Next Article in Journal
Extracellular Phosphate Availability Impacts Aspergillus terreus Itaconic Acid Fermentation via Biomass-Specific Product Yield
Previous Article in Journal
Morpho-Phylogenetic Evidence Reveals Neokeissleriella gen. nov. and Three Novel Species of Lentitheciaceae from Grasses (Poaceae)
 
 
Correction published on 13 February 2026, see J. Fungi 2026, 12(2), 139.
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Diversity of Fungi Associated with Diseases of Cultivated Brassicaceae in Southern Italy

1
Department of Agricultural Sciences, Food, Natural Resources and Engineering (DAFNE), University of Foggia, Via Napoli 25, 71122 Foggia, Italy
2
Mendeleum–Institute of Genetics, Faculty of Horticulture, Mendel University in Brno, Valticka 334, 691 44 Lednice, Czech Republic
*
Authors to whom correspondence should be addressed.
J. Fungi 2026, 12(1), 13; https://doi.org/10.3390/jof12010013
Submission received: 13 November 2025 / Revised: 12 December 2025 / Accepted: 22 December 2025 / Published: 24 December 2025 / Corrected: 13 February 2026
(This article belongs to the Section Fungal Evolution, Biodiversity and Systematics)

Abstract

This study investigated the fungal species associated with symptomatic cultivated Brassica crops in Apulia, Southern Italy, during the 2022–2023 growing seasons. Twenty-two samples from Brassica oleracea var. botrytis, B. oleracea var. italica, and B. rapa var. cymosa showing stunting, wilting, necrotic spots, and lesions were analyzed using morphological and molecular analyses. A total of 259 fungal isolates were obtained, mainly belonging to the genera Alternaria, Plectosphaerella, Fusarium, and Sclerotinia, with Alternaria and Plectosphaerella being the most frequent. Microsatellite PCR (MSP-PCR) profiling revealed considerable genetic diversity within the Alternaria and Plectosphaerella genera, whereas Fusarium and Sclerotinia showed uniform profiles. Multilocus analyses (ITS, tef-1α, rpb2, Alt-a1, and gapdh) identified nine species as Alternaria alternata, A. brassicicola, A. japonica, Fusarium solani species complex, Plectosphaerella cucumerina, P. pauciseptata, P. plurivora, Sclerotinia sclerotiorum, and Stemphylium vesicarium. While Alternaria, Fusarium, and Sclerotinia species are well-known Brassicaceae pathogens, P. pauciseptata, P. plurivora, and S. vesicarium have been detected here for the first time on cultivated Brassica crops worldwide. These findings highlight significant intraspecific diversity among the detected fungi and expand the current knowledge of fungal diversity associated with symptomatic cultivated Brassica plants.

