonest was tropicalis in 9 (50.0%) and albicans in 6 (33.33%) patients], follwed by aspergillusspp. 7 (26.9%) patients, fusarium and mucor in 1 patient respectively. Video assisted thoracoscopy done in 11 (42.3%), conservative managemnet (chest tube& antifungal) done in 12 (46.1%) patients. Overall mortality seen 9 (34.6%) patients, 10 (38.4%) devloped respiratory failure, 11 (42.3%) had clinical improvement and 6 (23.07%) patients were lost to followup.
Conclusions: Our data suggest fungal empyema is not uncommon and necessitate high index of suspicion to prevent delay in diagnosis, treatment and imrpove outcome.

P150 Diabetes as Risk Factor for COVID-19 Associated Mucormycosis

Dora Edith Corzo Leon 1, Thomas Pichl 1, Luis David Chora-Hernandez 2, Rosa Colamarino 1 and Carol Munro 1
  • 1 University Of Aberdeen
  • 2 Hospital General Dr. Miguel Silva SSM
Objectives: The aims of this study is 1) to describe characteristics of COVID-19 associated mucormycosis (CAM) in diabetic individuals and 2) to describe phagocytosis of Rhizopus oryzae in an in vitro model simulating COVID-19 and high glucose environment.
Methods: Previous informed consent, clinical characteristics and outcomes from CAM cases have been identified during 2020 and 2021 in a newly established mycology reference centre in Western Mexico. At laboratory level, J774.1 macrophages were exposed to high glucose concentrations (4 mg/mL) and/or previously heat-inactivated (HI) supernatant containing viral proteins from wild type SARS-CoV-2 propagation in Vero E6 cells. After 24 h, these same macrophages were challenged with R. oryzae spores for 3 and 5 h. Engulfment and fungal killing was evaluated.
Results: Six CAM cases have been identified in diabetic individuals. Infections were diagnosed 20 days (IQR 13–25) after COVID-19 diagnosis. All patients received corticosteroids for more than 7 days, 5/6 had rhino-ocular damage and 3/6 had palate ulcer. Four cases were treated with amphotericin B deoxycholate and two were also treated with surgery. Mortality rate was 66% (4/6). In vitro, R. oryzae growth was faster when grown in both high glucose and HI viral supernatants compared to control culture medium. Neither high glucose nor viral supernatants affected uptake of R. oryzae spores by macrophages but intracellular hyphae production was higher in these two conditions after 3 and 5 h of co-incubation.
Conclusions: Diabetic individuals treated with corticosteroids due to severe COVID-19 are at high risk of mucormycosis. High glucose concentration and the COVID-19 environment impact on the immune response to Mucorales such as R. oryzae.

P151 Autochthonous Cryptococcus bacillisporus (AFLP5/VGIII) Infection in a Grey Parrot (Psitaccus erithacus), from Portugal

Carolina Silva 1, Carles Juan-Sallés 2, Joana Mendes 1, Ana Mendes 1, Mariana Ruivo 1, Juan Luis Abad 3, Ferry Hagen 4 and Francisca Colom 3
  • 1 VetExoticos, Veterinarian Clínic
  • 2 Noah’s Path, Veterinary Pathology Laboratory
  • 3 Medical Mycology, University Miguel Hernández, Institute for Healthcare and Biomedical Research of Alicante (ISABIAL)
  • 4 Department of Medical Microbiology, Westerdijk Fungal Biodiversity Institute, University Medical Center
Objectives: To report an autochthonous case of cryptococcosis caused by Cryptococcus bacillisporus (AFLP5/VGIII) in a 12-year-old female grey parrot (Psittacus erithacus) born and bred in captivity in Portugal.
Materials & Methods: The bird developed a several slow-growing masses (about 8 months) in the maxillar portion of the beak (rhinoteca). Given the suspicion of neoplasia, a biopsy of the mass was taken and sent for histopathological study, which detected the presence of yeasts morfologically suggestive of Cryptococcus. After obtaining the biopsy results, a second sample was obtained and cultured onto Sabouraud dextrose Agar. The yeast obtained in culture were further analyzed by phenotypic tests including CGB agar, urease and phenoloxidase production, carbon auxonograme by Auxacolor system (Biorad®), presence of polysaccharide capsule and melanine production onto L-DOPA agar, as well as molecular analysis by URA5-RFLP. Antifungal susceptibility was checked for amphotericin B, fluconazole and voriconazole using the E-test method. Multi-Locus Sequence Typing was performed to obtain the molecular profile of the strain that was compaired with other C. bacillisporus strains availables in public databases.
Results: Histopathology showed severe chronic granulomatous and necrotising dermatitis with serocellular crusting, fibrosis and intralesional yeast-like structures. Phenotypic and molecular analysis of the isolated yeast allowed the identification of Cryptococcus bacillisporus (AFLP5/VGIII) as the cause of the infection. Comparison of the MLST profile showed that the strain clustered within the group of C. bacillisporus strains from Mexico (Figure 1). The antifungal susceptibility testing showed a low response to fluconazole which was the initial empiric treatment administered, therefore, it was switched to amphotericin B in the parrot’s drinking water (600 mg per litre of water) with a good response after 6 months. The masses size was reduced significantly, although some chronic lesions remained in the rhinoteca, consisting mainly in queratine deposition anomalies and deformed beak growth.
Conclusions: Cryptococcus bacillisporus is a relatively rare cause of cryptococcosis in humans and animals, and most cases have been described in warm areas of the Americas and Oceania. Its description as a cause of cryptococcosis is exceptional in Europe.
Figure 1. Phylogenetic tree with Cryptococcus bacillisporus isolates clustered by the MLST information.

P160 The Rise of Zoophilic Dermatophytes during Corona Pandemic in Germany

Silke Uhrlass 1, Daniela Koch 1, Hanna Muetze 1, Constanze Krueger 1 and Pietro Nenoff 1
Laboratory of Medical Microbiology
Objectives: During the months-long lockdown due to the Corona pandemic, significantly more pets were probably bought and kept. Whether more zoophilic dermatophytes are subsequently isolated, and which species are in the foreground, is the focus of this study.
Methods & Materials: In the period of one year, from March 2020 to February 2021, all zoophilic dermatophytes from all submissions to the Mölbis laboratory were recorded. Both the cultural and the molecular evidence of fungal detection directly from skin scales, hair roots, in individual cases from nails were taken into account. For dermatophyte DNA detection an in-house-PCR (Polymerase chain reaction)-Elisa (Enzyme linked immunosorbent assay) was used. In distinct cases, identification of dermatophytes was confirmed by sequencing of the “internal transcribed spacer”- (ITS) region of the rDNA, and of the gene of the Translation Elongation Factor (TEF)-1α.
Results: In 2.7% of the 21290 materials studied, zoophilic dermatophytes were detectable with the PCR-Elisa. The total of 579 zoophilic dermatophytes split as follows (Figure 1): Trichophyton (T.) benhamiae 186 (32.1%), T. mentagrophytes 173 (29.9%), T. quinckeanum 110 (19.0%), Microsporum (M.) canis 78 (13.5%), T. verrucosum 22 (3.8%), Nannizzia (N.) persicolor 8 (1.4%), T. erinacei 1 (0.2%) and T. equinum 1 (0.2%). T. benhamiae had the highest prevalence from June to September 2020, then again in December. T quinckeanum is associated with a sharp increase in the mice population in Germany in 2020, a significant increase was found in the months September 2020 to January 2021 (Figure 2). T. mentagrophytes had a conspicuous peak in September, while M. canis did not have a conspicuous peak until November 2020. Up to 50% of the dermatophytoses caused by T. mentagrophytes. T. quinckeanum and M. canis affected children and adolescents, in the case of T. benhamiae it was as much as two thirds. Tinea corporis was the most common, followed by Tinea faciei and Tinea capitis. M. canis infections affected more common the scalp than the face.
Conclusions: Zoophilic dermatophytes were increasingly isolated during the lockdown due to the Corona pandemic in Germany. In the first place, the dermatophyte T. benhamiae from guinea pigs was found as the cause of Tinea corporis, Tinea faciei and Tinea capitis in children and adolescents. A significant proportion of dermatophytoses concerned adults. T. quinckeanum is an emerging pathogen in Germany with unprecedented high infection rates in 2020.
References: Uhrlaß, S.; Schroedl, W.; Mehlhorn, C.; Krüger, C.; Hubka, V.; Maier, T.; Gräser, Y.; Paasch, U.; Nenoff, P. Molecular epidemiology of Trichophyton quinckeanum—A zoophilic dermatophyte on the rise. J. Dtsch Dermatol. Ges. 2018, 16, 21–33.

P161 Otomycosis in Northern Iran: Epidemiology, and Diagnosis

Behrad Roohi 1, Tahereh Shokohi 1,2, Shadman Nemati 3, Abbas Alipour 4, Leila Faeli 1, Sabah Mayahi 2 and Iman Haghani 1
  • 1 Invasive Fungi Research Center, Communicable Diseases Institue, Mazandaran University of Medical Sciences
  • 2 Department of Medical Mycology, School of Medicine, Mazandaran University of Medical Sciences
  • 3 Department of Otolaryngology and Head and Neck Surgery, Otorhinolaryngology Research Center, School of Medicine, Guilan University of Medical Sciences
  • 4 Department of Community Medicine, Faculty of Medicine, Mazandaran University of Medical Sciences
Objectives: Otomycosis is a common type of external ear infection caused by a wide range of fungal species and affects the external auditory canal in tropical and subtropical regions. Due to the long period of treatment and recurrence, this may be challenging for physicians. It also can be fatal in acute invasive or chronic invasive forms. This study aimed to assess the epidemiologic pattern and etiological agents of otomycosis north of Iran.
Methods: In this cross-sectional study, all patients with clinical suspicion of otomycosis enrolled in a sequential random manner at ENT subspecialty referral center from October 2020 in a sequential random sampling method in Guilan province, near the Caspian Sea, northern Iran. Patients’ demographic characteristics, clinical findings, laboratory results, and risk-related disease factors were recorded. Each sample was examined by direct examination and cultured on Sabouraud Dextrose Agar with Chloramphenicol as well as CHROMAgar Candida. Definitive identification of fungal isolate was made by molecular methods. Our investigations are still ongoing.
Results: Out of 75 clinically suspected patients, 59 (78.7%) cases were confirmed after mycological investigation. 65 fungal strains isolated from these cases counting multiple fungal species infections. The most common symptoms were otalgia (52%) followed by itching (49.33%), the fullness of the ear (43.42%), hearing loss (17.11%), and tinnitus (13.16%). The most prevalent fungal agent was Aspergillus section nigri (24; 32%) followed by Candida spp. (14; 18.66%), Aspergillus section Flavi (11; 14.66%), Aspergillus section Fumigati (8; 10.66%), Aspergillus section Nidulantes (2; 2.66%), and Mucor spp. and Alternaria spp. (both 1; 1.33%). The Polymorphism of the Internal transcribed spacer region for Candida isolates was analyzed with the restriction enzyme Msp1. Accordingly, Candida parapsilosis was isolated in 50% (7) of cases, followed by C. albicans (5; 35.71%), and C. krusei (2, 14.28%).
Conclusions: Consistent with previous studies, the most eminent isolated fungi were Aspergillus section nigri and C. parapsilosis complex among filamentous and yeast fungi, respectively, the impact of subtropical climate in the geographical region of Guilan could not be neglected in the increasing trend in otomycosis prevalence. However, the species of etiological agent seems to be independent of the regional climate as C. parapsilosis was reported as the most prevalent agent in dried climates of Iran. It might be suggested that the ability of C. parapsilosis in adhesion to epithelial cells and surfaces could affect the rate of occurrence as well as recurrence in otomycosis. Species identification by appropriate laboratory diagnosis would definitely be useful for accurate and successful treatment.

P162 Increasing Incidence of Candidemia and Changing Trend towards non-albicans Candida Species: Results from a 10-Year Nationwide Study in Greece

Georgia Vrioni 1, Vassiliki Mamali 2, Maria Siopi 3, Stefanos Charpantidis 4, Vassiliki Baka 5, Stavroula Baka 6, Theodora Biniari 7, Nikoletta Charalampaki 8, Athanasios Chatzimoschou 9, Athanasia Christidou 10, Myrto Christofidou 11, Genovefa Chronopoulou 12, Ioannis Deliolanis 13, Ioannis Dendrinos 14, Maria Dimitriou 15, Maria Drogari-Apiranthitou 16, George Ganteris 17, Konstantina Gartzonika 18, Panagiota Giannopoulou 8, Eirini Glynou 4, Helen Kafkoula 5, Stefanos Karachalios 7, Stergios Karapsias 19, Paraskevi Karle 20, Anna Katsiaflaka 21, Helen Koiliari 22, Eirini Lamprou 15, Paraskevi Mantzana 23, Sofia Maraki 10, Fani Markou 24, Maria Martsoukou 25, Joseph Meletiadis 3, Chrysi Michailidou 26, Alexandra Mpakosi 20, Martha Nepka 27, Maria Orfanidou 17, Zoi-Dorothea Pana 28, Maria Panopoulou 29, Angeliki Pantazatou 13, Kalliopi Panteli 30, Virginia Papaemmanouil 15, Vassiliki Papaioannou 22, Efstathia Perivolioti 27, Evangelia Platsouka 31, Aggeliki Poulou 24, Spyros Pournaras 3, Efthalia Priavali 18, Emmanuel Roilides 28, Christina Sereti 8, Vassiliki Skandami 32, Nikoletta Skarmoutsou 25, Anna Skiada 33, Lemonia Skoura 23, Anastasia Spiliopoulou 11, Katina Themeli-Digalaki 2, Anastasios Tsakalos 17, Sofia Tsiplakou 22, Athanasia Tsiringa 32, Helen Vagdatli 26, Helen Vagiakou 17, Olga Vasilaki 23, Christina Vossou 12, Ioanna Voulgaridi 21, George Samonis 34 and Athanasios Tsakris 1
  • 1 Department of Microbiology, Medical School, National and Kapodistrian University of Athens
  • 2 Department of Microbiology, Tzaneio General Hospital
  • 3 Clinical Microbiology Laboratory, “Attikon” University General Hospital, Medical School, National and Kapodistrian University of Athens
  • 4 Department of Microbiology, “Elena Venizelou” Maternity Hospital
  • 5 Department of Microbiology, Korgialenio Benakio Hellenic Red Cross Hospital
  • 6 Department of Microbiology, “Aretaieion” University Hospital, National and Kapodistrian University of Athens
  • 7 Department of Microbiology, “Agioi Anargyroi” General Oncology Hospital
  • 8 Department of Microbiology, Thriassio General Hospital
  • 9 Laboratory of Infectious Diseases, 3rd Department of Pediatrics, Aristotle University School of Health Sciences, Hippokration General Hospital
  • 10 Department of Microbiology, University Hospital of Heraklion, Heraklion
  • 11 Department of Microbiology, University Hospital of Patras
  • 12 Department of Microbiology, Euroclinic Hospital
  • 13 Department of Microbiology, Laikon General Hospital
  • 14 Department of Microbiology, Metropolitan Hospital
  • 15 Department of Microbiology, “Metaxa” Anticancer Hospital
  • 16 4th Department of Internal Medicine, “Attikon” University General Hospital, National and Kapodistrian University of Athens
  • 17 Department of Microbiology, “G. Gennimatas” General Hospital
  • 18 Department of Microbiology, University Hospital of Ioannina
  • 19 Clinical Department of Microbiology, 251 Air Force General Hospital
  • 20 Department of Microbiology, General Hospital of Nikaia “Agios Panteleimon”
  • 21 Department of Microbiology, University Hospital of Larissa
  • 22 Department of Microbiology, KAT General Hospital
  • 23 Department of Microbiology, AHEPA University Hospital, Aristotle University of Thessaloniki
  • 24 Department of Microbiology, General Hospital of Serres
  • 25 Department of Microbiology, Sismanogleio General Hospital
  • 26 Department of Microbiology, Hippokration General Hospital
  • 27 Department of Microbiology, Evaggelismos General Hospital
  • 28 3rd Department of Paediatrics, Infectious Diseases Unit, Aristotle University School of Medicine, Hippokration General Hospital
  • 29 Laboratory of Microbiology, School of Medicine, Democritus University of Thrace
  • 30 Department of Microbiology, Asklepieion Voulas General Hospital
  • 31 Department of Microbiology, Konstantopouleio-Patission General Hospital
  • 32 Department of Microbiology, Hippokration Athens General Hospital
  • 33 1st Department of Medicine, Laiko Hospital, School of Medicine, National and Kapodistrian University of Athens
  • 34 Department of Internal Medicine, Univerity of Crete School of Medicine, Heraklion
Objectives: Geographic variations in the epidemiology of candidemia highlight the need for monitoring local trends, in order to guide appropriate empiric antifungal therapy and thus reduce mortality. Reported epidemiological data regarding the general population of Greece are scarce. Therefore, we conducted a nationwide survey to describe the epidemiologic characteristics of Candida spp. isolated from hospitalized patients with bloodstream infections during 2009–2018, with a view to evaluate epidemic trends and provide evidence for empirical treatment regimens.
Materials & Methods: All microbiologically confirmed candidemia cases in patients hospitalized in 28 centers across Greece during 2009–2018 were analysed. Ward of hospitalization at the time of the diagnosis, species identification and in vitro antifungal susceptibility profile (where available) were recorded. Identification of Candida isolates and susceptibility testing were performed as per hospital protocol. Annual incidence rates/100,000 inhabitants were calculated. Chi-square test for trend was used for evaluation of changes in species distribution.
Results: A total of 6.057 candidemic episodes/patients were analysed. In 3% of cases a mixed Candida spp. infection was diagnosed. Cases were reported in 44% from internal medicine wards, 33% intensive care units and 23% surgical wards. The overall incidence of candidemia was 5,56/100.000 inhabitants with a significant increase over the years (3.75, 5.83, and 7.01/100.000 inhabitants in 2009–2011, 2012–2014, and 2015–2018, respectively; p = 0.0002). C. parapsilosis species complex (SC) was the predominant species (41%), followed by C. albicans (37%), C. glabrata SC (10%), C. tropicalis (7%), C. krusei (1%), and other rare Candida spp. (4%). C. albicans rates decreased from 2009 to 2018 (48% to 31%) in parallel with a doubling of C. parapsilosis SC rates (28% to 49%, p < 0.0001) (Figure). The majority of pathogens was susceptible/wild-type to the antifungals tested. No resistance to amphotericin B and flucytosine was found. Fluconazole resistance was detected in 418/2101 (20%) of C. parapsilosis SC isolates (15/418 pan-azole-resistant) with no trend in resistance over time. Echinocandin resistance was found in 10/203 (5%) of C. glabrata SC isolates (7/10 pan-echinocandin-resistant) (Table).
Conclusions: This is the first multicentre nationwide candidemia study in Greece demonstrating an increasing incidence of candidemia with a shift towards non-albicans Candida spp., in particular C. parapsilosis SC, as the leading causative agent. Although antifungal resistance rates remain relatively low in the total sample, fluconazole-resistant C. parapsilosis SC raises concern.