1. Introduction

The Brassica genus is the most significant among the 51 genera within the Brassicaceae family. It includes 37 species [1], many of which have edible leaves, roots, seeds, and stems, providing essential nutrients like vitamins, minerals, and dietary fiber [2]. These crops are also recommended for crop rotation and sustainable farming systems because they improve soil health and reduce reliance on chemical fertilizers [3]. The Brassica genus is native to the Mediterranean and Saharan regions, where the climate features consist of mild winters followed by hot and dry summers. However, many species within the genus have adapted well to colder growing conditions. Most of the 37 Brassica species are annual or biennial plants, ranging from weedy wild species to domesticated crops [4]. The most widely cultivated Brassica species include B. oleracea (e.g., cabbage, cauliflower, broccoli), B. rapa (e.g., turnip, Pak choi), and B. napus (e.g., canola, rapeseed) [5]. Worldwide, Brassicaceae crops are grown in a wide range of climates, from temperate to tropical areas, due to their adaptability and resilience. The leading countries in the production of Brassicaceae are China, India, the United States, and several European countries, each region focusing on different species based on local conditions and agricultural practices [5].
The economic weight of Brassicaceae in Italian agriculture is considerable. According to 2024 Istat data, the market value of Brassicaceae continues to rise due to increased yield efficiency and high demand. Apulia and Sicily have seen an expansion in Brassicaceae production, driven by both domestic consumption and growing export markets. These regions enjoy favorable climatic conditions, which enable year-round production and strengthen Italy’s position in European vegetable exports [6].
In particular, Apulia showed an increase in the cultivation of Brassica crops, especially in terms of the utilized agricultural area (UAA) and production values. The area dedicated to the cultivation of Brassicaceae, such as cabbage, cauliflower, and turnip tops, increased from 3850 hectares in 2023 to 4090 hectares in 2024, and in the same timespan, the yield increased from 23 to 28 tons per hectare [6]. Apulia is also one of the leading regions in Italy for the export of Brassica crops, with a substantial portion of the export to European markets significantly contributing to its own agricultural economy. Additionally, Apulia’s specialized crops, such as “broccoli di Cima di Rapa” (an ecotype of broccoli), are in high demand for both domestic consumption and international trade, further strengthening the region’s role in global vegetable markets [6].
Despite their agricultural importance, Brassica vegetables are susceptible to several severe diseases that need careful monitoring in order to avoid a significant impact on yield and quality [7]. Among the fungal diseases reported worldwide on cultivated Brassica crops are the dark leaf spot caused by Alternaria spp. [8,9,10,11,12,13], the anthracnose caused by Colletotrichum dematium [14], the powdery mildew caused by Erysiphe cruciferarum [7], the fusarium wilt caused by Fusarium spp. [15,16,17,18,19], the blackleg or phoma disease caused by Leptosphaeria maculans (syn. Phoma lingam) [20], the white leaf spot caused by Neopseudocercosporella capsellae [21,22,23], the root rot caused by Plectosphaerella cucumerina [24,25], the wirestem caused by Rhizoctonia solani [26,27,28], and the white mold disease caused by Sclerotinia sclerotiorum [29,30,31].
Among the most dangerous fungal species causing disease symptoms and severe impacts on yield and quality on cultivated Brassica plants, Alternaria, Fusarium, Leptosphaeria, Neopseudocercosporella, and Sclerotinia species are recognized as highly severe pathogens affecting all brassicaceous plants and especially cultivated ones.
The Alternaria genus is a group of fungi belonging to the Ascomycetes class that encompasses significant plant pathogens and saprophytes and commonly causes allergies in humans [32,33]. Currently, this genus is classified under Pleosporaceae, within the order Pleosporales (Dothideomycetes class) [34,35], and consists of over 360 recognized species, clustered into 29 sections. Its main host range includes various Brassica species such as cabbage (B. oleracea var. capitata), Chinese cabbage (B. campestris var. chinensis), cauliflower (B. oleracea var. botrytis), broccoli (B. oleracea var. italica), canola (B. napus), mustard (B. juncea), and wild-grown plants. Several reports confirm their occurrence worldwide across countries such as China [8], Ecuador [12], Italy [10], Kazakhstan [13], Japan [11], Papua New Guinea [36], Russia [37], and the USA [9]. Four species of Alternaria are mainly pathogenic to Brassica species, such as A. brassicae and A. brassicicola, followed by A. japonica and A. alternata [38]. Alternaria brassicae is more commonly associated with B. rapa and B. napus, while A. brassicicola is more commonly found on B. oleracea [39], which generally requires warmer conditions and a longer period for infection [40].
Fusarium yellows, commonly known as Fusarium wilt, is one of the most devastating diseases affecting cabbage and other crucifers. It results in significant losses in agricultural yield. Currently, this genus is classified under Nectriaceae, within the order Hypocreales (Sordariomycetes class), comprising over 80 globally distributed species, which exhibit a broad host range and rapid growth, leading to significant challenges to the production of canola (Brassica napus) and other crops [41]. Among Fusarium species, F. avenaceum [19], F. equiseti [15,18], F. oxysporum f. sp. conglutinans [16], F. oxysporum f. sp. raphani [17], F. solani species complex [42], and F. verticillioides [43] are the most abundantly reported on cultivated Brassica.
One of the most economically serious diseases of Brassica crops, particularly on oilseed rape, is the Blackleg disease, also known as Phoma stem canker, caused by the L. maculans species complex [44,45,46]. This disease is globally spread, with increased severity in regions such as Europe, Australia, and North America, which are characterized by high summer temperatures [47]. It was observed on the leaf, flower, and corymb of several Brassica species, such as turnip, Chinese cabbage, pak choi, oilseed rape, swede, and mustard. In the UK, Phoma stem canker of oilseed rape is the most economically important disease in Southern, Eastern, and Central England. Severe losses can occur in cauliflower and swede, but it is mainly a leaf blemish on other vegetable brassicas.
When leaf spots appear, the fungus remains latent until severe stem symptoms become visible. Moreover, this fungus can remain viable in the soil for many years after the initial disease report. Despite the introduction of cultivars with enhanced resistance, this pathogen still has a substantial economic impact [48].
Neopseudocercosporella capsellae (white leaf spot disease) represents a major threat to cruciferous crops, causing substantial yield losses under cool and wet conditions [49]. Recently, the prevalence of this pathogen has globally increased, and it is now recognized as a re-emerging disease affecting oilseed rape and oriental Brassica vegetables, particularly in the UK [50], the USA [51,52], and Australia [53,54]. This species exhibits a broad host range, including both wild and cultivated crucifers (vegetable brassicas and forage crops) [49].
Lastly, Sclerotinia sclerotiorum is a fungal species classified under the Sclerotiniaceae, within the order Helotiales (Leotiomycetes class), that has a host range exceeding 400 species [55]. In the Brassicaceae family, it is reported as the most important pathogen causing disease on the B. napus in China. This pathogen is abundantly widespread in Europe and North America too, especially in favourable moist conditions where it causes a soft stem rot. Over the last 10 years, this fungal species has been reported on cabbage [29,31] and broccoli too [30]. As it is the case with L. maculans, the pathogen can remain viable in the soil for many years after the initial disease report via the production of sclerotia. The pathogen is not only restricted due to causing problems in open fields but also affects postharvest conditions [40].
In Italy, few reports are available of fungal diseases on cultivated Brassicaceae. In particular, Siciliano et al. [56] reported five Alternaria species, namely, A. alternata, A. tenuissima, A. arborescens, A. brassicicola, and A. japonica on cabbage, cauliflower, wild (Diplotaxis tenuifolia), and cultivated rocket (Eruca sativa). Other reports only regarded wild and cultivated rockets. Indeed, Garibaldi et al. [24,57] reported A. japonica and, for the first time, P. cucumerina on cultivated rocket. Lastly, Gilardi et al. [58] reported, for the first time in Italy, Fusarium equiseti and Rhizoctonia solani as pathogens of wild and cultivated rocket.
Due to the increasing production and the utilized agricultural area (UAA) for the cultivation of Brassicaceae, and also taking into account the lack of available information on the spread of the fungal diseases, a detailed survey was carried out in Northern Apulia from 2022 to 2023 in several Brassica fields. The survey focused on some Brassica varieties, such as B. oleracea var. botrytis (cauliflower), B. oleracea var. italica (broccoli), B. oleracea var. italica (mugnoli), and B. rapa var. cymosa (turnip), showing different symptoms on stems, leaves, and corymbs. Therefore, it aimed to characterize fungal diversity associated with symptomatic cultivated Brassica plants by morphological and molecular tools.

2. Materials and Methods

2.1. Sampling and Fungal Isolation

During the 2022–2023 growing seasons, 22 symptomatic samples consisting of stems, leaves, and corymbs were collected from distinct Brassicaceae species (4 samples of B. oleracea var. botrytis, 13 samples of B. oleracea var. italica, and 5 samples of B. rapa var. cymosa) from cultivated crops in three different areas of Foggia province, Apulia (Southern Italy) (Table S1).
For each sample collected, the disease incidence (DI) and disease severity (DS) were assessed (Table S1). The DI was calculated as a proportion of a number of plants showing symptoms divided by the total number of plants observed according to the following formula:
D I   ( % ) = N u m b e r   o f   d i s e a s e d   p l a n t s T o t a l   n o .   o f   p l a n t s   o b s e r v e d × 100
The disease severity was calculated, using a pathometric scale of 0–5, where 0 = no symptoms observed; 1 = 1–20%; 2 = 21–40%; 3 = 41–60%; 4 = 61–80%; and 5 = 81–100% of tissue surface showing symptoms. The overall disease severity (DS) was calculated according to the following formula:
D S = N .   o f   i n f e c t e d   p l a n t s   ×   v a l u e s   o f   s c o r e s T o t a l   n o .   o f   c a s e s
The symptoms observed consisted of plant stunting and wilting, leaf yellowing, and necrotic concentric spots, with or without a chlorotic halo, irregular dark spots on the corymb, elongated dark brown/black lesions on the stem, water-soaked lesions with white fluffy mycelia, and black sclerotia on the corymb (Figure 1).
Subsequently, after disinfection, the samples were transported to the laboratory for mycological analyses, according to the protocol of Fisher et al. [59], by lowering the percentage of the sodium hypochlorite solution from 5% to 2%. Five small tissue portions were placed on a potato dextrose agar (PDA, Sigma-Aldrich, Milan) medium supplemented with 500 mg L−1 of streptomycin sulphate (Oxoid Ltd.) and incubated for 7 days at 25 ± 3 °C. The morphological and culture features were preliminarily used to attribute the fungal genera [60,61,62,63]. All fungal colonies morphologically similar to Alternaria, Fusarium, Plectosphaerella, and Sclerotinia species were grown until they sporulated; then, a conidial suspension or hyphal tips were spread on water agar (WA) plates. After 24–36 h of incubation, single germinated propagules were transferred to fresh plates of PDA. The isolation frequency (IF; %) per Brassicaceae cultivar was calculated as the number of tissue portions infected by a given fungus divided by the subtotal number of tissue segments incubated and expressed as percentages:
I F = N .   o f   i n f e c t e d   t i s s u e s   b y   f u n g u s T o t a l   N .   o f   t i s s u e s   a n a l y z e d × 100
The single-spore (monoconidial) isolates are maintained in the culture collection of the Department of Agricultural Sciences, Food, Natural Resources, and Engineering (DAFNE) of the University of Foggia, Italy.

2.2. DNA Extraction

From the above-described isolation technique, 259 fungal strains were collected and preliminarily attributed to different taxa on the basis of morphological features. A selection of 142 fungal strains attributed to four of the most numerous taxa collected, that is to say, Alternaria (53), Plectosphaerella (47), Fusarium (25), and Sclerotinia (17) genera, was subjected to further analyses. These latter strains, grown on PDA for 7 days, were subjected to genomic DNA extraction according to Carlucci et al. [64].