P163 Prospective Surveillance (2005–2018) of Invasive Fusariosis in France: Species Level Identification, Mics and Association to Clinical Findings

Dea Garcia-Hermoso, Karine Sitbon, Stephane Bretagne, Francoise Dromer and The French Mycoses Study Group
Institut Pasteur, CNRS, Unité de Mycologie Moléculaire, Centre National de Référence Mycoses Invasives et Antifongiques (NRCMA), UMR2000
Objectives: Physiopathology of fusariosis is often restricted to a specific patient population preventing any correlation between fungal species and clinical presentation. Here we analyzed fusariosis cases prospectively collected over 14 years (2005–2018) with precise polyphasic identification of the isolates and taking into account the most recent nomenclature.
Methods: More than 500 cases of probable and proven fusariosis with isolates sent to the NRCMA were collected between 2005 and 2018 through the nationwide network of French university hospitals (RESSIF). Cases were classified as proven or probable ocular fusariosis (OF), or invasive fusariosis (IF) according to the EORTC/MSGERC definitions. The possible cases were excluded and onyxes were not captured. Isolates were sent to the CNRMA where they were characterized phenotypically by morphological methods and molecularly using a multi-locus sequence analysis of translation elongation factor 1-α (TEF-1α) and of RNA-dependent polymerase subunit II (Rpb2). In addition, antifungal susceptibility testing of 8 antifungal drugs was performed using EUCAST microdilution method.
Results: Multilocus sequencing was performed on 505 isolates.The most represented complex was Fusarium solani (FSSC) with more than 200 strains (40.3%) from which 60% were identified to the species level resulting in seven different species. Fusarium fujkuroi species complex (FFSC) (26.4%) was represented by eight different species with Fusarium proliferatum as the most denoted species, while the126 strains (25%) belonging to the Fusarium oxysporum species complex (FOSC) were mostly represented by Fusarium veterinarium (clade FOSC VII). We identified strains which belonged to additional species complexes such as F. incarnatum-equiseti species complex (n = 5), F. redolens species complex (n = 3), F. sporotrichoides. and F. nisikadoi with one isolate each. Finally, Fusarium dimerum species complex was represented by Fusarium (Bisifusarium) dimerum and B. delphinioides. The MIC profiles to azoles, candins and amphotericin B were similar for the Fusarium solani, oxysporum and fujikuroi complexes except for the strains of Bisifusarium dimerum and B. delphinoides which had lower MIC values to amphotericin B.
Preliminary analysis showed that, for the three main complexes, the repartition was different with less FFSC in Ocular Fusariosis than in Invasive Fusariosis and among the latter, more FFSC in immunocompromised patients. Further studies are needed to explore these differences.

P164 Shift in Mucormycosis Epidemiology in France: A Cohort Study from 2012 to 2018

Laura Gouzien 1, Dea Garcia-Hermoso 1, Karine Sitbon 1, Françoise Dromer 1, Julien Durand 2, Didier Che 2 and Fanny Lanternier 1
  • 1 Molecular Mycology Unit, Institut Pasteur, CNRS, UMR 2000, French National Reference Center for Invasive Mycoses and Antifungals
  • 2 Santé Publique France
Objectives: Mucormycosis is a rare but severe emerging fungal infection. At risk population includes immunocomprised patients, patients with diabetes mellitus, but also immunocompetents with trauma or burns. Its characteristics evolved over the last decade, as at risk population widened, guidelines for the management of immunocompromised patients were updated, and PCR-based diagnosis became available in 2015. The incidence of mucormycosis has been reported to increase in some countries, possibly in line with these changes.
Here, we aim to describe the epidemiology and outcomes of mucormycosis in France between 2012 and 2018, and to evaluate the risk factors for death.
Materials & Methods: Data included all proven, probable and putative mucormycosis cases from the RESeau de Surveillance des Infections Fongiques (RESSIF) database, recorded from 2012 to 2018 by the French National Reference Center for invasive Mycoses & Antifungals (NRCMA). RESSIF is a surveillance network including 29 French volunteer centers, which prospectively collect standardized epidemiological and mycological data regarding all unusual invasive fungal infections.
The 2020 European Organisation for Research and Treatment of Cancer/Mycoses Study Group definitions were applied for proven and probable cases. Putative cases were defined by a PCR-positive BAL or serum sample in patients presenting with clinical and radiological abnormalities compatible with the diagnosis. Risk factor for death at day 90 were analysed using logistic regression models.
Results: A total of 313 cases (145 proven, 113 probable, 55 putatives) were included. Haematological malignancies represented a majority of the main underlying diseases (194/313, 62%), followed by diabetes (8.6%), trauma and solid organ transplant (24/313, 7.7% each), and burns (21/313, 6.7%). Site of infection were mostly lungs (144/313, 46%), then rhinocerebral (58/313, 18.5%), cutanéo-articular (57/313, 18.2%) and disseminated (35/313, 11.2%). Fungal species were only available in 205 cases, with a majority of Rhizopus arrhizus (41/205, 20%), followed by Lichtheimia corymbifera (30/205, 14.6%), Lichtheimia ramosa (28/205, 13.6%), Mucor circinelloides and Rhizomucor pusillus (27/205, 10.2% each) and Rhizopus microsporus (21/205, 10.2%). PCR was positive in samples from 172 patients (55%).
Mortality at day 90 was 59%, with a median survival time of 39 days. The risk of death was increased by age (OR = 1.02 [1.00–1.03] per year), haematological malignancies (OR 2.74 [1.70–4.47]), diagnosis in intensive care unit (ICU) (OR 2.92 [1.73–5.08]), and diagnosis before 2015 (OR 1.88 [1.13–3.18]), but reduced in cutaneo-articular compared to disseminated (OR 0.17 [0.06–0.43]) infection in univariate analysis. All results remained statistically significant in multivariate analysis. In a sensitivity analysis with a landmark of one day on 259 cases, surgery reduced mortality in univariate (OR 0.23 [0.12–0.41], p < 0.0001) and multivariate.
Conclusions: We showed an increase in mortality compared to prior studies in France, despite the improvements made in diagnosis and treatment. It can be linked to the increased proportion of haematological malignancies as main underlying diseases, confirming a shift in at risk population over the last decade. Mucormycosis remains highly lethal, with a prognosis worsened by age, haematological malignancies and diagnosis while in ICU, but improved by surgery, and maybe early detection by PCR.

P165 The Impact of the COVID-19 Pandemic on the Consumption of Antifungals in a Tertiary Greek Hospital

Antonios Markogiannakis 1, Athanasios Kakasis 2, Nikolaos Pantazis 3, Nikolaos Sipsas 2 and Maria Gamaletsou 2
  • 1 Pharmacy Department, “Laiko” Athens General Hospital
  • 2 Pathophysiology Department, Medical School, National and Kapodistrian University of Athens
  • 3 Department of Hygiene, Epidemiology and Medical Statistics, Medical School, National and Kapodistrian University of Athens
Objectives: Our purpose was to determine the impact of COVID-19 pandemic on the consumption of in-hospital intravenous antifungal agents (IHIVAFs) in the tertiary hospital of Athens “Laiko”.
Methods and Materials: The monthly consumption data of IHIVAFs, expressed in DDDs/100 occupied bed days (OBD) were calculated for all eight IHIVAFs used during the first year of pandemic (March 2020 to February 2021, COVID-19 period-CP), in comparison to the corresponding preceding one-year period (March 2019 to February 2020, pre COVID-19 period-PCP) using an open-source software (AMC Tool, vers.1.9.0). Additional indices such as the total number of OBD, and the total number of patients, for all the clinics and separately for the five clinics with special populations such as hematologic or renal transplant patients (3 internal medicine departments, 1 hematologic department and 1 renal transplant unit) which usually demonstrate a high consumption of IHIVAFs, were also taken into account. Statistical analysis was performed using time-series analysis models. The differences in average IHIVAFs usage between the two periods were assessed through regression with Newey-West standard errors allowing for autocorrelated and heteroscedastic errors. All analyses were performed using Stata version 15.1 (Stata Corp., College Station, TX, USA). P-values less than 0.05 were considered as indicating statistical significance.
Results: A statistically significant reduction in IHIVAFs consumption was observed in five of eight agents and in particular for Liposomal Amphotericin B (L-AB) (p = 0.032), fluconazole (p = 0.048), voriconazole (p = 0.01), caspofungin (p < 0.001) and mycafungin (p = 0.003). These significant decreases were more evident in months with exaggerated COVID-19 outbreaks e.g., during March–April 2020 or January–February 2021 (Figure 1). Considerably, only for isavuconazole, a statistically significant increase in consumption was noticed during the CP (p = 0.02), possibly because of its use in COVID-19 patients. Overall there was a 16.3% reduction in the use of IHIVAFs during the CP and it was considered statistically very significant (p < 0.001; Figure 2). The total number of patient days and the total number of patients admitted to all clinics was slightly reduced between the two periods (157.627 vs. 142.318, 9.7% decrease and 26.356 vs. 22.129, 16% decrease), while it was more evident for the five clinics with special patient populations: 42.234 vs. 34.562 (18.2% decrease) regarding to the patient days and 8.984 vs. 7.086 (21.1% decrease) regarding to the number of patients.
Conclusions: The COVID-19 pandemic seems to have a considerable impact regarding to the consumption of IHIVAFs in our hospital, particularly for the most of those agents that are been used for empirical or pre-emptive treatment of invasive fungal infections. The reduction in the consumption of these agents was more apparent in the periods with the higher incidence of COVID-19 cases. These findings could be due to the reduced number of hospitalized patients and especially due to the low number of admissions in the hematologic and renal transplant units. This fact is highlighted by the decrease-during the pandemic period—in the total number of OBD and in the number of admitted patients, especially to those clinics with sensitive patient populations with a high consumption of IHIVAFs.

P166 Blastomycosis—Risk Factors for Severe Disease and Mortality

Timothy O’Dowd, Jack McHugh, Mark Enzler and Paschalis Vergidis
Mayo Clinic
Objectives: Blastomyces dermatitidis and the more recently described Blastomyces gilchristii are thermally dimorphic fungi. An increase in the incidence of blastomycosis has been reported in recent years possibly related to environmental changes. We sought to examine risk factors for severe disease and mortality.
Methods: We performed a retrospective review study of patients diagnosed with blastomycosis from 1 January 2004 through 31 March 2020. Disease was defined in patients with clinical and/or radiographic evidence of infection and one or more of the following: (i) Isolation of Blastomyces in culture of respiratory, skin or sterile specimens, (ii) histopathologic or cytopathologic evidence of yeast consistent with Blastomyces, (iii) positive serology, (iv) positive urine or serum Blastomyces antigen, or (v) Blastomyces PCR.
Logistic regression was used to evaluate risk factors for severe disease. A Cox proportional hazards model was constructed to assess mortality. Variables with p-values < 0.20 were included in the multivariate model. Statistical analysis was performed using STATA.
Results: We identified 210 patients during the study period. Mean age was 51 years (range, 6–84). Most were male (71%). The diagnosis was confirmed by culture of respiratory specimens in 62%. Skin/soft tissue involvement was confirmed by culture in 11%. The most common radiographic finding was presence of pulmonary nodule or lung mass. In terms of antifungal therapy, 38.9% (81/208) of patients received induction treatment with a formulation of amphotericin B. Itraconazole and voriconazole were the most commonly used azoles.
In this cohort, 40.5% of patients were treated as outpatients (mild disease), 37.6% were admitted to the hospital but not in the ICU (moderate disease), and 21.9% required ICU admission (severe disease). 14.8% patients required mechanical ventilation and 1.4% required extracorporeal membrane oxygenation support. Older age, chronic obstructive pulmonary disease, diabetes mellitus, obesity (BMI ≥ 30), extrapulmonary disease and immunosuppressive therapy were not associated with severe disease. Independent risk factors for severe disease were lymphopenia (≤1.0 × 109/L) and neutrophilia (≥7.5 × 109/L) at the time of diagnosis.
All-cause 90-day mortality was 11.9%. Median time from diagnosis to death was 23 days (interquartile range, 8–31 days). The main cause of death was multiorgan failure. Independent risk factors for mortality were older age, neutrophilia, and lymphopenia, as shown in the Table. 90-day survival by age and lymphocyte count are shown in the Figures.
Conclusions: In previous studies, immunosuppression was associated with severe disease and increased mortality, a finding that was not confirmed in our cohort. As blastomycosis is a rare condition limited to certain geographic areas, it is difficult to make definitive conclusions on the impact of immunosuppression on disease outcomes. Unlike other endemic mycoses, blastomycosis may cause severe disease with respiratory failure in previously healthy individuals.

P167 Molecular Reidentification of Candida guilliermondii and Candida famata Clinical Isolates from a Culture Collection

Elena Palencia-Mulero, Aitor Jauregi-Urrutia, Estibaliz Mateo, Cristina Marcos-Arias, Esther Tamayo, Katherine Miranda-Cadena, Elena Eraso and Guilliermo Quindós
Department of Inmunology, Microbiology and Parasitology, Faculty of Medicine and Nursery, University of the Basque Country (UPV/EHU)
Introduction and Objective: Candidiasis caused by Candida guilliermondii complex are of clinical interest given conventional phenotypic diagnostic methods may misidentify these species. Therefore, their prevalence may have been underestimated. The aim of the study was to reidentify clinical isolates from a culture collection that were previously identified as C. guilliermondii and Candida famata by conventional phenotypic methods.
Materials & Methods: The study included 84 clinical isolates from individual patients collected between 1993 and 2018 and stored in the yeast stock collection of the Medical Mycology Laboratory at the University of the Basque Country (UPV/EHU). These isolates were originally identified by Chromagar Candida (Becton-Dickinson, Franklin Lakes, NJ, USA) or Candida Chromogenic Agar (Condalab, Madrid, Spain), and by API ID 32C or API 20C AUX (bioMérieux, Craponne, France) identification systems. All isolates were reidentified by sequencing of the ITS ribosomal DNA, and in some of them (n = 41) ACT1 gene sequencing was performed. Sequences were assembled manually and subjected to BLAST analysis to find similarities to sequences deposited at GenBank and Mycobank databases.
Results: Isolates were phenotypically identified as C. guilliermondii (n = 55) or C. famata (n = 2), while for the remaining 27 isolates it was not possible to determine the species.
By sequencing of ITS region, 83 isolates were classified into the C. guilliermondii species complex (78 as C. guilliermondii, four as C. fermentati, and one isolate as Candida neustonensis) and the remaining one was included into the Candida famata complex. All the sequences showed a homology ranging from 98 to 100% comparing with the sequences from BLAST databases, except five sequences of C. guilliermondii that yield lower homologies ranging from 92 to 97%. ACT1 gene sequencing confirmed the analysis of ITS region, the 41 isolates analyzed were classified as C. guilliermondii (n = 40), and C. fermentati (n = 1) with a homology ranging from 98 to 100%, except three sequences of C. guilliermondii that yield lower homologies but not lesser than 97%.
The four C. fermentati isolates, phenotipically identified as C. guilliermondii, were isolated from superficial candidiasis (n = 3) and from a bronchoaspirate (n = 1). C. neustonensis, also phenotipically identified as C. guilliermondii, was isolated from an infant’s oral cavity and, to date, this is the first isolation described in humans. Among the two isolates phenotipically identified as C. famata, one was molecularly identified as C. guilliermondii and the other one was classified within the C. famata complex, but the species could not be determined due to the very low interspecies variation between Debaryomyces fabryi and Debaryomyces prosopidis.
Conclusions: The use of molecular methods improved the conventional identification of C. guilliermondii, but the low interspecies variation requires the analysis of more loci in addition to the ITS region for the discrimination between species within the complexes. Molecular identification allowed us to report, to our knowledge, the first isolation of C. neustonensis from a person.
Funding: GIC15/78 IT-990-16 (Gobierno Vasco-Eusko Jaurlaritza).