2.3. MSP-PCR Analysis and Molecular Characterization

All fungal strains (142) of each above-mentioned genus were separately screened by the M13 minisatellite primer (5′-GAGGGTGGCGGTTCT-3′) [65]. The (MSP)-PCR profiles were generated according to Santos and Phillips [66]. The DNA banding patterns of Alternaria, Plectosphaerella, Fusarium, and Sclerotinia strains were analyzed through the BIONUMERICS v.5.1 software (Applied Maths, Sint-Martens-Latem, Belgium) by calculating Pearson’s correlation coefficient, and the unweighted pair group method analysis (UPGMA) was calculated by arithmetic means. The reproducibility levels were calculated by comparing the banding profiles obtained for the M13 primer. To this purpose, 10% of the strains were chosen at random from all clusters, and their profiles were analyzed again.
Based on MSP-PCR profiles, representative strains of the Alternaria (27), Plectosphaerella (15), Fusarium (5), and Sclerotinia (5) groups were chosen for further molecular characterization and phylogenetic analysis.
The internal transcribed spacer (ITS) of the ribosomal DNA region of 52 fungal strains (27 Alternaria, 15 Plectosphaerella, 5 Fusarium, and 5 Sclerotinia) was amplified by PCR through the universal primers ITS1 and ITS4, according to White et al. [67]. Based on ITS sequence analysis, 23 strains were identified as belonging to the Alternaria genus. These strains were subjected to the amplification of fragments from three genes: the translation elongation factor 1-alpha (tef-1α), the Alternaria major allergen gene (Alt-a1), and the second largest subunit of RNA polymerase II (rpb2). The respective primers used for the amplification were EF1-728F/EF1-986R as described by Carbone and Kohn [68], Dir5cAlta1–Inv4Alta1 as described by Pavòn et al. [69], and fRPB2-5f2/fRPB2-7c, as described by Sung et al. [70] (Table 1). The remaining four strains within the Alternaria group were identified as belonging to the Stemphylium genus. These strains were subjected to the amplification of glyceraldehyde-3-phosphate dehydrogenase (gapdh) using the primers gpd1/gpd2 according to Berbee et al. [71] (Table 1).
For the Plectosphaerella strains, fragments of translation elongation factor 1-alpha (tef-1α) and RNA polymerase II’s second largest subunit (rpb2) genes were also amplified by means of primer sets EF1-983F/EF1-2218R and RPB2-5F2/RPB2-7cR according to Giraldo et al. [72] (Table 1).
For the Fusarium strains, a fragment of the translation elongation factor 1-alpha gene (tef-1α) was amplified through the primer set EF1/EF2 according to O’Donnell et al. [73] (Table 1).
The PCR amplifications were performed utilizing G2 Flexi DNA polymerase (Promega, Madison, WI, USA), thus following the protocols described in Table 1. The resulting products were purified by means of NucleoSpin Gel and the PCR Clean-up Kit (Macherey-Nagel, Düren, Germany), following the manufacturer’s protocol. Subsequently, the purified products were sequenced from both ends by using the Sanger method at Eurofins Genomics (Ebersberg, Germany).
Table 1. Primers and PCR conditions used in this study.
Table 1. Primers and PCR conditions used in this study.
LocusPrimerPrimer DNA Sequence 5′→3′PCR ConditionsReference
ITSITS1TCCGTAGGTGAACCTGCGG94 °C–3 min; [94 °C–30 s, 55 °C–30 s, 72 °C–30 s] × 35; 72 °C–10 min.[67]
ITS4GCTGCGTTCTT ATCGATGC
tef-1αEF1-728FCATCGAGAAGTTCGAGAAGG94 °C–3 min; [94 °C–30 s, 58 °C–30 s, 72 °C–30 s] × 35; 72 °C–10 min.[68]
EF1-986RTACTTGAAGGAACCCTTACC
EF-983FGCYCCYGGHCAYCGTGAYTTYA94 °C–5 min; [94 °C–45 s, 54 °C–45 s, 72 °C–60 s] × 36; 72 °C–10 min.[74]
EF-2218RATGACACCRACRGCRACRGTYT
EF1ATGGGTAAGGARGACAAGAC94 °C–3 min; [94 °C–60 s, 53 °C–60 s, 72 °C–120 s] × 35; 72 °C–10 min.[73]
EF2GGARGTACCAGTSATCATGTT
Alt-a1Dir5cAlta1GAGAACAGCTTCATGGACTTCTCTTT94 °C–1 min; [94 °C–30 s, 55–30 s, 72 °C–45 s] × 35; 72 °C–5 min.[69]
Inv4Alta1CGCGGCAGTAGTTGGGAA
rpb2fRPB2-5f2GAYGAYMGWGATCAYTTYGG94 °C–2.3 min; [94 °C–60 s, 50–53 °C–30 s, 72 °C–120 s] × 35; 72 °C–10 min.[70]
fRPB2-7cRCCCATRGCTTGYTTRCCCAT
gapdhgpd1CAACGGCTTCGGTCGCATTG96 °C for 2.00 min, followed by 30 cycles of denaturation at 96 °C for 60 s, annealing at 48 °C for 1 min, and elongation at 72 °C for 45 s. With each cycle, the time at 72 °C was extended by 4 s. Usually, the products from the first amplification were purified and then reamplified with the same primers using another 25 PCR cycles like the initial 30 but with 54 °C of annealing temperature.[71]
gpd2GCCAAGCAGTTGGTTGTGC