P168 COVID-19 Associated Pulmonary Aspergillosis (CAPA): Hospital or Home Environment as a Source of Life-Threatening Aspergillus fumigatus Infection?

Irene Gonzalez-Jimenez 3, Alejandra Roldan 3, Andrea Garcia-Fernandez 1, Lorena Forcelledo 1,2, Jose Luis Carretero 1, Belen Rivaya 1, Blanca Leoz-Gordillo 1, Rodrigo Albillos 1, Mar Martinez-Suarez 1,2, Fernando Vazquez 1,2, Santiago Melon 1,2, Maria Luisa Sanchez 1, Emilia Mellado 3 and Teresa Pelaez 1,2
  • 1 Hospital Universitario Central de Asturias (Servicio de Microbiología, Servicio de Medicina Intensiva, Servicio de Medicina Preventiva)
  • 2 Fundación para la Investigación Biosanitaria del Principado de Asturias (FINBA)
  • 3 Instituto de Salud Carlos III
Objectives: Most cases of invasive aspergillosis are caused by Aspergillus fumigatus, whose conidia are ubiquitous in the environment. Additionally, in indoor environments, such as houses or hospitals, conidia are frequently acknowledged too. Hospital-acquired aspergillosis is usually associated with airborne fungal contamination of the hospital air, especially after building construction events. A. fumigatus strain typing can fulfill many needs both in clinical settings and otherwise. The high incidence of aspergillosis in COVID patients from our hospital, made us wonder if they were hospital-acquired aspergillosis. The purpose of this study was to evaluate whether the hospital environment was the source of aspergillosis infection in CAPA patients, admitted to the Hospital Universitario Central de Asturias, during the first and second wave of the COVID-19 pandemic, or whether it was community-acquired aspergillosis prior to admission.
Materials & Methods: During 2020, sixty-nine A. fumigatus strains were collected for this study: 59 were clinical isolates from 46 COVID-19 patients and 10 strains were environmentally isolated from 8 hospital rooms and intensive care units. A diagnosis of pulmonary aspergillosis was based on: positive culture, galactomannan antigen (index 5–10 in respiratory samples), positive PCR in respiratory samples (CT < 36), positive LFD in respiratory samples, and/or β-D-glucan on blood, and clinical suspicion with presence of bilateral pneumonia compatible with aspergillosis on chest computed tomography image and/or X-ray images. Strains were genotyped by PCR amplification and sequencing of a panel of four hypervariable tandem repeats within exons of surface protein coding genes (TRESPERG) (Simpson index (D) = 0.9972). For each strain a type was obtained according to the composition and number of repeats for each gene and a final genotype for each strain was assigned combining the types obtained with the four genes.
Results: A total of seven genotypes among the 10 environmental strains and 32 genotypes among the 59 clinical strains were identified. Genotyping revealed that one A. fumigatus strain from UCI 5 (box 54) (1 cfu/m3) isolated in October (30 October 2020) and one A. fumigatus isolated from a COVID-19 patient admitted in Pneumology (Room 532-B) in November (24 November 2020) had the same genotype. Only two patients, one from March (30 March 2020) in the Cardiac ICU (Box 10) and another from November (13 November 2020) in the general ICU (Box-91) shared the same genotype. There was no coincidence in time or space between the two matched genotypes between patients, nor between hospital air and patients.
Conclusions: To our knowledge, this is the first study monitoring and genotyping A. fumigatus isolates from hospital air and COVID-19 patients admitted with aspergillosis obtained during one year. A. fumigatus strains showed a wide diversity of genotypes. Our work shows that patients did not acquire A. fumigatus in the hospital. This proves that COVID-associated aspergillosis in our hospital is not a nosocomial infection, but supports the hypothesis of “community aspergillosis” acquisition outside the hospital, having the home environment (pandemic period at home) as the main suspected focus of infection.

P169 Invasive Aspergillosis Co-Infection Associated with SARS-CoV-2: Experience in a Tertiary University Hospital during a Pandemic Year

Lorena Forcelledo 1,2, Blanca Leoz-Gordillo 1, Rodrigo Albillos 1, Irene Gonzalez 3, Alejandra Roldan 3, Guillermo Albacieta 1,2, Santiago Melon 1,2, Fernando Vazquez 1,2, Maria Luisa Sanchez 1,2, Emilia Mellado 3 and Teresa Pelaez 1,2
  • 1 Hospital Universitario Central de Asturias (Servicio de Microbiología, Servicio de Medicina Intensiva, Servicio de Medicina Preventiva)
  • 2 Fundación para la Investigación Biosanitaria del Principado de Asturias (FINBA)
  • 3 Instituto de Salud Carlos III
Objectives: Coronavirus disease-19 (COVID-19) has emerged as an important disease that predisposes patients to pulmonary aspergillosis (CAPA). Diagnosis of CAPA remains challenging and the incidence of CAPA varies between hospitals and between countries. Our study describes the incidence of CAPA among patients admitted at intensive care units (ICU) in a tertiary university hospital (1000-bed) in Spain, during the 2020 pandemic year.
Materials & Methods: A study was conducted among 300 patients tested for COVID-19 infection who were admitted to the hospital at ICU during the first and second waves (March–May 2020 and October–December 2020). COVID-19 diagnosis was performed by in-house quantitative PCR expressed in copies/103 cells. The laboratory was proactive (high mycological suspicion) and all respiratory samples from patients admitted to the ICU were processed. A diagnosis of pulmonary aspergillosis was based on ECCM/ISHAM criteria: positive culture, galactomannan antigen, PCR (CT < 36), and LFD in respiratory samples, β-D-glucan on blood, and clinical suspicion with presence of bilateral pneumonia compatible with aspergillosis on chest computed tomography and/or X-ray image. Clinical and laboratory data were collected from 35 patients, antifungal and viral therapies; underlying conditions; use of steroids and immunosuppressive drugs; hospitalization days and outcome.
Results: During the first wave, the incidence of patients with CAPA was 17.7% (11 pts) with a mortality of 10%. The Aspergillus species involved were as follows: A. fumigatus 60%, A. terreus 30%, and 10% of mixed infections (A. fumigatus + A. nidulans). During the second wave, the incidence of patients with CAPA was 10.1% (24 pts), with a mortality of 37.5%. The Aspergillus species involved were as follows: A. fumigatus 50%, A. niger 13%, A. terreus 8% and 25% of mixed infections with more than one Aspergillus species (17% A. fumigatus + A. terreus, 4% A. fumigatus + A. niger, 4% A. fumigatus + A. terreus + A. niger) and no growth in 4% of patients. Regarding the diagnostic tools, mycological culture, PCR, LFD and β-D-glucan (100%), and GM in respiratory specimen (87.5%) had high specificity and sensitivity. On the other hand, the sensitivity of GM in serum was only 16.7%. All A. fumigatus were azole susceptible. Two A. terreus and one A. niger showed azole resistance. The fact that all the patients in the first wave had Aspergillus positive PCR in the same sample as the COVID-19 diagnosis supports the co-infection of Sars-CoV-2 and Aspergillus since the first day of hospital admission.
Conclusions: In our hospital, there was a high incidence of patients with COVID-19 co-infection and aspergillosis, not only among immunocompromised patients but also immunocompetent patients. A large percentage of patients had a poor outcome even when antifungal therapies were administrated. We emphasize the importance to perform mycological screening to all patients entering the ICU with COVID-19. Finally, it is important to detect IA co-infection caused by different Aspergillus species, with different susceptibility profiles that can complicate antifungal therapy and clinical outcome.

P170 Epidemiology of Mucormycosis in Greece; Results from a 15-Year Nationwide Survey

Maria Drogari-Apiranthitou 1, Anna Skiada 2, Ioannis Pavleas 3, Elias Iosifidis 4, Myrto Christofidou 5, Emmanuel Roilides 4, George Petrikkos 6,7
  • 1 Infectious Diseases Research Laboratory, 4th Department of Internal Medicine, National and Kapodistrian University of Athens, Attikon General Hospital
  • 2 1st Department of Internal Medicine, National and Kapodistrian University of Athens, Laiko General Hospital
  • 3 Intensive Care Unit, Laiko General Hospital
  • 4 3rd Department of Paediatrics, Aristotelion University of Thessaloniki
  • 5 Department of Microbiology, University Hospital of Rion, Patras
  • 6 National and Kapodistrian University of Athens
  • 7 European University Cyprus
Objectives: Mucormycosis has emerged as an important infection in the past two decades, affecting mainly immunocompromised patients. The aim of the study was to analyse the epidemiological parameters of this potentially devastating infection, in a multicentric, nationwide survey in Greece.
Materials & Methods: The survey started in 2005 and is ongoing. Each case was recorded in a Case Report Form and sent to our departments together with the fungus, or the paraffin (FFPE) embedded tissue block whenever cultures were negative or not available. From 2008 onwards, the cases were submitted electronically, at www.zygomyco.net, which is the site of the ECMM/ISHAM Working Group on Zygomycosis. The collected data included demographic, clinical characteristics of the patients, risk factors, time and type of laboratory diagnosis, treatment, and outcome. Only proven and probable infections according to EORTC/MSG criteria were analysed. Laboratory diagnosis was based on histopathology, microbiology, and molecular methods. The incidence was calculated in the general population, based on the latest census (2011).
Results: There were 88 cases registered from January 2006 to December 2020. Male to female ratio was 1.3:1, with a median age of 57 years. The underlying diseases were haematologic malignancies/neutropenia and haematopoietic stem cell transplantation (HSCT) (37.5%), diabetes mellitus (18.2%), other immunodeficiencies (13.6%) (including autoimmune diseases/high dose corticosteroids, solid tumours, chronic renal failure, and solid organ transplantation), whereas 24% were cutaneous/soft tissue infections occurring in immunocompetent individuals after major trauma, burns, or surgery. Of the cutaneous infections 28.6% were healthcare-associated and two occurred after natural disasters. The most frequent form of infection was the rhino-cerebral (49%), followed by the cutaneous (31.8%), pulmonary (12.5%) and disseminated (6%). Almost all immunocompetent patients had the cutaneous form. Rhizopus (66%, mostly R. arrhizus) was the predominant genus followed by Lichtheimia (11.2%) and Mucor (4.2%). Other Mucorales were Saksenaea vasiformis (2 cases), Apophysomyces elegans and Syncephalastrum racemosum (1 case each) and 12.7% were unspecified Mucorales. Culture was negative in 8% of the cases. Histopathology was obtained from all cases. Treatment was multimodal, including antifungals (liposomal amphotericin B, posaconazole and isavuconazole); surgery in cases where this was possible, and reversal of underlying risk factors. Crude mortality rate was high (51%) and ranged between 30% (diabetics) to 64% (haematological patients). The incidence rate appears to be stable and the estimate is 6 cases/year or 0.05/100,000 population.
Conclusions: Our results show that mucormycosis in Greece follows the epidemiology of other European countries and has a stable rate. Increased knowledge and awareness may help preventing many cases especially in the immunocompetent and increase survival.
Note: The study was part of the ECMM/ISHAM Working Group of Zygomycosis registry (www.zygomyco.net)

P171: Canine Dermatophytoses and Associated Risk Factors among Dogs in Osun and Kwara States, Nigeria

Yemisi Adesiji 1, Daniel Oluwayelu 2 and Julius Aiyedun 3
  • 1 Department of Medical Microbiology and Parasitology
  • 2 Department of Veterinary Microbiology, University of Ibadan
  • 3 Department of Veterinary Public Health and Preventive Medicine, University of Ilorin
Objectives: This study was designed to investigate the occurrence and associated risk factors of dermatophytoses in dogs with dermatophytic skin lesions presented at Veterinary Clinics in Osun and Kwara States, Nigeria.
Materials & Methods: This prospective, cross-sectional study was carried out in Osogbo, Osun State and Ilorin, Kwara State in southwestern and north-central Nigeria, respectively. A total of 325 dogs with lesions suggestive of dermatophytosis were examined between July and November 2019. Plucked hairs and skin scrapings were emulsified in 10% potassium hydroxide and examined microscopically for fungal elements. All the samples were also cultured using standard mycological procedures. A structured questionnaire was administered to obtain information on the dogs’ demographic characteristics and possible risk factors for dermatophytosis from the animal owners and clinicians. The level of association between variables and occurrence of dermatophytoses was determined using Chi-square test and p-values ≤ 0.05 were considered significant.
Results: Our findings revealed that of the 325 dogs examined, 35 (10.8%) samples were positive for fungal elements by direct microscopy while 14.8% (48/325) yielded cultures positive for dermatophytes. Out of the 48 positive cultures obtained, 37.5% (n = 18) were identified as M. canis, 27.1% (n = 13) as M. gypseum and 8.3% (n = 4) as T. mentagrophytes. Others included Aspergillus flavus 12.5% (n = 6), and Malassezia canis 12.5% (n = 6). The age distribution of positive cases were <1 year (n = 24, 50.0%), 1–3 years (n = 14, 29.2%) and >3 years (n = 10, 20.8%). Risk factors associated with dermatophytosis included the dog breed (p = 0.006), sex (p = 0.023), history of dermatophytosis (p = 0.001), housing type (p = 0.001), sanitation (p = 0.003), and grooming (p = 0.012).
Conclusions: This study established the occurrence of dermatophytosis in dogs kept for companionship (i.e., pets), security and breeding purposes, and presented at veterinary clinics in two States located in two different geographical regions of Nigeria. Our findings underscore the need for routine mycological investigations in these dogs to facilitate early detection of cases and prompt institution of treatment interventions, thereby preventing zoonotic transmission of dermatophytes to their owners, handlers and veterinarians.

P172 Epidemiological, Diagnosis and Management of Cryptococcosis Cases in Fann Teaching Hospital from 2005 to 2017 in Senegal

Doudou Sow 1,3, Carole Pab Minlekib 2, Isaac A Manga 2, Mamadou Dia 3, Souleye Lelo 2,3, Cheikh Binetou Fall 2, Khadime Sylla 2,3, Magatte Ndiaye 2, Roger CK Tine 2,3, Babacar Faye 2, Thérèse Dieng 2,3
  • 1 Université Gaston Berger
  • 2 Université Cheikh Anta Diop
  • 3 Centre Hospitalier National Universitaire de Fann
Background: Cryptococcal Meningitis is one of the most important opportunistic infection and a major contributor to early mortality. In sub-Saharan Africa, particularly in Senegal, prevalence of Cryptococcal Meningitis remains high. This study aimed to describe the epidemiology, laboratory profile, therapeutic and outcome of cases diagnosed in Dakar.
Methods: We have analyzed the cryptococcosis cases diagnosed at the department of parasitology-mycology in Fann Teaching Hospital in Dakar from 2005 to 2017. The diagnosis was confirmed by culture on Sabouraud’s dextrose agar and/or by India ink preparation and/or by cryptococcal antigen detection. The diagnosis methods were assessed by using culture as reference. During a period of 6 months in 2017, the accuracy and the reliability of the Dynamiker Cryptococcal Antigen Lateral Flow Assay (LFA), a new antigen kit was assessed compared to the latex agglutination used in routine activities.
Results: Out of the 2425 patients screened, a total of 194 cases of Cryptococcal Meningitis were diagnosed. The prevalence of Cryptococcal Meningitis was 8%. The most infected patients were aged between 31–45 years old (42.2%). There were slightly more male (53.4%) than female (46.6%) patients; 92.3% of the patients were found to be infected with HIV. India ink staining was positive in 32 patients (16.4%) while the culture of the fungus in the cerebrospinal fluid was positive in 52 patients (26.8%). 120 patients (61.8%) were diagnosed using the cryptococcal antigen detection in cerebrospinal fluid. The performance of the Dynamiker Lateral Flow Assay yielded a sensitivity at 100%, a specificity at 75% and a Youden at 75 when it was compared to the Latex agglutination. The most frequently used antifungal drug was fluconazole (86.7%), and the mortality rate was 64%.
Conclusions: Early diagnosis is essential to control cryptococcosis, and countries should prioritize widespread and reliable access to rapid diagnostic cryptococcus antigen assays. But it is important to make available the antifungal drugs including the Amphotericin B and the Flucytosine to reduce the mortality rate.
Keywords: cryptococcal meningitis; epidemiology; laboratory profile; therapeutic outcome

P173 A Cross-Sectional Study of Epidemiological Aspects of Mucormycosis in Educational Hospitals Affiliated to Shiraz University of Medical Sciences, Iran

Marjan Motamedi
Department of Medical Mycology & Parasitology, School of Medicine, Shiraz University of Medical Sciences
Objectives: Invasive diseases caused by the Mucorales fungi occur amongst patients with immunodeficiency and other predisposing factors. The clinical signs of Mucormycosis are reflections of infarction and necrosis of the host tissue, which is due to hypha attack on the arteries and pose a high mortality rate despite medical advances. Due to the differences in the epidemiological aspects of Mucormycosis, we sought to assess the epidemiological and clinical characteristics of patients suffering from Mucormycosis infection admitted to educational hospitals affiliated to Shiraz University of Medical Sciences, Shiraz, Iran.
Materials and Methods: Our goal population in this cross-sectional study were all patients suffering from Mucormycosis infection admitted to main referral centers for infectious diseases in Fars province (including Namazi, Shahid Faghihi, Khalili and Amir), during 1392 to 1399. Demographic, clinical and diagnostic data was obtained by reviewing and entering in a semi-structured data collection form from medical records.
Results: After de-duplication, a total of 164 patients (55.5 percent male, 44.5 percent female) with a mean age of 41.66 ± 22.91 years were included in the study. The highest number of hospitalizations was observed in autumn (31.7 percent) and the lowest in spring (15.9 percent). The most common type of invasion was rhino-cerebral with 74.4 percent abundance. The highest frequency of risk factors belonged to hematological malignancies and neutropenia (37.8 percent), followed by diabetes mellitus (37.3 percent). The mortality rate was 14.6 percent. There was a significant relationship between the risk factor and the location of infection (p-value < 0.001), and also a significant relationship between the administered therapy and the prognosis (p-value < 0.02).
Conclusions: Due to the high frequency of patients with hematologic malignancy, control measures and improvement of environmental and staff sanitary conditions in hematology departments should be considered to reduce the risk of mucormycosis infection. Moreover, treating neutropenia is warranted. In addition, control of diabetic ketoacidosis in diabetic patients should be on the agenda.

P174 Genetic Variation and Population Structure Analysis of Microsporum Canis Using Microsatellite and Multilocus Typing

Chioma Aneke 1,2, Adela Cmokova 3,4, Vit Hubka 3,4, Wafa Rhimi 1, Domenico Otranto 1,5 and Claudia Cafarchia 1
  • 1 University of Bari
  • 2 Department of Veterinary Pathology and Microbiology, University of Nigeria
  • 3 Department of Botany, Faculty of Science, Charles University
  • 4 Laboratory of Fungal Genetics and Metabolism, Institute of Microbiology of the Czech Academy of Sciences
  • 5 Faculty of Veterinary Sciences, Bu-Ali Sina University
Objectives: Molecular epidemiological studies on Microsporum canis are still rare because of lack of sufficiently variable DNA sequences and polymorphic markers. In this study, we were searching for variable DNA sequence and microsatellite markers.
Methods: A total of 65 M. canis strains isolated from humans, animals with and without lesions were selected subtyping by multilocus sequence typing (MLST) and multilocus microsatellite typing (MLMT). Firstly, we used a limited set of strains for screening of variability among 12 housekeeping genes and among available and newly detected microsatellite loci.
Results: We observed no intraspecific variability among 10 out of 12 housekeeping genes, and only ITS and IGS regions showed two and three sequence genotypes, respectively. However, one from these 12 loci were useful for differentiation between M. canis, M. audoinii and M. ferrugineum.
Eighteen microsatellite genotypes (A-R) were recognized using multilocus microsatellite typing (MLMT) based on 8 loci, allowing a subdivision of the strains into two populations following of Bayesian statistical approach. Genotype C was isolated from dogs, cats, man, whereas other genotypes were host specific.
Conclusions: The present study suggests that MLST is not useful for typing M. canis but ITS and IGS regions might be used to detect limited genetic variability. However, microsatellite-analysis is a powerful tool for subtyping and can be used for surveillance studies and for gaining insight into the epidemiology of infections due to M. canis.

P175 Pneumocystis Jirovecii Pneumonia in Fann Teaching Hospital from 2009 to 2017 in Senegal

Doudou Sow 1,3, Carole Pab Minlekib 2, Isaac A Manga 2, Mamadou Dia 3, Souleye Lelo 2, Cheikh Binetou Fall 2, Khadime Sylla 2,3, Magatte Ndiaye 2, Roger CK Tine 2,3, Babacar Faye 2 and Thérèse Dieng 2,3
  • 1 Université Gaston Berger
  • 2 Université Cheikh Anta Diop
  • 3 Centre Hospitalier National Universitaire de Fann
Background: Pneumocystis pneumonia (PcP) is caused by Pneumocystis jirovecii, an ascomycetous fungus that causes opportunistic pulmonary infections in immunocompromised patients such as human immunodeficiency virus (HIV) infection, haematological/solid malignancies, transplant recipients and receiving chronic immunosuppressive medications. In Sub-saharan Africa, data is lacking due to the low sensitivity of diagnostic tools in many countries. The objective of this study is to describe the frequency of pneumocystis pneumonia cases in Fann Teaching Hospital in Dakar.
Materials and methods: A descriptive longitudinal study was carried out from January 2009 to December 2017, in Fann Teaching Hospital in Dakar. The bronchoalveolar lavages received in the laboratory were examined microscopically for Pneumocystis jirovecii using indirect fluorescent assay and Giemsa staining.
Results: Out of the 477 patients screened for Pneumocystis jirovecii, 28 were positive yielding a frequency at 5.8%. Fourteen patients of the 28 infected (50%) were aged between 31 and 60 years old. There was more male (60.7%) than female (39.3%). The high number of diagnosed cases was found in 2011 (42.8%), in 2009 (21.4%) and in 2015 (17.8%). Seven patients (25%) were HIV positive. All the 28 patients were diagnosed using the indirect fluorescent assay.
Conclusions: Pneumocystis pneumonia remains a severe invasive fungal infection in immunocompromised patients. So, there is a need to improve diagnostic level including molecular testing for a better management of cases.
Keywords: pneumocystis pneumonia; bronchoalveolar lavage; indirect fluorescent assay; Giemsa

P176 Isolation of Rasamsonia argillacea Species Complex in a Cystic Fibrosis Adult Patient—First Case in Portugal

Dinah Carvalho 1, Raquel Sabino 2,4, Cristina Veríssimo 2, Helena Simões 2, Pilar Azevedo 3, Luis Marques Lito 1 and José Melo Cristino 1
  • 1 Centro Hospitalar Universitário Lisboa Norte
  • 2 National Health Institute Dr. Ricardo Jorge, Reference Unit for Parasitic and Fungal Infections—Infectious Diseases Department
  • 3 Centro Hospitalar Universitário Lisboa Norte—Cystic Fibrosis Reference Center
  • 4 Instituto de Saúde Ambiental, Faculdade de Medicina, Universidade de Lisboa
Objectives: Cystic fibrosis (CF) is the most common monogenetic autosomal recessive disease in the human population. An important fungal biota has been described in respiratory secretions of patients suffering from CF being Aspergillus fumigatus and Candida albicans the most common fungi found. We report the isolation, for the first time in Portugal, of the emerging fungal pathogen Rasamsonia argillacea species complex, from a respiratory sample of an adult patient with CF.
Material & Methods: A 51-year-old male patient with heterozygous CF due to mutations ΔF508/P205S, is being followed in Cystic Fibrosis Reference Center for about 10 years. In the last years, he has been consistently colonized with Methicilin-susceptible Staphylococcus aureus, Pseudomonas aeruginosa and Aspergillus section Fumigati whereby is under chronic suppression therapy with two inhaled antibiotics. Recently, there has been a progressive clinical respiratory functional deterioration. In a periodic evaluation, a microbiology control sputum was requested. Sample was cultured, in parallel, for bacteriology and mycology evaluation.
Results: Apart from detection of S. aureus and Raoultella ornithinolytica, after 3–5 days of incubation at 37 °C, the cultures showed several cream-coloured colonies, powdery to velvety. Microscopic examination showed hyaline septate hyphae, Penicillium-like conidiophores with rough wall, ovoid to cylindrical phyalides with a narrow neck and cylindrical unicellular smooth-walled microconidia, arranged in unbranched basipetal chains arising from phialides.
The isolate was identified as Rasamsonia argillacea species complex based on its morphology and confirmed by MALDI-TOF mass spectrometry. As no septate hyphae were seen on direct examination, a new sample was requested to exclude extrinsic contamination. The second sample was inoculated as previously, confirming the persistent presence of Rasamsonia argillacea species complex in the sputum of this patient. The identification of this isolate was further confirmed by sequencing the internal transcribed spacer (ITS) region of ribosomal DNA, showing 100% homology with sequences deposited on databases. Antifungal susceptibility testing showed high minimal inhibitory concentrations (MIC) to almost all tested antifungals (posaconazole, voriconazole, amphotericin B) and low MIC to anidulafungin. The patient had no great exacerbation of his respiratory problems and the isolated fungus was interpreted as colonization being the patient under more frequent surveillance.
Conclusions: Although colonization of the upper respiratory tract in CF patients by R. argillacea species complex has been described as an emerging situation, the role of these fungi in clinical or functional deterioration of the disease remains controversial. Indeed, data about its real prevalence in the CF population are lacking. However, taking into account the ability of this species to predominantly affect the lungs, to induce pneumonia and to disseminate to adjacent organs or even to the central nervous system (CNS) in immunocompromised patients, it is essential to promote its accurate identification that is often misidentified as Penicillium spp. or Paecilomyces species. Antifungal susceptibility testing should be performed for epidemiological purposes and to guide therapy, as Rasamsonia spp. usually presents a marked antifungal resistance profile.

P177 Epidemiology of Invasive Candidiasis in Hematological (Hem) and Non-Hematological (Non-Hem) Patients: Results of Prospective Multicenter Study in Russia

Galina Klyasova 1, Anna Malchikova 1, Irina Molchanova 2, Olga Kutsevalova 3, Mihail Maschan 4, Antonina Vetokhina 5, Tatiyana Chernenkaya 6, Natalia Zvyozdkina 7, Oksana Khoreva 8, Larisa Krainova 9 and Svetlana Shushurina 10
  • 1 National Research Center For Hematology
  • 2 Chelyabinsk Regional Clinical Hospital
  • 3 Rostov Research Institute of Oncology
  • 4 Dmitry Rogachev National Medical Research Center Of Pediatric Hematology, Oncology and Immunology
  • 5 Irkutsk Regional Clinical Hospital
  • 6 Sklifosovsky Moscow City Research Institute of Emergency Medicine
  • 7 Regional Clinical Hospital
  • 8 Surgut District Clinical Hospital
  • 9 Novosibirsk Regional Clinical Hospital
  • 10 Samara Regional Clinical Hospital named after V.D. Seredavin
Background: The aim of the study was to evaluate the etiology of invasive candidiasis in hem and non-hem patients (pts).
Materials/methods: The prospective multicenter study was performed in the period from 2005 to 2019 in 10 centers and 8 cities in Russia. Candida spp. isolates were collected from hem pts and non-hem pts (81.3% non-hem pts were in ICU) from blood and other sterile sites and were identified by matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS).
Results: During the 15-year study period, a total of 569 Candida spp. isolates were evaluated. Candida spp. were isolated from blood culture in 488 (85.8%) cases, from other sterile specimens in 81 (14.2%), from hem pts in 233 (40.9%), from non-hem pts in 336 (59.1%). Detection of Candida spp. from blood culture was predominated in hem pts compared to non-hem pts (94.4% vs. 79.8%, p < 0.001). Among non-hem pts Candida spp. were significantly more often isolated from peritoneal fluid (10.4% vs. 3.4%, p = 0.002) and cerebrospinal fluid (2.7% vs. 0%, p = 0.01) compared to other sities. The most common species were.
C. albicans (n = 229, 40.2%), followed by C. parapsilosis (n = 131, 23.0%), C. glabrata (n = 48, 8.4%), C. krusei (n = 42, 7.4%), C. tropicalis (n = 42, 7.4%), C. guilliermondii (n = 22, 3.9%), C. pelliculosa (n = 16, 2.8%), C. lusitaniae (n = 12, 2.1%), C. auris (n = 11, 1.9%), C. kefyr (n = 7, 1.2%), C. lipolytica (n = 4, 0.7%), C. dubliniensis (n = 2, 0.4%), C. orthopsilosis (n = 1, 0.2%), C. methapsilosis (n = 1, 0.2%), C. fabianii (n = 1, 0.2%). In total 11 Candida species were detected among hem pts and 14—in non-hem (Figure 1). C. krusei (11.6% vs. 4.5%, p = 0.002), C. guilliermondii (7.7% vs. 1.2%, p < 0.001) and C. pelliculosa (5.2% vs. 1.2%, p = 0.08) prevailed in hem pts compared to non-hem pts while C. albicans and C. auris were most frequently detected from non-hem pts (31.3% vs. 46.4%, p < 0.001 and 3.3% vs. 0%, p = 0.004, respectively). The species distribution varied by age and clinical specimens (Figure 2). Distribution of Candida species obtained from pts below 18 years of age were limited by 10 species compared to 15 species in pts older than 18 years; 14 Candida species were isolated from blood culture compared to 9—from other sterile sites.
Conclusions: The etiology of invasive candidiasis in hem and non-hem pts in Russia is characterized by a wide species diversity. The rate of C. albicans was less than 40.2%. The third most prevalent Candida species among hem pts was C. krusei (11.6%), among non-hem pts in ICU—C. glabrata (10.1%). C. auris was isolated only from non-hem pts in ICU. Among hem pts Candida spp. were isolated more commonly from blood culture (94.4%), but 10.4% of Candida species from non-hem pts were from peritoneal fluid ().

P178 Trends of the Epidemiology of Candidemia in Switzerland: A 15-Year FUNGINOS Survey

Kai-manuel Adam 1, Michael Osthoff 1, Frédéric Lamoth 3,4, Anna Conen 5, Véronique Erard 6, Katia Boggian 7, Peter W Schreiber 8, Stefan Zimmerli 9,10, Pierre-Yves Bochud 3, Dionysios Neofytos 11, Mapi Fleury 12, Hans Fankhauser 13, Daniel Goldenberger 14, Konrad Mühlethaler 9,10, Arnaud Riat 15, Reinhard Zbinden16, Andreas Kronenberg 10, Chantal Quiblier 16, Oscar Marchetti 3,17 and Nina Khanna 1,2
  • 1 Division of Infectious Diseases and Hospital Epidemiology, University Hospital of Basel
  • 2 Department of Clinical Research
  • 3 Infectious Diseases Service, Department of Medicine, Lausanne University Hospital and University of Lausanne
  • 4 Institute of Microbiology, Lausanne University Hospital and University of Lausanne
  • 5 Division of Infectious Diseases and Hospital Epidemiology, Cantonal Hospital of Aarau
  • 6 Infectious Diseases Service, Department of Medicine, Cantonal Hospital
  • 7 Division of Infectious Diseases and Hospital Epidemiology, Cantonal Hospital
  • 8 Division of Infectious Diseases and Hospital Epidemiology, University Hospital of Zurich and University of Zurich
  • 9 Department of Infectious Diseases, Bern University Hospital
  • 10 Institute for Infectious Diseases, University of Bern
  • 11 Infectious Diseases Service, University Hospital and University of Geneva
  • 12 Department of Oncology, Lausanne University Hospital and University of Lausanne
  • 13 Institute of Laboratory Medicine, Cantonal Hospital of Aarau
  • 14 Clinical Bacteriology & Mycology, University Hospital of Basel and University of Basel
  • 15 Division of Laboratory Medicine, Laboratory of Bacteriology, University Hospital of Geneva
  • 16 Institute of Medical Microbiology, University of Zürich, Zürich
  • 17 Department of Medicine, Ensemble Hospitalier de la Côte
Objectives: The increasing incidence of candidemia and emergence of drug resistant Candida (C.) species are major concerns worldwide. Long-term surveillance studies are needed.
Materials & Methods: The Fungal Infection Network of Switzerland (FUNGINOS) conducted a 15-year (2004–2018) nationwide epidemiological study of candidemia. Hospital-based incidence of candidemia, Candida species distribution, antifungal susceptibility and consumption were stratified in three periods (2004–2008, 2009–2013, 2014–2018). Population-based incidence over the period 2009–2018 derived from the Swiss Antibiotic Resistance Surveillance System (ANRESIS).
Results: A total of 2273 Candida blood isolates were studied. Population and hospital-based annual incidence of candidemia increased from 2.96 to 4.20/100,000 inhabitants (p = 0.022) and 0.86 to 0.99/10,000 patient-days (p = 0.124), respectively. The proportion of C. albicans decreased significantly from 60% to 53% (p = 0.0023), whereas C. glabrata increased from 18% to 27% (p < 0.0001). Other non-albicans Candida species remained stable. C. glabrata bloodstream infections occurred predominantly in the age group 18–40 and above 65 years. A higher proportional increase of C. glabrata was recorded in wards (18% to 29%, p < 0.0001) vs. intensive care units (19% to 24%, p = 0.22). According to CLSI, non-susceptibility to fluconazole in C. albicans was observed in 1% of isolates, and anidulafungin and micafungin non-susceptibility in 2% of C. albicans and C. glabrata. Fluconazole consumption, the most frequently used antifungal, remained stable, whereas use of mold-active triazoles and echinocandins increased significantly in the last decade (p < 0.0001).
Conclusions: Over the 15-year period, the incidence of candidemia increased. A species shift toward C. glabrata was recently observed, concurring with increased consumption of mold-active triazoles.