2.4. Phylogenetic Analyses

Newly generated DNA sequences, together with those retrieved from GenBank (Table 2 and Table S2), were subjected to phylogenetic analyses in order to identify the Alternaria strains. The dataset of each gene was aligned separately by using the MAFFT v. 7, and the alignment obtained was manually checked and edited, when necessary, using Geneious Prime® (v.2023.0.1., Biomatters Ltd., Auckland, New Zealand). A concatenated dataset was built in Sequence Matrix v.1.8 [75], and the missing information sites were denoted by a question mark. The combined dataset (ITS, tef-1α, Alt-a1, and rpb2) was subjected to maximum likelihood (ML) and Bayesian inference analyses (BI).
Maximum likelihood analysis was performed using IQ-TREE 2 software (Minh et al., 2020 [76]), running 1000 bootstrap replicates. The best-fit evolutionary model for each locus was calculated automatically by IQ-TREE 2 according to the Akaike Information Criterion (AIC). The BI analyses were performed by MrBayes v. 3.2.7 [77,78]. The analyses included four parallel runs of 50 million generations starting from a random tree topology, every 1000 generations were sampled, and the first 25% of the trees were discarded as the “burn-in”. The most suitable substitution model for the BI analyses was determined separately for each locus using jModelTest version 2.1.7 [79]. The trees were visualized in iTOL v. 6.7 [80] and edited in Adobe Illustrator CC 2019. The resulting trees of both methods shared a similar topology; thus, we decided to present ML trees with support values of both methods—bootstrap (BS) and posterior probabilities (pp)—labelled at the nodes.
The consensus sequences of the ITS and the gapdh obtained, together with those retrieved from GenBank (Table 2 and Table S2), were subjected to phylogenetic analyses in order to identify the Stemphylium strains. All Stemphylium sequences were manually concatenated and aligned using MAFFT v.7 (http://mafft.cbrc.jp/alignment/server/, accessed on 26 March 2025) [81]. The alignments were visually checked and manually improved where necessary. Multigenic analyses, according to maximum likelihood and maximum parsimony, were carried out for the ITS and the gapdh genes of the Stemphylium sequence data. The maximum likelihood analysis was performed using IQ-TREE 2 software [76], running 1000 bootstrap replicates. The best-fit evolutionary model for each locus was calculated automatically by IQ-TREE 2 according to the Akaike Information Criterion (AIC). The maximum parsimony analyses were performed using PAUP, version 4.0b10 [82], through the heuristic search option with 100 random taxa additions, and tree bisection and reconstruction were used as the branch swapping algorithm. Branches of zero length were collapsed, and all multiple equally parsimonious trees were saved. Bootstrap support values were calculated from 1000 heuristic search replicates and ten random taxon additions. The tree length (TL), the consistency index (CI), the retention index (RI), the homoplasy index (HI), and the rescaled consistency index (RC) were calculated for each of them, and the resulting trees were visualized in TreeView, version 1.6.6 [83]. Alignment gaps were treated as missing data. The final trees were selected among the suboptimal trees from each run by comparing the likelihood and bootstrap scores. Alternaria abundans (CBS 534.83) and A. breviramosa (CBS 121331) were used as outgroups in the multigenic analysis.
Newly generated DNA sequences, together with those retrieved from GenBank (Table 2 and Table S2), were subjected to phylogenetic analyses in order to identify the Plectosphaerella strains. All Plectosphaerella sequences were manually concatenated and aligned using MAFFT v.7 (http://mafft.cbrc.jp/alignment/server/, accessed on 30 July 2025) [81]. The alignments were visually checked and manually improved, where necessary. Multigenic analyses of the ITS, tef-1α, and rpb2 genes of the Plectosphaerella sequence data were carried out as described for the Stemphylium strains. Gibellulopsis serrae and G. fusca were used as outgroups in the multigenic analysis.
In order to identify the Fusarium strains, the consensus sequences of ITS and tef-1α obtained were exported as a fasta file for the BLASTn analysis. Two web-accessible DNA sequence databases recommended for conducting BLASTn queries to identify that Fusarium spp. were used: FUSARIOID-ID by the Westerdijk Fungal Biodiversity Institute, which is publicly available through a web browser (https://www.fusarium.org/page/ID, accessed on 19 June 2025), and the non-redundant NCBI nucleotide collection (i.e., GenBank + EMBL + DDBJ + PDB + RefSeq sequences; http://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 19 June 2025) [84].
Lastly, in order to identify the Sclerotinia strains, the consensus sequences of ITS were exported as a fasta file for use in the BLASTn analysis. The consensus sequence was compared with those available in the GenBank database using the Basic Local Alignment Search Tool (BLAST, http://www.ncbi.nlm.nih.gov/, accessed on 24 March 2025) to confirm the preliminary morphological identification and ascertain sequence similarity searches.

3. Results

3.1. Fungal Isolation

The data related to the surveys carried out on 22 samples of Brassicaceae from two different Apulian provinces are summarized in Table 3. A total of 282 strains were collected; 23 of them were attributed to opportunistic bacteria, while the other 259 strains, by preliminary morphological characterization, were identified as the representatives of different fungi. The Alternaria group (number of strains [N] = 53; IF = 16.0%) and the Plectosphaerella group (N = 47; IF = 14.2%) were the most frequently isolated fungi, followed by the Fusarium group (N = 25; IF = 7.6%) and the Sclerotinia group (N = 17; IF = 5.2%). Other fungal species, such as Aspergillus spp., Epicoccum spp., and Penicillium spp., were isolated at IFs from 10.0% to 14.5%.

3.2. Microsatellite PCR Profiles and Molecular Characterization

Microsatellite PCR profiles were analyzed to select the representative isolates for subsequent molecular analyses. The MSP-PCR dendrogram of the 53 strains belonging to the Alternaria group revealed 11 clades, with a reproducibility level of 78% (Figure 2), allowing the identification of distinct groups from which representative strains were chosen. The MSP-PCR dendrogram of the 47 Plectosphaerella strains revealed three clades, with a reproducibility level of 73% (Figure 3), providing a tool for selecting strains showing different fingerprint diversity. Lastly, the MSP-PCR analysis of the 25 Fusarium and the 17 Sclerotinia strains revealed only one microsatellite pattern profile for each group; therefore, the MSP-PCR dendrogram was not generated for these two groups. Specifically, a subset of 27 representative strains of the Alternaria group, a subset of 15 representative strains of the Plectosphaerella group, a subset of five representative strains of the Fusarium group, and a subset of five representative strains of the Sclerotinia group were chosen for in-depth molecular characterization and phylogenetic analysis.