P179 Aspergillus fumigatus Genotyping from CF Patient Isolates Demonstrates Possible Acquisition from the Home Environment

Mireille van der Torre 1, Sara Gago 2, Lisa J. Collier 1, Andrew M. Jones 1, Malcolm D. Richardson 1 and Lily Novak Frazer 1
  • 1 MFT Wythenshawe Hospital
  • 2 University of Manchester
Objectives: Aspergillus fumigatus is the most common filamentous fungus isolated from respiratory secretions from Cystic Fibrosis (CF) patients. Despite the high chronic colonisation rate and the contribution of allergic bronchopulmonary aspergillosis (ABPA) to disease progression in CF, little is known about the source of A. fumigatus in CF patients.
We compared A. fumigatus isolates from the homes of CF patients in the Greater Manchester municipal area and corresponding isolates produced from patient respiratory specimens using a sequence-based genotyping technique (TRESPERG) to determine whether the patients could acquire A. fumigatus from the environment of their own homes.
Materials & Methods: The A. fumigatus isolates collected from the homes and respiratory tract of 10 CF patients were characterised with a panel of four genes: cell surface protein A (CSP); MP-2 antigenic galactomannan protein (MP2); hypothetical protein with a CFEM domain (CFEM); and putative C-24 sterol reductase (ERG4B). The environmental samples were also sequenced to determine the presence of cyp51A-mediated azole resistance mechanisms.
Results: The time span between sampling the respiratory tract of patients and environmental sample collection was no longer than 8 weeks. Nineteen environmental isolates from 11 air samples collected from the bedrooms of CF patients with a corresponding respiratory tract A. fumigatus infection were identified as A. fumigatus through phenotypic and genotypic identification. The corresponding 10 clinical isolates were also confirmed as A. fumigatus; all were susceptible to the antifungal drugs itraconazole, voriconazole, posaconazole and amphotericin B. However, cyp51A sequencing revealed the environmental azole resistance mechanism ‘TR34/L98H’ in 2 of 19 (10.5%) environmental isolates.
TRESPERG genotyping revealed 6 CSP, 8 MP2, 7 CFEM and 8 ERG4B genotypes among the 29 A. fumigatus isolates including 1 CFEM and 2 MP2 novel genotypes (Table 1). The most common individual genotypes for CSP, CFEM, MP2 and ERG4B were t01 or t02 (31%), C08A (31%), m1.1 (65.5%) and e07 (37.9%), respectively (n = 12).
There was only one case (1 in 10) where the genotypes of the environmental and corresponding patient airway samples were identical for all four genes tested. However, we found two other patients whose clinical and environmental isolates shared 3 out of 4 markers, suggesting close genetic relatedness. Moreover, there were identical genotypes among clinical and environmental isolates but from different patients (Table 1).
Conclusions: This study suggests that acquisition of environmental A. fumigatus that could potentially become established clinically in CF patients is possible but may occur at low frequency; further sequencing is required to establish causality. This work suggests that preventive measures should focus on the living environment of vulnerable patients to avoid exposure. The use of this genotypic tool can identify quickly whether isolates are genetically distinct. Further analysis of the source of environmental acquisition is ongoing, including environmental testing of the CF centre.

P180 Azole Resistance in Aspergillus fumigatus—Local Epidemiology in Skåne, Southern Sweden, and a Validation of the Four-Well Agar Plate

Unn Tjörnstrand 1 and Karl Oldberg 1,2
  • 1 Clinical Microbiology, Region Skåne
  • 2 Section for Infection Medicine, Lund University
Objectives: Azole resistance in Aspergillus fumigatus is a threat to effective antifungal therapy of invasive aspergillosis, and international guidelines recommend that the choice of agent for empirical treatment should be guided by local prevalence of resistance. Antimicrobial susceptibility testing (AST) with the reference method, broth microdilution (BMD), is often too demanding for most microbiological laboratories. The four-well azole agar plate (FWP) has previously been validated as a simpler method of screening for azole resistance: Three of the wells contain voriconazole, itraconazole and posaconazole, respectively, while the fourth is a growth control. Growth in any of the azole-containing wells indicates possible resistance. Our first objective was to validate the FWP as a routine method of AST on clinical isolates of A. fumigatus in our laboratory. Secondly, to evaluate the local prevalence of azole resistance in our region—Skåne in southern Sweden, with a population 1.38 million in 2020.
Materials & Methods: A commercially available FWP, VIPcheck™ (EWC Diagnostics, Steenwijk, The Netherlands) was used according to the instructions of the producer. The amount of growth was scored from 0 to 3.
Sensitivity, specificity and variation was investigated using a panel of 11 resistant strains and 11 sensitive strains that had been tested with BMD. This panel was tested twice, each time by two blinded individuals. The highest score for any azole well was registered.
The local prevalence of resistant isolates was studied by testing all clinical isolates of A. fumigatus in the Skåne region with the FWP during one year. Isolates exhibiting growth score ≥0.5 in an azole well were sent to Karolinska University Laboratory, Stockholm, Sweden, for BMD. Selected isolates (the first resistant or ambiguous isolate per patient) were sent to Statens Serum Institut, Copenhagen, Denmark, for sequencing of the cyp51A gene.
Results: All resistant isolates in the panel were identified, with a growth score of ≥1. In five cases a sensitive strain was given the score 0.5, giving a per test specificity of 77%.
During November 2018 to February 2020, 235 isolates from 157 patients were screened. 18 isolates were positive in the FWP (Table 1). Of these, ten isolates from three patients were resistant in BMD. Two patients had isolates with the mutation T34/L98H. The proportion of resistant isolates was 4.3% and the proportion of patients with resistant isolates was 1.9%.
The specificity in the screening study was 97% if isolates with growth score 0.5 were included as possibly resistant.
Conclusions: The sensitivity of the FWP is high, and it can be used to rule out azole resistance in the routine of microbiological laboratories. The distinction between no growth and weakest possible growth (0.5) can sometimes be difficult without experience, leading to reduced specificity. We believe this is why we classified more isolates to 0.5 in the early tests with the panel, compared with the later screening study.
We found a proportion of resistant isolates similar to what has been described in nearby Denmark. We see no need of exchanging azoles as the first line therapy for Aspergillus infections in our region.

P181 Epidemiology of Candidemia in the Netherlands: An Update on Aetiology and Antifungal Susceptibility from a Nationwide Survey

Renee Van Bentum 1, Claudy Oliveira dos Santos 2,3,4, Greetje Kampinga 2, Douwe Postma 1 and Paul Verweij 4
  • 1 Department of Internal Medicine, University Medical Centre Groningen
  • 2 Department of Medical Microbiology, University Medical Centre Groningen
  • 3 Laboratory of Clinical Microbiology and Infectious Diseases, Isala Hospital
  • 4 Centre for Expertise in Mycology, Department of Medical Microbiology, Radboud University Medical Center
Objectives: Candidemia is the most frequent form of invasive candidiasis and results in high morbidity and mortality. Proper empirical treatment requires knowledge of the local incidence, species distribution, and susceptibility, yet the incidence of Candida species can differ per geographical region. Unfortunately, epidemiological data of Candida infections in the Netherlands is lacking after 2001. We use a retrospective cohort study of fungemia to gain knowledge of recent Candida species distribution and their susceptibility in the Netherlands.
Methods: Positive blood cultures with Candida species were retrieved from the Laboratory Information Systems of four tertiary care centres in different areas of the Netherlands (UMCG Groningen, AMC and VUMC Amsterdam, Radboud UMC Nijmegen) during the period 2005–2015. Only first isolate from episodes of candidemia were included. Identification and susceptibility testing was performed according to local procedures. Based on the MIC-distributions, the proportion of isolates outside the wildtype distribution was assessed.
Results: 984 isolates were retrieved from 744 patients. Incidence could not be calculated as the total amount of collected blood cultures or patient admissions was not known at this time. The most frequently found Candida species were Candida albicans (53.8%), C. glabrata (20.7%), C. parapsilosis (7.5%), C. krusei (4.8%), and C. tropicalis (4.7%). This distribution was relatively stable from 2005 to 2015 with the average percentage of non-albicans ranging from 44.8% from 2005–2009 to 45% from 2010–2015. 96.8% of the C. albicans, 83.6% of the C. glabrata and 92.5% of C. parapsilosis fell within the wildtype distribution range for fluconazole according to the EUCAST epidemiological cut-off (ECOFF) values. This was 100%, 98.6%, and 92.9% respectively for amfotericine B. For caspofungin, this was 98.9% for C. albicans and 87.1% for C. glabrata. For C. parapsilosis no formal EUCAST ECOFF value is available, with regards to caspofungin.
Conclusions: C. albicans remains the most common cause of candidemia in the Netherlands; the major subspecies of non-albicans candidemia are C. glabrata and C. parapsilosis. Throughout the follow-up period this remained relatively stable. Fluconazole resistance was rare. These data can be used in the development of Dutch treatment guidelines and choice of empirical treatment strategies. Future efforts will include updating the database to the present and combining microbiologic with clinical and pharmacologic data to obtain insights into current management and antifungal stewardship of candidemia in the Netherlands.

P182 Surveillance of Azole-Resistant Aspergillus fumigatus Clinical Isolates in Greece: First Detection of TR34/L98H Alteration in cyp51A Associated with Pan-Azole Resistance

Joseph Meletiadis 1, Maria Siopi 1, Olga Rivero-Menendez 2, Narda Medina 2, Athanasios Chatzimoschou 3, Angeliki Stathi 4, Helen Kirikou 4, Paraskevi Mantzana 5, Stavroula Antonopoulou 6, Eleni Vagiakou 6, Lemonia Skoura 5, Levantia Zachariadou 4, Aristea Velegraki 7,8, Georgia Vrioni 8, Emmanuel Roilides 3, Ana Alastruey-Izquierdo2, Spyros Pournaras 1 and Athanasios Tsakris 8
  • 1 Clinical Microbiology Laboratory, “Attikon” University General Hospital, Medical School, National and Kapodistrian University of Athens
  • 2 National Centre for Microbiology, Instituto de Salud Carlos III, Mycology Reference Laboratory
  • 3 Infectious Diseases Laboratory, 3rd Department of Pediatrics, “Hippokration” General Hospital, Faculty of Medicine, Aristotle University School of Health Sciences
  • 4 Microbiology Department, “Aghia Sophia” Children’s Hospital
  • 5 Microbiology Department, “AHEPA” University Hospital, Aristotle University School of Health Sciences
  • 6 Microbiology Department, “G. Gennimatas” General Hospital
  • 7 University of Athens/Hellenic Collection for Pathogenic Fungi (UOA/HCPF), Medical School, National and Kapodistrian University of Athens
  • 8 Microbiology Department, Medical School, National and Kapodistrian University of Athens
Objectives: We have recently shown that azole-resistant Aspergillus fumigatus (AR-Af) with an environmental signature is present in Greece (Siopi JAC 2020). Nevertheless, the prevalence of azole resistance in Greek clinical isolates remains unknown. Based on these grounds, we investigated the occurrence of clinical AR-Af in Greece.
Materials/methods: A total of 206 A. fumigatus species complex (SC) strains recovered from multiple respiratory specimens of 180 patients (64 haematological, 75 paediatric whereof 50 with cystic fibrosis, 30 hospitalized in ICU whereof 13 with COVID-19 infection, 36 other) were collected from 7 centres (5 Athens, 2 Thessaloniki), were stored in 10% glycerol stocks at −70 °C and were retrospectively tested. Isolates were macro-/micro-scopically identified to SC level, while A. fumigatus sensu stricto (SS) were presumptively identified based on growth at 48 °C. In vitro susceptibility testing against amphotericin B (AMB), itraconazole (ITC), voriconazole (VRC), posaconazole (POS), isavuconazole (ISA), anidulafungin (AFG), caspofungin (CAS) and micafungin (MFG) was performed according to EUCAST E.DEF 9.3.2. Isolates exhibiting reduced susceptibility to azoles were subjected to confirmatory molecular identification and were further studied for the detection of specific mutations in the cyp51A gene, including its promoter region, associated with azole resistance (Mellado AAC 2007).
Results: All isolates grew at 48 °C indicating that they belonged to A. fumigatus SS. Antifungal susceptibility patterns among all strains are summarized in Table. Overall, 3/206 (1.5%) AR-Af SS from 2/180 (1.1%) patients were detected. Particularly, one of the three strains, recovered from pleural fluid culture of an ICU patient, did not have mutations in cyp51A gene and showed resistance to ITC/POS (MIC > 8/0.5 mg/L) but was susceptible to VRC/ISA (MIC 1/1 mg/L). The other two strains, isolated from subsequent sputum specimens of a 16-year-old cystic fibrosis patient without prior azole exposure, were pan-AR-Af (ITC, VRC, ISA and POS MIC >8, 4, 8 and 1 mg/L, respectively) harbouring the TR34/L98H resistance mechanism.
Conclusions: We report for the first time pan-azole-resistant clinical A. fumigatus in Greece. Although the occurrence of AR-Af is still limited, this finding must alarm the systematic local surveillance of azole resistance.
Keywords: azole-resistant Aspergillus fumigatus, clinical isolates, Greece

P183 Prevalence of Dermatophytosis in Sheep and Goats Sold at Live Animal Markets in Ibadan, Oyo State, Nigeria

Rotimi Oludare and Dimeji Oluwayelu
Department of Veterinary Microbiology, Ahmadu Bello University, Zaria 810211, Nigeria
Objectives: The study was undertaken to determine the prevalence of dermatophytosis in sheep and goats sold at two major live animal markets in Ibadan, Oyo State, Nigeria. The two markets, Oranyan and Akinyele, are known for the sale of West African Dwarf (WAD) sheep and goats raised in Southwestern Nigeria and Ouda sheep and Red Sokoto goats transported from the northern region, respectively.
Materials & Methods: Based on the availability of sheep and goats, purposive sampling method was used. Samples were collected from adult sheep and goats with skin infections suggestive of dermatophytosis as follows: skin scrapings (sheep, n = 70; goats, n = 50) and hair samples (sheep, n = 20; goats, n = 10). The samples were treated with 10% KOH and examined microscopically for fungal elements. Thereafter, they were cultured using Dermatophyte Test Medium, Sabouraud’s dextrose agar, corn meal agar and potato dextrose agar with incubation at room temperature, followed by identification of each isolate through observation of colonial morphology and microscopic appearance of lactophenol cotton blue-stained smears prepared from the cultures. Statistical analysis was done using SPSS software and level of association between variables and occurrence of dermatophytosis was determined using Chi-square test. p-values <0.01 were considered significant.
Results: Out of the 150 samples, 13 dermatophytes (8.7%) were isolated namely: Microsporum canis (n = 3, 23.1%), Microsporum gypseum (n = 3, 23.1%), Trichophyton tonsurans (n = 2, 15.4%), Trichophyton verrucosum (n = 4, 30.8%) and Epidermophyton floccosum (n = 1, 7.7%). Dermatophytic lesions were found on four anatomical sites on the bodies of the sampled animals, viz: the head, neck, limbs and flank region with dermatophyte isolation rates per total sample collected being: 12%, 5%, 10% and 7%, respectively. However, there was no statiscally significant association between the number of dermatophytes obtained and the anatomical sites (p > 0.01).
Comparison of dermatophytosis prevalence among examined animals revealed highest detection rates in Ouda sheep (14.0%) and Red Sokoto goats (7.5%) which were from northern Nigeria and least detection rates in the WAD sheep and goats. There was however no significant association between the prevalence of dermatophytosis and breed of sheep and goats (p > 0.01). Similarly, although the prevalence of dermatophytosis was higher (25.3%) in female sheep and goats than in males (3.3%), the difference was not statistically significant. Two anthropophilic dermatophytes, Trichophyton tonsurans and Epidermophyton floccosum, were isolated from Ouda sheep in this study.
Conclusions: The zoophilic dermatophytes (Trichophyton verrucosum, Microsporum gypseum and Microsporum canis) isolated in this study pose a substantial health risk to occupationally exposed humans especially animal handlers, livestock farmers, abattoir workers and veterinarians. Additionally, the isolation of anthropophilic Trichophyton tonsurans and Epidermophyton floccosum from sheep in this study underscores the role of humans in the transmission of dermatophytes to domestic animals. This shows that these animals are not only reservoirs of zoophilic dermatophytes, but they can also serve as reservoirs of anthropophilic dermatophytes, thus making them potentially capable of transmitting the latter to in-contact or occupationally exposed humans. To our knowledge, this is the first report of isolation of Epidermophyton floccosum in domestic animals in Nigeria.