3.3. Molecular Identification of Representative Isolated Fungi

The ITS, tef-1α, Alt-a1, and rpb2 sequences were obtained for the 23 Alternaria strains selected from the MSP-PCR profiles, and these were aligned with sequences retrieved from GenBank. The dataset consisted of sequences from 148 taxa, which included the outgroup taxa Stemphylium herbarum (CBS 191.86).
After the alignment and exclusion of incomplete portions at either end, the dataset consisted of 1841 characters, including alignment gaps. Among these, 1123 were constant, and 172 were variable and parsimony-uninformative. The detailed results for each individual gene dataset, along with the corresponding models used, can be found in Table 4.
The ML/BI analyses (Figshare: https://figshare.com/s/1ec6360c15ca44c54f54, accessed on 18 July 2025; Figure 4) placed 11 strains in the Alternaria section Alternata. These 11 strains formed three clusters closely related to reference strains of A. alternata. Five strains (3Bs, 10BA, 4BD, ALT4, and 3BD) formed a sister clade to a cluster containing three A. alternata strains (CBS 620.83, CBS 15431, and EGS 34-015).
Three strains (2AR, ALT1, and 6BB) were placed among the ex-type strain (CBS 916.96) and four other A. alternata strains (CBS 175.52, YL2, YL1, and CBS 118814). The remaining three strains (C1, C5, and 3AA) formed a clade between the two aforementioned A. alternata clusters. In addition to the strains placed in the Alternaria section Alternata, three isolates (10AC, 7AD, and 2AC) were displayed in the Alternaria section Brassicola and formed a fully supported clade with the ex-type strain of A. brassicicola (CBS 118699). Furthermore, another strain (1BB) was placed in the Alternaria section Japonicae, clustering with five strains of A. japonica (CBS 118390, AC97, AC96, MAFF 246775, and AC73) and the ex-type of A. nepalensis (CBS118700). Eight strains were identified as Alternaria sp. within the Alternaria section Infectoriae. One strain (4BA) formed a fully supported clade closely related to a cluster containing four known species: A. arbusti (CBS 596.91), A. roseogrisea (CBS 121921), A. oregonensis (CBS 542.94), and A. incomplexa (CBS 121330). One strain (10BB) formed a sister branch to the ex-type of A. fimeti (FMR 17110). Four strains (3BG, 5A, 2C, and 10AA) formed a clade closely related to a cluster containing three ex-type strains: A. ventricosa (CBS 121546), A. triticina (CBS 763.87), and A. pseudoventricosa (FMR 17060). Finally, two strains (7AC and 4BB) were placed in a sister clade to the ex-type strain of A. montsantina (FMR 17060).
The ITS and gapdh sequences were generated for four Stemphylium strains selected from the MSP-PCR profiles, and these were aligned with sequences retrieved from GenBank (Table 2 and Table S2). Detailed results for each individual gene of the combined dataset, along with the corresponding models used, can be found in Table 4 The combined dataset consisted of sequences from 30 taxa, which included the outgroup taxa Alternaria abundans (CBS 534.83) and A. breviramosa (CBS 121331). After the alignment and exclusion of incomplete portions at either end, the dataset consisted of 1146 characters, including alignment gaps. Among these, 947 were constant, and 17 were variable and parsimony-uninformative. Maximum parsimony analysis of the remaining 182 parsimony-informative characters resulted in four most parsimonious trees (TL = 250; CI = 0.880; RI = 0.925; RC = 0.814; HI = 0.120). Maximum likelihood analysis produced a tree with similar topology (Figshare: https://figshare.com/s/1ec6360c15ca44c54f54, accessed on 18 July 2025; Figure 5). The MP/ML analyses (Figure 5) placed the four Stemphylium strains (3BA, 6B, 7C, and 7DB) in a well-supported clade with the ex-type sequences of S. vesicarium (CBS 191.86).
The ITS tef-1α and rpb2 sequences were generated for 15 Plectosphaerella strains selected from the MSP-PCR profiles, and these were aligned with sequences retrieved from GenBank (Table 2 and Table S2). The detailed results for each individual gene of the combined dataset, along with the corresponding models used, can be found in Table 4. The combined dataset consisted of sequences from 44 taxa (Table 2 and Table S2), which included the Gibellulopsis serrae (CBS 387.35) and G. fusca (CBS 120.818) outgroup taxa. After the alignment and exclusion of incomplete portions at either end, the dataset consisted of 2562 characters, including alignment gaps. Among these, 1918 were constant, and 179 were variable and parsimony-uninformative. Maximum parsimony analysis of the remaining 465 parsimony-informative characters resulted in one most parsimonious tree (TL = 1629; CI = 0.558; RI = 0.769; RC = 0.429; HI = 0.442). Maximum likelihood analysis produced a tree with similar topology (Figshare: https://figshare.com/s/1ec6360c15ca44c54f54, accessed on 18 July 2025; Figure 6). The MP/ML analyses (Figure 6) placed six strains (1C, 2AE, 5AF, 6BC, 10AE, and C1AB) in a clade with the ex-type strain of P. pauciseptata (CBS 131745), three strains (16A, 18D, and 21A) in a well-supported clade with the ex-type strain of P. plurivora (CBS 131742), and four strains (6F, 10E, 13B, and 15F) and two other strains (2EF, 12B) in two sister well-supported clades with the ex-type of P. cucumerina (CBS 137.37) and the neotype of P. cucumerina (CBS 137.33).
The ITS and tef-1α sequences of the five Fusarium strains (1F, 3F, 4FG, 5E, and 7GA), analyzed in GenBank by the BLAST tool and by the FUSARIOID-ID database, showed the following similarity rates from 99.65% to 99.84% with several reference strains belonging to the Fusarium solani species complex (FSSC) (syn. Neocosmopora solani) (CBS 112101; NRRL 32737; NRRL 44924; NRRL 46643; CBS 111722; CBS 117149, NRRL 32484; NRRL 53511).
The ITS sequences of the five Sclerotinia strains (2F, 5CD, 13F, 16D, and 18E) analyzed in GenBank by the BLAST tool showed a similarity rate of 100% with the Acc. numbers of S. sclerotiorum (OR527163, OR527175, OP164567, KY073614, ON506022, OR527174, KY073612, ON830716, MK828201, KT369007, MH137960, KX184720, and ON506026).
On the basis of the data obtained from MSP-PCR and phylogenetic analyses, it was possible to tentatively assign the percentages of isolation for each of the above-mentioned species in terms of isolates in total. In particular, the species belonging to the Alternaria group tentatively consisted of Alternaria alternata (N = 21; IF = 6.4%), A. brassicicola (N = 8; IF = 2.4%), Alternaria sp. (N = 16; IF = 4.8%), and Stemphylium vesicarium (N = 7; IF = 2.1). The species belonging to the Plectosphaerella group tentatively consisted of P. cucumerina (N = 20; IF = 6.1%), P. pauciseptata (N = 18; IF = 5.5%), and P. plurivora (N = 9; IF = 2.7%). The species belonging to the Fusarium and Sclerotinia groups tentatively consisted of F. solani species complex (N = 25; IF = 7.6%) and S. sclerotiorum (N = 17; IF = 5.2%) species, respectively (Table 3).