P184 A Modified Point Prevalence Study of Antifungal Drug Use in Neonatal Units across Europe

Elisavet Chorafa 1, Elias Iosifidis 1, Andrea Oletto 2, Adilia Warris 3, Elio Castagnola 4, Roger Bruggemann 5, Andreas Groll 6, Thomas Lehrnbecher 7, Laura Ferreras-Antolin 8, Alessio Mesini 4, Emmanuel Roilides 1 and CALYPSO Study Group 1
  • 1 Aristotle University Of Thessaloniki
  • 2 Fondazione Penta Onlus
  • 3 MRC Centre for Medical Mycology, University of Exeter
  • 4 Istituto Giannina Gaslini
  • 5 Radboud University Medical Centre
  • 6 University Children’s Hospital Munster
  • 7 Hospital for Children and Adolescents, Johann Wolfgang Goethe-University
  • 8 St. George’s University Hospitals NHS Foundation Trust
Objectives: Knowledge of antifungal prescribing in neonatal units is extremely important. However, data on antifungal use in neonatal inpatients are limited. There is need to collect standardized multi-center data. Aim of CALYPSO study was to record antifungal consumption in infants hospitalized in neonatal units across Europe in order to obtain a better understanding of current practice and to identify areas to be targeted in future.
Materials & Methods: We organized a multicenter European 12-wk modified point-prevalence study (mPPS). All patients hospitalized in neonatal units (NUs) and receiving systemic antifungals in participating centers across Europe were included. Information about ward demographics and policies was collected once at the beginning; weekly ward and patient data (demographics, underlying conditions, risk factors, antifungal agents prescribed, dose, rational) were collected prospectively during the 12-wk study period and entered in REDCap database.
Results: Twenty-six NUs (18 Level 3, 4 Level 2, 4 Level 1) from 17 hospitals, located in 8 European countries with a median capacity of 21 beds participated in the study. The median percentage of neonates receiving antifungal agents per mPPS week across all NUs Level 3 was 9.9% (range 7.3–11.9). Great variations were observed among different NUs; median antifungal consumption ranged from 0% to 48.9% during the 12 w study period. A total of 166 patients were included in the study; 156 patients aged ≤90 d (md age = 6, Q1 = 3, Q3 = 18.5) and 10 aged 3–14mo (md age = 4, Q1 = 3, Q3 = 6.3). Prematurity was most common underlying condition among patients ≤ 90 d of age (87%), whereas chronic respiratory disease (60%) and history of surgery (40%) were among patients 3–14 mo. Indication for antifungal prescribing upon inclusion in the study was prophylaxis for 77% and treatment for 23% of prescriptions (69% empirical, 10% preemptive, 21% targeted, n = 39). Most common reasons for prophylaxis were prematurity, birth weight <1000 g, and presence of central venus catheters; whereas late onset sepsis was for empirical treatment. Fluconazole was the most frequently prescribed agent both for prophylaxis (98%, n = 129) and treatment (39%, n = 39). Dose of fluconazole for prophylaxis ranged from 2 to 8 mg/kg/day (md dose = 4.8) and for treatment from 3 to 12 mg/kg/day (md dose = 8.6), respectively. Liposomal amphoterecin b was used in 26% of patients for treatment with a dose range from 3 to 5 mg/kg/day (md dose = 4.2).
Conclusions: The majority of antifungal prescriptions across European NUs is for prophylaxis. Fluconazole is the most commonly prescribed antifungal agent both for prophylaxis and treatment with significant variation in dosing regimens across NUs. Results from this multicenter study can be a first step to guide a European antifungal stewardship program.

P185 Behavioural Factors and Vulval Symptoms Associated with RVVC among Women of Childbearing Age in Southern Nigeria

Samuel Fayemiwo 1,2, Lily Novak-Frazer 3, Isaac Adewole 1 and Riina Richardson 3,4
  • 1 College of Medicine, University of Ibadan
  • 2 Division of Infection, Immunity and Respiratory Medicine, Faculty of Biology, Medicine and Health, School of Biological Sciences
  • 3 Division of Infection, Immunity and Respiratory Medicine, School of Biological Sciences, NIHR Manchester Biomedical Research Centre (BRC) at the Manchester Academic Health Science Centre, The University of Manchester
  • 4 Manchester University NHS Foundation Trust, Wythenshawe Hospital, Manchester
Objectives: Recurrent vulvovaginal candidosis (RVVC) is a clinical condition defined by a history of four or more acute inflammatory and culture-positive symptomatic episodes of vulvovaginal candidosis (VVC) in a 12-month period. This condition is established by the presence of compatible clinical signs, symptoms, and detection of Candida species in the laboratory by microscopy and culture from vaginal swabs. Predisposing factors for RVVC have not been thoroughly characterised, but are thought to include hormonal changes, as seen during pregnancy, uncontrolled diabetes, magnified host immune response, as well as other idiopathic causes. This study aimed to examine the behavioural and clinical characteristics associated with RVVC among women of childbearing age in southern Nigeria, which may differ from the western world (prevalence of 8–9%).
Materials & Methods: A prospective population-based cross-sectional study was conducted in three geopolitical zones of southern Nigeria (Anambra in the southeast (SE), Rivers in the south (SS) and Oyo in the southwest (SW)). Women of childbearing age were recruited in their homes or at Primary Health Centres in two randomly selected local government areas of the selected states. The participants, either symptomatic or asymptomatic, were given standardised symptom, health and lifestyle questionnaires. Data were analysed using SPSS version 25.0.
Results: The mean age of the participants was 35 years (range 18–55). Of the 585 women enrolled, 66.5% (389/585) were symptomatic at enrollment, with the highest prevalence in women from southeastern Nigeria (P = 0.001). The prevalence of women with a history of RVVC was also highest in SE Nigeria: 34.1% (62/182) in contrast to 25.7% (57/222) in the SW; and 8.8% (16/181) in the SS (P = 0.001). Overall, the most common behavioural factor associated with RVVC was frequent sexual activity, with an odds ratio (OR) of 2.7 (1.0–6.9, 95%CI, P = 0.035). Other factors, though not statistically significant, included the practice of oral and anal sex, wearing of tight-fitting trousers, use of local herbs. Risky sexual behaviour was more common in the southeastern zone. Clinical characteristics associated with RVVC included being symptomatic at time of enrollment (3.1 (2.1–4.7) P = 0.0001), genital soreness (2.6 (1.6–4.2); P = 0.001), burning sensation (2.4 (1.5–3.9); P = 0.001;), genital irritation (3.3 (2.1–5.1) P = 0.0001), abnormal vaginal discharge (3.3 (2.1–5.1), P = 0.003), genital pruritus (2.3 (1.6–3.4), P = 0.0001), presence of genital rashes (2.4 (1.0–5.7), P = 0.043), dysuria (2.2 (1.3–3.6), P = 0.002) and vaginal spotting (2.2 (1.07–4.3), P = 0.028). Logistic regression showed that those who inserted synthetic objects into their genitals (P-value for AOR = 0.044) and those having abnormal vaginal discharge (P-value for AOR = 0.001) were at least twice likely to have RVVC.
Conclusions: RVVC is more common in Nigeria than in the western world, and there are regional differences in their aetiology and epidemiology. Women between the ages of 25–29 and 35–39 years are mostly affected. Numerous factors, including risky sexual behaviour, vaginal spotting and dysuria, were associated with the occurrence of RVVC.

P186 Cystic Fibrosis Patients Fungal Epidemiology in a Tertiary Hospital in the North of Portugal

Dolores Pinheiro
Serviço de Patologia Clínica—Centro Hospitalar Universitário S. João
Objectives: Cystic Fibrosis (CF), a hereditary disease, is caused by mutations on the CF transmembrane conductance regulator (CFRT) gene, on chromosome 7. CFRT protein is present in multiple organs of the human body, but it is particularly important in the respiratory trat, where its impairment leads to increased mucus thickness, unable to be cleared by the mucociliary system. This condition promotes local chronic infection and inflammation. Accordingly, patients with CF develop recurrent infections by bacteria, virus, or fungi together or separately along different periods of time and patient’s ages. The purpose of this work was to prospectively identify yeast and filamentous fungi (FF) in the patient’s sputum samples sent to the microbiology laboratory in 2019, in a tertiary hospital on the north of Portugal.
Materials & Methods: All sputum samples belonging to CF patients with mycological exam, were culture on Sabouraud medium, incubated in aerobiosis atmosphere at 25 °C and observed for growth every 2 days, until a total of 7. Those media with presence of yeast and FF proceeded for identification. For yeast, Vitek® MS (MALDI-TOFF methodology) and Vitek®2 (biochemical tests) from biomerieux were used; for FF, classical morphological and microscopical methods of fungal colony assessment were employed.
Results: On 32 patients (20 female and 12 males) with a medium age of 21.6 years old (range: 5 to 51) a total of 114 samples exhibited fungal growth and 137 strains were identified. Among them, 79 (57.7%) were yeast: 53 Candida albicans, 20 C. parapsilosis, 2 C. dubliniensis, 2 C. lusitanea and 2 C. glabrata; and 58 (42.3%) were FF: 15 A. fumigatus, 1 A. niger, 12 Exophiala dermatitidis, 12 Rasamsonia argillacea complex, 8 Scedosporium apiospermum, 9 Penicillium spp. and 1 Fusarium spp. In most patients, one single strain was identified but in some, two or even three strains were present.
Conclusions: The results show a fair balance between yeast and FFs in these patients. In addition, they provide evidence on fungal diversity, suggesting that some strains are replaced by others over time. While the meaning of these changes is uncertain, also because Candida spp. are a usual inhabitant of the oral cavity, they emphasize the view that CF patients require regular fungal assessment along the course of the disease.

P188 Analysis of Resistance in Antifungals (ARIA)—Global Surveillance of Candida spp. Isolates, Including C. auris, in 2019

Ian Morrissey 1, Stephen Hawser 1, Nimmi Kothari 1 and Mahmoud Ghannoum 2,3
  • 1 IHMA Europe
  • 2 Center for Medical Mycology, University Hospitals Cleveland Medical Center and Case Western Reserve University
  • 3 NTS Ventures
Objectives: ARIA is an annual surveillance initiative collecting yeast and fungal isolates from hospitals worldwide designed to determine susceptibility to antifungal agents and trends over time. The data presented here are for Candida spp. collected in 2019 (study year 1) from Argentina (number of sites = 1), Australia (2), Czech Republic (1), Germany (1), Italy (1), Panama (1), Taiwan (1), Turkey (1) and the USA (3).
Materials & Methods: Isolates (n = 730) were collected and re-identified by MALDI-TOF or molecular methods. MIC determinations were performed at a central laboratory by the Clinical and Laboratory Standards Institute (CLSI) broth microdilution method (CLSI standard M27) using amphotericin B (AMB), anidulafungin (AFG), caspofungin (CFG), fluconazole (FLC), isavuconazole (IVC), micafungin (MFG), posaconazole (PSC) and voriconazole (VRC). Percentage susceptibility (%S) or wild-type (%WT) were calculated according to CLSI breakpoints (CLSI supplement M60) or epidemiological cut-off values (CLSI supplement M59), respectively.
Results: Summary MIC and susceptibility data for all isolates combined are shown in the Table. Most isolates were at least 90% %S or %WT to the antifungals tested. Those with lower susceptibility are highlighted in grey shading and in these cases susceptibility was variable by country. The %WT for PSC vs. C. albicans ranged from 26.7% in Turkey to 90.9% in Germany. Similarly, AFG susceptibility against C. glabrata was 15.8% in Italy but 91.7% in Panama. MFG susceptibility in C. glabrata ranged from 76.9% in Turkey to 100% in Argentina. Micafungin susceptibility in C. krusei was 100% in Argentina, Australia. Italy and Taiwan, whereas susceptibility in the USA was 73.3%. FLC susceptibility in C. parapsilosis was 100% in all countries except Italy (52.4%) and Turkey (76.2%) which reduced the overall susceptibility to 88.5%. Isolates of C. tropicalis from Australia, Panama, USA and Taiwan were >90% WT to PSC in contrast to isolates from Argentina (57.1%) and Italy (47.4%). No CLSI breakpoint or epidemiological cut-off value is available for C. auris. However, the US Centres for Disease Control and Prevention has issued tentative breakpoints (https://www.cdc.gov/fungal/candida-auris/c-auris-antifungal.html). Using these breakpoints, full susceptibility was observed to all the antifungals tested except FLC where 56.3% were susceptible.
Conclusions: Most Candida spp. were fully-susceptible to the antifungal agents tested, but where non-susceptibility did occur this varied by country and antifungal agent. These differences are important to help clinicians make optimum choice of antifungal agent. As ARIA evolves it will become an essential tool to monitor and assess changes in antifungal resistance by geography and over time.

P189 Large-Scale Molecular Epidemiological Assessment of Candida Species Isolated from Patients in Nigeria

Rita Oladele 1,9, Folake Peters 2,9, Mark Okolo 3, Iriagbonse Osaigbovo 4, Y AbdulHakeem 5, U Udoh 6 and Ben Stielow 7,8
  • 1 Department of Medical Microbiology and Parasitology, College Of Medicine, University Of Lagos, Lagos State, Nigeria
  • 2 Mycology Unit, Medical Microbiology and Parasitology Laboratory, Lagos University Teaching Hospital
  • 3 Department of Medical Microbiology and Parasitology, University of Jos Teaching Hospital
  • 4 Department of Medical Microbiology and Parasitology, University of Benin Teaching Hospital
  • 5 Federal Medical Centre, Yola
  • 6 University of Calabar Teaching Hospital
  • 7 Radbound UMC, Centre for Infectious Diseases
  • 8 Thermo Fisher Scientific
  • 9 Medical Mycology Society of Nigeria
Objectives: Molecular identification and typing methods have proven to be very useful to unravel the epidemiological and population structure of geography dependent Candida species infections, facilitating the understanding of the dynamics of candidiasis in the human population. Information obtained from molecular approaches determines specific features that enable isolate discrimination and measure of isolate relatedness. This study aimed to determine the molecular epidemiology of Candida species isolated from patients in a tertiary hospital in Lagos Nigeria.
Materials and Methods: Study design was cross-sectional involving isolates from clinical samples of in-patients as well as out-patients. Stored identified isolates of Candida spp. were collected on pre-prepared sabouraud dextrose slants. Pre-identification of Candida spp. was performed using routine conventional microscopy and biochemical tests. Molecular characterization methods were employed for the identification of the Candida species using internal transcribed spacer (ITS) and 28S large ribosomal subunit regions as well matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI TOF). Gene sequences obtained were accessioned and deposited in the Gene Bank.
Results: Majority of the Candida spp. were isolated were from; HVS 112(51.4%), urine 44(20.2%), sputum 18(8.3%), blood cultures 14(6.4%), wound swabs 10(4.6%) and stool 10(4.6%) samples. Age range of patients was between 8 weeks up to 97 years, median 33 years with IQR 18.5. Females accounted for majority of the samples (160 [73.4%]). The total number of yeast isolates sequenced were 219; Candida albicans 114(52.3%), Candida tropicalis 43(19.7%), Candida glabrata 22(9.7%), Candida parapsilosis 11(5.0%), Candida orthopsilosis 7(3.2%), and other atypical yeast spp. (including Aurobasidium melanogenum, Issatchenkia orientalis (Pichia kudriavzevii), Kluyveromyces cf marxianus, Starmerella sorbosivorans). Twenty-one (9.6%) of the yeast isolates identified as Candida spp. were not Candida.
Conclusions: The results of the present investigation revealed a high degree of genetic diversity among the yeast isolates being isolated from clinical specimens in Nigeria. Whole-genome sequencing will provide more information regarding evolutionary pathway geographical locations and anatomical sources of the Candida species.

P190 Physiological and Genetic Relatedness between Human and Animal Candida albicans Isolates Recovered from Southeastern Nigeria

Ifeanyi Elibe Mba and Emeka Innocent Nweze
University Of Nigeria Nsukka
Objectives: Candida albicans is currently the most implicated pathogenic fungal species recognized as the major cause of various human and animal fungal infections globally. Knowing the local epidemiology of Candida albicans and evaluating its diversity is essential and will help understand and control their transmission globally. The present study was conducted to evaluate the physiological and genetic relatedness between human and animal C. albicans isolates in Nigeria.
Methods: Clinical Candida albicans (n = 96) were isolated from urine, high vaginal swab (HVS) and blood. In contrast, Candida albicans (n = 41) were isolated from the rectal swab, blood, feces, and milk in animals: goat, sheep, cattle, pig and chicken. The identification of the species was performed using standard methods. Enzymatic activity was screened using plate methods. Susceptibility testing was carried out using disk diffusion and broth microdilution methods. The C. albicans isolates that were highly resistant to the antifungal agents and showed a strong ability to produce extracellular hydrolytic enzymes were typed by random amplified polymorphic DNA polymerase chain reaction (RAPD-PCR) using three primers (P4, OPA-03 and OPE-18). RAPD-PCR DNA banding patterns that represent the DNA fingerprint were analyzed. After ethidium bromide staining, polymorphism was detected as the presence or absence of bands of particular sizes and intensity. The dendrogram was constructed using a matrix generated by UPGMA (Unweighted Pair Group Method with Arithmetic Means).
Results: A statistically significant difference (P = 0.031) was observed in the distribution of Candida spp. recovered from humans and animals. The Pz values of human Candida albicans for proteinase, hemolysin, lipase and phospholipase were 0.65 ± 0.97, 0.61 ± 0.81, 0.59 ± 0.47 and 0.76 ± 0.74 respectively, while that of Candida species recovered from the animal were 0.67 ± 0.13, 0.61 ± 0.95, 0.62 ± 0.67 and 0.69 ± 0.70 respectively (Table 1). Thus, there was no statistically significant difference (P > 0.05) in the in vitro enzymatic activity between the two groups. A high azole-resistance rate was observed. Resistance was higher among human Candida isolates than animal isolates, although the difference was not statistically significant (P = 0.519). The three primers used in this study produced appropriate multi-shape bands encoded within a range from 100 bp–1300 bp (Figures 1–3). Regardless of isolate sources, several DNA bands with different sizes and variable electrophoretic patterns were observed in this study. Therefore, our RAPD analysis showed a high degree of heterogeneity. No evidence of any clonal relationship was observed as a high degree of separation of human and animal C. albicans isolates into distinct genotypes was evident. Most of our isolates showed less than 80% similarity suggesting the presence of independent strains.
Conclusions: Though this is a preliminary study, we observed different banding patterns suggesting a high degree of discriminatory power for the three primers used. It further confirms the usefulness of RAPD-PCR in molecular typing of Candida isolates. Moreover, this study underscores the importance of animals and their products as potential sources/reservoirs and means of transmission of pathogenic and multi-azole resistant Candida species in Nigeria.
Keywords: Candida albicans; antifungal resistance; virulence factors; genotyping; RAPD PCR; human; animal

P191 Prevalence of Dermatophytoses in School Age Children and Outpatients in Enugu Metropolis, Enugu State, Nigeria

Ekene Chidebelu, Emeka Nweze and Ukamaka Udeh
University Of Nigeria Nsukka
Objectives: Dermatophytosis is an evolving epidemiologically important fungal infection in Nigeria with increased incidence especially in children of school age. The infection has contributed to overall public health burden due to the treatment cost complicated by the occassional emergence of resistant strains. This study investigated the prevalence of dermatophytosis in children of school age, and among patients in Enugu metropolis.
Materials & Methods: The study population whose informed consents and demographic data were obtained comprises of school children and outpatients from selected schools and hospitals within the study area. Preliminary screening of the samples (n = 200) was done by direct observation of the wet mount digested in 20% KOH under the ×10 and ×40 objectives. The samples in normal saline solution, were inoculated on SDA plates using sterile swab sticks, and then incubated at room temperature and at 37 °C for 2 to 4 weeks. The suspected colonies consistent with cultural and microscopic characteristics of dermatophytes were identified using the reference fungal atlas.
Results: The recovery rate of dermatophytes was 30.5%. Higher prevalence was recorded in school samples (93.44%) than the hospital samples (6.56%). Age distribution of the positive samples showed a higher occurrence among early school age (5–9 yrs, 19.67%) and the adolescent age groups (10–14 yrs, 65.57%); than the adult population (1.64–3.28%). Incidence in females was more in (52.5%), than in males (47.5). Body lesion with the highest incidence of dermatophytes was scalp (67.2%), while the rate of isolation from nails was the lowest (4.91%). The predominant dermatophyte species were Trichophyton mentagrophytes (40.98%), T. tonsurans (24.59%), and T. verrucosum (18.03%).
Conclusions: These findings indicated that school age children are vulnerable to dermatophytoses, and good personal hygiene should be encouraged in children. Sharing of personal effects such as towels and handkerchiefs among children should be discouraged to reduce the risk of the infection spread in the young population.

P192 Mucormycosis: An Emerging Challenge in Covid19 Pandemic

Jagdish Chander and Surinder Singhal
Sector 32, Government Medical College Hospital
Objectives: Mucormycosis is a rapidly destructive necrotising fungal infection usually seen among the diabetics and also in patients with other types of immunocompromised background. It occurs due to disruption of normal protective barrier hence local risk factors include trauma, burns, surgery, surgical splints, arterial lines, injection sites, biopsy sites, tattoos and insect or spider bites. The systemic risk factors for mucormycosis are hyperglycemia, ketoacidosis, malignancy, leucopenia and immunosuppressive therapy; however, infections in immunocompetent host are now well-described. Mucormycetes are upcoming as emerging agents leading to fatal consequences, if not timely detected/treated. Covid19 pandemic has led to more than 11,000 cases of rhino-orbito-cerebral mucormycosis in India during a very shot span of time. In the mainstream media mucormycosis is being projected as black fungus throughout this pandemic. This is rather a misnomer and should not be used because Mucorales are hyaline fungi. Recently, mucormycosis has been declared as a notifiable disease by various states of India. Eventually ICMR/GOI on May 20, 2021 covered this disease under Epidemic Disease Act, 1897, wherein all government and private health facilities, medical colleges will follow guidelines for its screening, diagnosis and management. Therefore, it has become an acute emergency being a life-threatening during Covid19 pandemic to the patients thereby a challenge to the medical fraternity at large. This two minutes video is being presented to highlight the importance of this unprecedented disease.
Materials & Methods: The debrided necrotic skin tissue was processed as per standard mycological protocol ring the Covid19 pandemic period. The clinical entity was diagnosed by mounting biopsy material on potassium hydroxide (10%), CFW, histopathology study of tissue sections stained by hematoxylin and eosin (H&E), periodic acid-Schiff (PAS) and Gomori methenamine silver (GMS) stainings as well as by fungal culture on conventional media, with morphological identification of isolates with LCB mount. All patients were treated with amphotericin B along with extensive surgical debridement of necrotic tissue tissue.
Results: Majority of the martinets belong to the rhino-orbital mucormycosis and Rhizopus arrhizus is the commonest species isolated throughout the country. The underlying factor was either diabetes mallets or indiscriminate use of steroids for treating Covid19. The other risk factors like use of mask, lack of exercise due to frequent lockdowns, contaminated masks and use of contaminated oxygen supply accessories, however, these have not yet proved. The overall mortality among the patients was found to be on an average a fifty percent.
Conclusions: During this pandemic of Covid19, thousands of patients have presented with mucormycosis particularly rhino-orbito-cerebral type. This is very significant change in the Incidence and prevalence of the Mucoralean fungi and underlying factors are to be explored in details. Moreover, index of suspicion of fungal etiology should be kept very high to avoid any time wastage in establishing diagnosis and empirical treatment on bacterial lines. Early diagnosis, prompt and extensive surgical debridement and appropriate antifungal therapy are the key to treat such type of patients and their lives can be saved from mucormycosis.

P193 Antifungal Prescription Practices and Average Length of Stay (ALoS). Evidence from the Public Hospitals in Romania

László Lorenzovici 1,2, Andrea Bârzan-Székely 1, Szabolcs Farkas-Ráduly 1 and Maria Gheorghe 3
  • 1 Syreon Research Romania
  • 2 G. E. Palade University of Medicine, Pharmacy, Science andTechnology
  • 3 Pfizer
Objective: ECDC indicates that Romania is among the Member States with the highest levels of antimicrobial resistance (AMR) in Europe. However, there is no National Antimicrobial Stewardship Program (ASP) implemented to facilitate national guidelines on antimicrobial prescription. Furthermore, studies using local hospital data of cases with aspergillosis and mucormycosis are scarce. The aim of this study is to estimate the average length of stay (ALoS) and observe the prescription practices of treating aspergillosis and mucormycosis infections in public hospitals in Romania.
Methods: This analysis used official diseases codes data reported from all public hospitals in Romania (515 hospitals) in years 2018 and 2019. We used 6 diseases codes for aspergillosis and mucormycosis including pulmonary aspergillosis, gastro-intestinal mucormycosis and other forms of unspecified aspergillosis and mucormycosis. A separate analysis using data from 21 large hospitals investigated to what extent prescription protocols for fungal infections included a microbiologic test.
Results: We found that on average, in 2019, Romanian hospitals reported approximately 4 cases of fungal infections treated per 100,000 per year with 80% of these cases having a disease code indicative of pulmonary aspergillosis. However, in the absence of rapid testing only in 20% of all cases the fungal prescription practices included a test to confirm the fungal infection. In addition, we found that the average ALoS was 17 days [95% CI: 16.2–17.2] with approximately 6 days [95% CI: 5.7–6.3] spent on average in the intensive care unit (ICU). Importantly, we observed that, compared to patients who did not have renal impermeant, those with renal impermeant spent on average 60% more time in the intensive care unit.
Conclusions: Considering that 80% of patients treated with antifungals in Romanian public hospitals did not have a lab test to confirm the fungal etiology, we can conclude that antifungals are often used in an ad-hoc manner. An optimal use of antifungal treatment in Romania and a decrease of ALoS can be achieved through the development of national guidelines on rapid diagnosis and early treatment of fungal infections.

P194 Fatal Cryptococcal Meningitis in Anon-HIV Infected Male with Documented Exposure Risk in Nigeria

Iriagbonse Osaigbovo 1,2 and Steven Igetei 2
  • 1 University Of Benin
  • 2 University of Benin Teaching Hospital
Objectives: To describe a fatal Cryptococcal Meningitis in an apparently immunocompetent patient with documented exposure risk.
Materials & Methods: A 28 year old Nigerian male was referred to our facility with recurrent frontal, throbbing headaches and vomiting of 7 weeks, fever of 1 week and irrational talk of a day’s duration. Headaches began insidiously, were of moderate to severe intensity, each episode lasting up to 18 h a day, affecting daily activities and transiently relieved by analgesics. Headaches worsened 2 weeks prior to presentation with associated diplopia and neck stiffness necessitating presentation at the referring centre. There was no history of psychoactive drug use or psychiatric illness nor recent travel to states in the well described meningitis belt. He was not diabetic and retroviral status was unknown. Antibiotics given at the referring centre did not improve clinical status hence the referral.
Lumbar puncture was done and CSF sent for microscopy, culture and sensitivity (M/C/S), GeneXpert and chemistry. Full blood count, electrolytes/urea/creatinine, retroviral screen, and random blood glucose were ordered.
Results: CSF M/C/S was blood stained so white cells were not reported. No organisms were seen on Gram stain. Cultures yielded no growth after 48 h. GeneXpert did not detect Mycobacterium tuberculosis. However, CSF protein was markedly elevated at 184.8 mg/dL; CSF glucose was low at 29 mg/dL with a concomittant random blood glucose of 127 mg/dL. The retroviral screen was non-reactive. Clinical microbiologist invited to review on day four considered cryptococcal meningitis. Serum cryptococcal antigen testing using non-routine IMMY CrAg strips placed on-site by the Medical Mycology Society of Nigeria for screening HIV patients returned positive. Archived CSF also tested positive. Culture plates were discarded after 48 h so speciation was not done.
Further probing revealed history of recent move to a house opposite a poultry 3 months before presentation. Patient took ill a month after the move. On day four review, patient was unable to perceive light. Bilateral lateral rectus palsy was noted. An assessment of complicated Cryptococcal Meningitis in an apparently immunocompetent adult was made.
Induction therapy was commenced with intravenous Amphotericin B 50 mg into 500 mL of 5% dextrose water over 3 h daily and intravenous Fluconazole 1.2 g daily. He deteriorated by day 7 with blood pressure of 170/110 mmHg and persistent tachycardia; ECG showed sinus tachycardia. Glasgow coma scale dropped from 13/15 to 7/15. An assessment of raised ICP was made and therapeutic lumbar puncture planned. However, he continued to deteriorate until his demise on the eight day.
Conclusions: Cryptococcal Meningitis in the immunocompetent is missed or diagnosis delayed in sub-Saharan Africa because of lack of diagnostic tools and a myopic, though justified focus on cryptococcal disease caused by HIV/AIDS. In this case, treatment was delayed due to low index of suspicion because of non-HIV status and failure to promptly elicit environmental exposure. Interdisciplinary collaboration and use of a simple but non-routine diagnostic test finally clinched diagnosis. Attention should be paid to the epidemiology of non-HIV cryptococcal disease and making diagnostic tests readily available in sub-Saharan Africa.

P195 The Impact of the COVID-19 Pandemic on the Frequency of Candidemia in a Tertiary Greek Hospital

Nikolaos Zapaniotis 1, Athanasios Kakasis 2, Angeliki Padazatou 1, Ioannis Delliolanis 1, Nikolaos Sipsas 2 and Maria Gamaletsou 2
  • 1 Microbiology Department, “Laiko” Athens General Hospital
  • 2 Pathophysiology Department, School of Medicine, National and Kapodistrian University of Athens
Objectives: To evaluate the possible impact of the COVID-19 pandemic on the incidence of candidemia in a tertiary hospital.
Methods: We retrospectively reviewed the Candida spp. isolates in blood cultures within the first year of the COVID-19 pandemic (March 2020 to February 2021) in comparison to the previous one-year period (March 2019 to February 2020). For that purpose we extracted data from the Microbiology Laboratory of “Laiko” Athens General Hospital. Duplicate blood culture results which were corresponding to the same patient were excluded.
Results: Overall, during the first year of the pandemic there were 47 Candida spp. isolates in blood cultures of which 25 (53.2%) were Candida parapsilosis, 16 (34.1%) Candida albicans, 4 (8.5%) Candida tropicalis, 1 (2.1%) Candida krusei and 1 (2.1%) Candida glabrata. During the preceding one-year period there were also recorded 47 Candida spp. blood culture isolates. These isolates were distributed as follows: 22 (46.9%) Candida albicans isolates, 12 (25.5%) Candida parapsilosis isolates, 7 (14.9%) Candida glabrata isolates, 4 (8.5%) Candida krusei isolates and 2 (4.2%) Candida tropicalis isolates. There is a significant increase (p = 0.006) in the number of Candida parapsilosis isolates during the pandemic period. These results can be overviewed in Figure 1.
Conclusions: There was no difference in the incidence of candidemia cases in our hospital during the first year of the COVID-19 pandemic compared to the previous one-year period. However, there is a significant change in Candida spp. distribution, notably a shift towards Candida parapsilosis. This finding could be due to a decline in the hospital’s infection control program, taking into consideration that Candida parapsilosis is associated with poor hand hygiene practices. Such findings underline the overwhelming impact of the pandemic which caused an increased workload on hospital staff.

P196 Head and Neck Manifestations of Paracoccidioidomycosis: A Retrospective Study of Histopathologically Diagnosed Cases in Southern Brazil

Maria Lúcia Scroferneker 1,2, Alessandra Koehler 1, Fábio Muradás Girardi 3, Leo Kraether Neto 4 and Paulo Cezar de Moraes 1
  • 1 Postgraduate Program in Medicine: Medical Sciences, Universidade Federal do Rio Grande do Sul
  • 2 Department of Microbiology, Immunology and Parasitology, ICBS, Universidade Federal do Rio Grande do Sul
  • 3 Integradet Oncology Center, Hospital Ana Nery
  • 4 Professor at Universidade de Santa Cruz do Sul (professor) and coordinator of the Bucal Diagnostic Project from Universidade de Santa Cruz do Sul
Objectives: Analyze the clinical and epidemiological characteristics of 28 cases of paracoccidioidomycosis (PCM) with head and neck manifestations from southern Brazil.
Materials & Methods: Retrospective analysis of cases of PCM with head and neck manifestations referred to two medical centers in the municipality of Santa Cruz do Sul, state of Rio Grande do Sul, during a 10-year period (2011–2020). The medical centers were the Hospital Ana Nery and the Dentistry Clinic of Universidade de Santa Cruz do Sul. All cases were histopathologically diagnosed. The following data were analyzed: year of diagnosis, age at diagnosis, gender, race, smoking habit, place of origin, schooling, anatomical sites of the lesions, evolution time of the symptoms, presence of cancer and other associated diseases and outcomes. Data analysis was carried out by descriptive statistics. Informed consent forms were obtained from all of the participants.
Results: Twenty-eight patients were selected. The number of cases remained stable during the analyzed period, ranging from one to four cases per year. However, in 2019, there was a considerable increase, with 11 diagnosed cases. Age at diagnosis ranged from 29 to 80 years. The predominant age range was between 40 and 59 years old, with 46% of the patients. In total, 21 (75%) were men and 7 (25%) were women, with the male:female ratio 3:1. Most were Caucasian (92%) and 46% were smokers. Patients were from 12 municipalities of the East Center region of the state of Rio Grande do Sul. Most of the patients (59%) had not finished elementary school. Regarding clinical characteristics, the two most common anatomical sites of the lesions were the soft palate and the larynx, both in six cases, followed by the lips (five cases) and the face skin (four cases). The evolution time of the symptoms was recorded only in ten cases. Among these, eight cases had evolution time between one and four months. A longer time (15 and 24 months) was observed only in two cases. The associated diseases recorded were hepatitis C, HIV, HIV plus pulmonary/ganglionic tuberculosis, diabetes mellitus (each one in one case) and hypertension (three cases). Associated squamous cell carcinoma was present in three cases. A total of three deaths occurred, but none of them was directly associated with PCM.
Conclusions: This is the first study to analyze PCM cases from the East Center region of the state of Rio Grande do Sul. The predominance of men aged between 40 and 59 years and smokers is according with the epidemiological data found in literature. However, we found a lower male:female ratio (3:1) than that usually reported (22:1). The occurrence of a greater number of cases in Caucasian individuals is according to a recent study that showed that white individuals are more affected by PCM. The large increase in cases diagnosed in 2019 is a data that deserves attention and is possibly associated with the climatic conditions of the period, when there were many droughts in the region. PCM is endemic to southern Brazil and differential diagnosis with granulomatous and neoplastic diseases must always be done.