4. Discussion

The present study investigates the occurrence and distribution of various fungal species associated with symptomatic cultivated Brassica plants in Apulia (Southern Italy). Although Aspergillus, Epicoccum, and Penicillium species exhibited higher IFs than Fusarium and Sclerotinia species, they were not considered associated with the symptoms observed. This observation is consistent with previous reports identifying these genera as predominantly saprophytic fungi [85,86,87].
The use of the MSP-PCR technique to screen the remaining 142 isolates of Alternaria, Plectosphaerella, Fusarium, and Sclerotinia species successfully revealed genetic variability among strains isolated from cauliflower, broccoli, turnip, and “mugnoli” plants. This approach grouped the strains into eleven main clades for the Alternaria-like strains, three clades for the Plectosphaerella-like strains, and a single clade for each of the Fusarium and Sclerotinia groups, thus permitting us to focus subsequent multigenic analyses on 52 selected representative strains. On the basis of the ITS results of the 52 strains, further analysis by multigenic approaches tailored a specific taxonomic resolution of each fungal taxon.
The phylogenetic analysis of the 27 Alternaria-like strains revealed that 23 of them belonged to the Alternaria genus; four other strains were identified as members of the Stemphylium genus. The 23 Alternaria strains clustered into four distinct Alternaria sections. The members of the Alternaria genus are recognized globally as primary responsible agents for some of the most economically significant diseases in Brassicaceae crops [88]. The major pathogenic species commonly reported in cultivated Brassica include A. brassicae and A. brassicicola, followed by A. raphani and A. alternata [38,89]. These pathogens are known to cause substantial yield losses, particularly in B. oleracea, and as a consequence, they have considerable economic importance. Humpherson-Jones [39] further noted a host-specific pattern, A. brassicae being more frequently associated with B. rapa and B. napus, while A. brassicicola predominantly affects B. oleracea.
In the present study, A. alternata emerged as the most frequently isolated species and was consistently recovered from all symptomatic Brassica samples examined, including cauliflower (B. oleracea var. botrytis), broccoli and mugnoli (B. oleracea var. italica), and turnip (B. rapa var. cymosa). Alternaria alternata has previously been reported in Italy by Siciliano et al. [56] as a responsible agent for foliar spots on cabbage, cauliflower, and both wild and cultivated rocket, alongside A. arborescens, A. brassicicola, and A. tenuissima. Furthermore, Matić et al. [10] identified A. alternata as the agent of alternariosis in cabbage, and more recently, Ramirez-Villacís et al. [12] have reported it as responsible for leaf spot on broccoli in Ecuador. Alternaria alternata has also been associated with Alternaria leaf spot on canola (B. napus var. napus) and rapeseed (B.napus var. oleifera) in Australia and Serbia, as documented by Al-Lami et al. [90] and Blagojević et al. [89], respectively. Therefore, to the best of our knowledge, this is the first study that associates A. alternata with symptomatic B. oleracea var. italica (mugnoli) and B. rapa var. cymosa (turnip) plants worldwide.
The second largest Alternaria species isolated was A. brassicicola, which exclusively emerged from B. oleracea samples (cauliflower and broccoli) at a lower IF than A. alternata. This finding aligns with previous studies that identify A. brassicicola as a common and severe pathogen of B. oleracea, often co-occurring with A. brassicae [8,36,38,89]. These results also underscore the marked susceptibility of cauliflower and broccoli to simultaneous infections by multiple Alternaria species.
Interestingly, in the present study, only a single isolate of A. japonica was recovered from B. oleracea var. italica (broccoli). This fungus has previously been reported as a responsible agent for damping-off in Chinese cabbage seedlings (B. rapa subsp. chinensis) in China [91] and for the black spot disease on turnip (B. rapa subsp. rapa) in Spain [92]. Additionally, A. japonica was identified as the pathogen responsible for the black spot disease on kale (B. oleracea var. sabellica) in South Carolina, USA [93], and on Brassica oleracea var. italica in Japan [11]. Among other cultivated brassicas, A. japonica has also been reported on cultivated rocket [94,95]. In this case, A. japonica has also been detected here for first time associated with symptoms observed on broccoli (B. oleracea var. italica) in Italy.
The multigenic analysis performed in this study did not enable the species-level identification of eight Alternaria strains, which were placed within the Alternaria section Infectoriae and classified only at the genus level as Alternaria sp. Although Hong et al. [96] and Chalbi et al. [97] demonstrated that the Alt-a1 locus is a reliable marker for Alternaria species identification, further molecular analyses are still needed to resolve the taxonomic placement of these eight strains. Further multilocus phylogenetic analyses or whole-genome sequencing will be required to confirm this hypothesis. Previous studies have proposed a multigenic approach based on five protein-coding loci (act, Alt-a1, cam, gapdh, and plasma membrane ATPase) to clarify phylogenetic relationships among Alternaria species, with the cam and plasma membrane ATPase genes being identified as particularly informative [96,98]. More recently, whole-genome sequencing has emerged as a powerful tool for resolving species boundaries within Alternaria and other taxonomically challenging fungal groups [99].