P197 Epidemiological Aspects of Sporotrichosis in Brazil: A Study of 62 Cases in the State of Rio Grande do Sul

Maria Lúcia Scroferneker 1,2, Natália Andressa Buss Venier 3, Alessandra Koehler 1, Fernanda Brandão Pacheco 3 and Gerson Vettorato 3
  • 1 Postgraduate Program in Medicine: Medical Sciences, Universidade Federal do Rio Grande do Sul
  • 2 Department of Microbiology, Immunology and Parasitology, ICBS, Universidade Federal do Rio Grande do Sul
  • 3 Department of Dermatology of the Hospital Santa Casa de Misericórdia de Porto Alegre
Objectives: Analyze the clinical and epidemiological characteristics of 62 cases of sporotrichosis from southern Brazil.
Materials & Methods: Retrospective study of reports from the Mycology Laboratory located in the Dermatology Department of the Irmandade Santa Casa de Misericórdia Hospital Complex, Teaching Hospital of the Federal University of Health Sciences of Porto Alegre (UFCSPA), in the state of Rio Grande do Sul, in the southern region from Brazil, over a period of seventeen years, two months and 11 days. All patients, of all ages, who visited the mycology laboratory from 1 January 2002 until 11 March 2020, the date of the closure of the service, who had a positive result for Sporothrix sp. in the cultural mycological examination, obtained from scraping of skin lesions or fragment of lesions suggestive of sporotrichosis, were included.
Results: 62 patients were included, 34 male (54.83%) and 28 female (45.16%). The age ranged from 8 to 82 years, with an average of 46.43 years and a child of 8 years (1.6%). The number of cases per year was variable, with an average of 3.44 cases per year in the period from 2003 to 2020. The year of 2019 had the highest number of cases (n = 8) and the years 2018 and 2020 did not have diagnosed cases in the laboratory. The upper extremities were the most affected (67.74%), followed by the lower limbs (25.80%), and also affected the head and face, chest and buttocks (3.22%). Of the 62 patients, 69.35% were from the metropolitan region of Porto Alegre, with 16 patients from the city of Porto Alegre and the rest from cities in the metropolitan region. The second region with the highest number of patients was northwest with 6.45%, followed by southeast with 4.83%, southwest and eastern center, both with 3.22%. The northeast and central eastern regions of the state of Rio Grande do Sul had no reported cases. There is a record of the treatment instituted for only 10 patients, due to the exchange for eletronic medical records. Of these, 60% were treated with itraconazole, 30% with potassium iodide, 10% with amphotericin B and 10% had spontaneous resolution of the condition. Regarding comorbidities, 40% were healthy, 30% hypertensive, 20% with thyroid disease and 10% generalized anxiety disorder.
Conclusions: Sporotrichosis is the most prevalent subcutaneous mycosis worldwide, with acute and subacute clinical manifestations. In Brazil, most cases are reported in the South and Southeast regions. It affects men and animals, with an increase in the incidence of cases in recent years, receiving prominence from public health entities such as the World Health Organization and the Pan American Health Organization. Several factors are also known that can lead species of the genus Sporothrix to present resistance to antifungals, like mutations in cytochrome P450 monooxygenases. Therefore, epidemiological studies on sporotrichosis are essential.

P198 Clinical and Microbiological Findings Associated with RVVC among Women in Southern Nigeria

Samuel Adetona Fayemiwo 1,2, Lily Novak-Frazer 3, Isaac Folorunso Adewole 1 and Riina Rautemaa-Richardson 3,4
  • 1 College of Medicine, University of Ibadan
  • 2 Division of Infection, Immunity and Respiratory Medicine, Faculty of Biology, Medicine and Health, The University of Manchester, Manchester
  • 3 Division of Infection, Immunity and Respiratory Medicine, School of Biological Sciences, NIHR Manchester Biomedical Research Centre (BRC) at the Manchester Academic Health Science Centre, The University of Manchester
  • 4 Manchester University NHS Foundation Trust, Wythenshawe Hospital
Objectives: Vulvovaginal candidosis (VVC) is a common vaginal inflammatory disease in women of childbearing age and is mainly caused by opportunistic Candida species. Recurrent vulvovaginal candidosis (RVVC) is defined by a history of four or more acute inflammatory and culture-positive symptomatic episodes of VVC in 12 months. The signs and symptoms of VVC are non-specific and many other infectious or non-infectious conditions can present similarly and/or concomitantly. This study aimed to determine some epidemiological, clinical and microbiological features of RVVC and association with other co-infections among women of childbearing age in southern Nigeria.
Materials & Methods: A population-based prospective cross-sectional study was conducted across three states in the southern geopolitical zones of Nigeria (southeastern Nigeria, southsouthern Nigeria and southwestern Nigeria). A total of 585 participants, aged 18 to 55 years and with or without vulvovaginal symptoms at the time, were recruited from urban and rural areas in two randomly selected local government areas (LGAs) within the geopolitical zones. Patient histories were collected using a structured interview form. High vaginal swabs were collected from the sides of the vaginal wall to screen for the presence of Candida spp. by culture and sexually transmitted organisms by PCR. The Quick-DNA mini–Prep ZYMO extraction kits and the CFX-96 Real-time PCR using the AllplexTM Assay system (Seegene, Seoul, Korea) were used for the PCR. Data were analysed using SPSS version 25.0.
Results: The mean age of the participants was 35 years (range 18–55). Three-quarter (75.7%; 443/585) were married and their mean age of sexual debut was 19 years (Range 9–37). At the time of enrolment, two-thirds (66.5%) of the participants reported two or more vulval symptoms. The highest incidence was in southeastern Nigeria (P = 0.001). The prevalence of women with a history of RVVC was 23.1%, and 30.4% (41/135) of these had one or more Candida species isolated at enrolment. The prevalence of VVC in this study was 20.7%, while 6.3%. of them had asymptomatic vaginal Candida colonisation. Five Candida species were isolated from participants of any form of VVC: C. albicans (75.3%) followed by C. glabrata (12.0%), C. krusei (8.9%), C. tropicalis (3.2%) and C. ciferrii (0.6%). Other infections included bacterial vaginosis (BV) (43.6%), Trichomoniasis (13.0%), Chlamydia trachomatis (0.7%), Mycoplasma genitalium (1.4%), Hepatitis B infection (4.1%) and HIV infection (3.8%). In the multivariate analysis, there was no significant association between the Candida species isolated, vaginal colonisation and the likelihood of RVVC (P > 0.05). However, the odds ratio of 1.6 for current VVC (1.1–2.6) 95%CI; P = 0.028) and BV (OR (95%CI) = 1.6 (1.1–2.6); P = 0.027) were significantly associated with the increased risk of RVVC, respectively.
Conclusions: RVVC is common in Nigeria, and there are no significant regional differences in their aetiology and epidemiology. Candida albicans remains the main causative agent in all geopolitical zones in Nigeria. However, other concomitant infections were common in the study population.

P210 Invasive Aspergillosis in Adult ICU Patients

Olga Shadrivova 1, Nikolay Klimko 1, Evgeniia Zaytseva 1, Alisa Volkova 2, Marina Popova 2, Yulia Chudinovskikh 3, Marina Lebedeva 4, Andrey Saturnov 5, Olga Uspenskaya 5, Mariya Penkova 5, Svetlana Ignatyeva 1, Tatiyana Bogomolova 1 and Lyudmila Zubarovskaya 2
  • 1 North-Western State Medical University Named After I.I. Mechnikov
  • 2 I. Pavlov First Saint Petersburg State Medical University
  • 3 The Federal State Budget Institution «N.N. Petrov Research Institute of Oncology» of the Ministry of Public Health of Russian Federation
  • 4 State Budgetary Healthcare Institution “Saint-Petersburg Clinical Scientific and Practical Center for Specialised Types of Medical Care (Oncological)”
  • 5 Leningrad Regional Clinical Hospital
Objectives: Analysis of risk factors, aetiology, clinical features, treatment and survival rates in ICU patients with invasive aspergillosis (IA).
Materials & Methods: Retrospective analysis of data from 110 adult ICU patients with IA was conducted. The following criteria were used for diagnosis: EORTC/MSGERC (2019), ECMM/ISHAM (2020), and clinical algorithm AspICU (S. Blot, 2012). Group I—43 non-hematological patients, median age—63 (19–99), females—44%. Group II—67 hematological patients, 47 (18–75) years, females—34%.
Results: In non-hematological patients, IA more often developed against the background of severe COVID-19 or influenza (42% vs. 6%, p = 0.005), decompensated diabetes mellitus (35% vs. 7%, p = 0.006), acute or chronic renal failure (23% vs. 8%, p = 0.04). Other underlying conditions in the non-hematological group were autoimmune diseases—21%, malignant neoplasms—12%, heart and vascular diseases—7%, severe pneumonia—5%, primary immunodeficiency—2%; in hematological patients-lymphomas—43%, acute leukemias—42%, chronic leukemia—6%, aplastic anemia—6%, and multiple myeloma—3%. Common risk factors for the IA development in the ICU patients were the use of systemic steroids (72% vs. 78%), prolonged lymphocytopenia (80% vs. 82%, median—18 days in both groups), and immunosuppressive therapy (28% vs. 25%). Severe neutropenia was detected predominantly in hematological patients with IA (5% vs. 70%, p = 0.0001). Other risk factor in the hematological cohort was hematopoietic stem cell transplantation (24%).
The main sites of IA were lungs (100% vs. 97%). Dissemination of infection with ≥2 organs involvement (9% vs. 18%) and central nervous system involvement (4% vs. 12%) were more often diagnosed in hematological patients. In non-hematological patients, most severe clinical symptoms of IA were noted: fever (100% vs. 76%), respiratory failure (95% vs. 77%, p = 0.001), hemoptysis (37% vs. 13%, p = 0.01), cough (86% vs. 66%, p = 0.007) and chest pain (52% vs. 13%, p = 0.0003).
In non-hematological patients, cavities of destruction on CT scan more often registered (51% vs. 9%, p = 0.0001), the “halo” symptom was determined in hematological patients (9%). Aspergillus spp. positive culture was received in 67% and 45%, p = 0.03. The main etiology agents of IA were A. fumigatus (59% vs. 50%), A. niger (23% vs. 22%), and A. flavus (18% vs. 16%). In both groups, the most commonly used drug was voriconazole (90% vs. 82%). The overall 12-week survival rate of ICU patients with IA was low (55% vs. 45%).
Conclusions: In ICU patients, the main risk factors for IA development were steroid use (72% vs. 78%), lymphocytopenia (80% vs. 82%), neutropenia (5% vs. 70%, p = 0.0001) and immunosuppressive therapy (28% vs. 25%). Causative agents are A. fumigatus (59% vs. 50%), A. niger (23% vs. 22%) and A. flavus (18% vs. 16%). The main sites of infection were lungs (100% vs. 97%). Fever (100% vs. 76%), respiratory failure (95% vs. 77%) and haemoptysis (37% vs. 13%) are characteristic. The overall 12-week survival rate of ICU patients with IA was low (55% vs. 45%).

P211 Aspergillus spp. Isolation in COVID-19 Critical Patients during Second, Third and Fourth Pandemic Waves in a Tertiary Hospital in Madrid

Federico Becerra-aparicio 1, María Cruz Soriano-Cuesta 2, Jesús Fortún 3, Juan de Dios Caballero 1,4, Daniel Marcos-Mencía1, Rafael Cantón 1,4 and Elia Gómez G. de la Pedrosa 1,4
  • 1 Servicio de Microbiología, Hospital Ramón Y Cajal-IRYCIS
  • 2 Servicio de Medicina intensiva, Hospital Ramón y Cajal
  • 3 Servicio de Enfermedades Infecciosas, Hospital Ramón y Cajal
  • 4 Red Española de Investigación en Patología Infecciosa (REIPI)
Objectives: To assess the prevalence and the microbiological characteristics of Aspergillus spp. isolates prospectively recovered from respiratory samples of non-immunocompromised patients admitted to the intensive care units (ICUs) in our institution during the period of the second, third and fourth COVID-19 pandemic waves in Madrid.
Materials & Methods: All Aspergillus spp. isolates recovered from COVID-19 patients admitted to the different ICUs in our hospital from one or more lower respiratory samples from September 2020 to May 2021 were included. Species identification was performed by microscopic visualization and MALDI-TOF MS (MALDI Biotyper®, Bruker Daltonik, Bremen, Germany) analysis using both Bruker (MBT Filamentous Fungi Library 3.0) and MSI online databases (species identification threshold >20 and >2 respectively). Antifungal susceptibility to amphotericin B and voriconazole of first isolate per species and patient was assessed by gradient strips (Liofilchem, Teramo, Italy). Galactomannan (GM) testing was performed using Platelia Aspergillus (BioRad Laboratories, Marnes-la-Coquette, France; cut-off ≥0.5 in serum and ≥1.0 in BAL) and 1,3-β-D-glucan (BDG) in serum was performed when required with the Wako β-glucan test (Fujifilm Wako Pure Chemical Corporation; cut-off = 11 pg/mL).
Results: Overall, 51 patients with 58 isolates were included (5/51 with 2 and 1/51 with 3 different species). Global prevalence during the study period was 8.3% (51/614). A total of 103 respiratory samples from these episodes yielded positive cultures, including 83 BAS, 15 BAL, 4 sputum and 1 tracheal aspirate. Aspergillus spp. growth in 2 or more samples was detected in 49% of patients (25/51). Most common species were A. fumigatus sensu stricto (60.3%, 35/58), A. flavus (10.3%, 6/58) and A. terreus (8.6%, 5/58). Other species were A. hiratsukae, A. nidulans (n = 2 each), A. citrinoterreus, A. calidoustus, A. lentulus, A. parasiticus, A. sublatus and A. tubingensis (n = 1 each). Discrepancies between Bruker and MSI identification were detected in 10 cases, 8 of them corresponding to Aspergillus cryptic species only identified using MSI database. BAL-GM was positive in 15/51 (29.4%) and 4/51 in serum samples (7.8%). BDG detection was assessed only in 3 cases with 1 positive result. Ten isolates (19.6%) showed in vitro high MIC values to amphotericin B (5 A. terreus, 3 A. flavus, 1 A. fumigatus and 1 A. nidulans, MIC > 32 mg/L) and only one isolate (1.9%) in the case of voriconazole (1 A. fumigatus sensu stricto, MIC > 32).
Conclusions: A high prevalence of isolation of different Aspergillus species among COVID-19 non-immunocompromised ICU patients (8.3%) was detected, including cryptic species. COVID-19 associated pulmonary aspergillosis could be assessed in 29.4% according to BAL-GM results. Moreover, in 11.7% cultures (6/51) more than one species were found, which also included cryptic species. Susceptibility studies revealed a high proportion of isolates displaying high MIC values to amphotericin B and voriconazole.

P212 A Novel Zebrafish Larva Model for Influenza-Associated Aspergillosis

Simon Feys 1,2, Jana Van Dycke 3, Cato Jacobs 2, Agustin Reséndiz Sharpe 4, Annelies Stevaert 3, Lieve Naesens 3, Katrien Lagrou 4,5, Joost Wauters 1,2 and Joana Rocha-Pereira3
  • 1 Department of Microbiology, Immunology and Transplantation, Laboratory for Clinical Infectious and Inflammatory Disorders, KU Leuven
  • 2 Medical Intensive Care Unit, UZ Leuven
  • 3 Department of Microbiology, Immunology and Transplantation, Rega Institute, Laboratory of Virology and Chemotherapy, KU Leuven
  • 4 Department of Microbiology, Immunology and Transplantation, Laboratory of Clinical Bacteriology and Mycology, KU Leuven
  • 5 Laboratory Medicine, UZ Leuven
Objectives: Influenza-associated pulmonary aspergillosis (IAPA) is a severe co-infection with high mortality rates, affecting critically ill influenza patients. Knowledge on the pathophysiology of IAPA is key to establish new diagnostic and therapeutic modalities, but is currently lacking. We aim to establish an infection model for influenza-associated aspergillosis using the transparent zebrafish larva. Its swimbladder has been validated as a model for the human alveolus at the anatomical, developmental and transcriptional level. Since zebrafish larvae do not possess an adaptive immune response yet, they are perfectly suited to investigate in