Among the 11 clades identified through MSP-PCR analysis of the Alternaria strains, four strains selected as representatives of subclade 3 were identified as Stemphylium vesicarium based on the ITS and gapdh sequences. Stemphylium vesicarium is a filamentous fungus that is able to infect a wide range of hosts worldwide, including asparagus [100], garlic [101], and onion [102]. In 2009, it was reported in China from Brassica pekinensis leaves [63,103]. Stemphylium vesicarium has been present since the late 1970s in Italy, where it causes brown spot symptoms on pear leaves and fruits in the Po Valley [104]. To date, no information is available about the pathogenic or non-pathogenic role of S. vesicarium on cultivated Brassicaceae crops worldwide. Moreover, limited information is available on the relationship between saprophytic and pathogenic populations of Stemphylium spp., as well as on the possible host specificity of pathogenic isolates. For example, the closely related species belonging to the Alternaria genus are primarily saprophytic, although some act as opportunistic pathogens on a broad range of crops [100]. Finally, isolates of S. vesicarium are known to produce phytotoxic metabolites [105], and the leaf blight symptoms observed on onion and garlic have been linked to toxin production [106]. Four secondary metabolites that appear to be host-specific toxins are produced by S. vesicarium: stemphylin, stemphyperylenol, stemphyloxin, and stemphol [107]. These compounds are known to facilitate colonization and symptom development by selectively damaging or killing host tissues, but their effects are limited to susceptible host species [108]. In any case, to date, the above-mentioned compounds from S. vesicarium are not listed on the US National Center for Computational Toxicology database [109] as mycotoxins for humans and livestock. In our study, isolates of S. vesicarium were collected alongside Alternaria species from symptomatic leaf samples. This co-occurrence raises questions about potential interactions between these genera and the specific role of S. vesicarium in the disease development. Therefore, further investigations are needed to determine the pathogenic potential of S. vesicarium on cultivated Brassica species. To the best of our knowledge, this is the first detection of S. vesicarium being associated with B. oleracea var. italica (broccoli and mugnoli) worldwide.
The phylogenetic analysis of the 15 Plectosphaerella-like strains revealed that they clustered into three distinct species within the Plectosphaerella genus, namely P. cucumerina, P. pauciseptata, and P. plurivora. Over the past three decades, Plectosphaerella isolates have been collected from a wide range of plant hosts across different countries, P. cucumerina being consistently reported as the prevalent species [110,111]. Despite their widespread occurrence, infections caused by Plectosphaerella spp. remain poorly characterized. These fungi have been identified as agents of both wilt [112] and root rot diseases [113], although comprehensive studies on their pathogenic behaviour and host interactions are still limited. In Italy, Raimondo and Carlucci [111,114] isolated several Plectosphaerella species from basil, parsley, tomato, and pepper and demonstrated, through pathogenicity tests, that these fungi behave as hemibiotrophs. These fungi are capable of transitioning to necrotrophic behavior, inducing stunting syndrome characterized by root and collar rot, vascular discoloration, and foliar symptoms. Plectosphaerella pauciseptata was the second most abundantly recovered species in this study. In Italy, this fungus has previously been associated with watermelon, melon, tomato, and pepper [60,111]; basil and parsley [114]; in Japan with lettuce, coriander, and chervil [115]; and recently in China with tomato [116]. Plectosphaerella plurivora, here detected in association with symptomatic brassica plants, has recently been implicated alongside other Plectosphaerella species as a cause of root and collar rot in asparagus, watermelon, tomato [60]; basil [114]; and ginseng [117]. The detection of Plectosphaerella spp. in Brassicaceae crops presented in this study is particularly significant, considering that recent studies worldwide have rarely documented their presence or pathogenic impact on Brassicaceae. Indeed, P. cucumerina has been described as a pathogen on wild rocket (Diplotaxis tenuifolia), recorded for the first time in Italy, causing leaf spots in several commercial glasshouses in Northern and Southern Italy [24,58,118]. More recently, P. cucumerina has also been reported as responsible for root rot on cabbage, both in China and worldwide [25]. Our findings align with previous reports, as P. cucumerina was the most frequently isolated species within the Plectosphaerella genus, exhibiting the highest IF values. Plectosphaerella cucumerina, P. pauciseptata, and P. plurivora were isolated from B. oleracea and B. rapa. In particular, P. cucumerina was isolated from symptomatic stems, leaves, and corymbs of cauliflower, broccoli, and turnip, as well as from symptomatic stems and leaves of mugnoli (B. oleracea var. italica). By contrast, P. pauciseptata and P. plurivora were consistently isolated from symptomatic stems and leaves of both B. oleracea and B. rapa. Moreover, all three Plectosphaerella species were collected alongside Fusarium and Alternaria species from symptomatic leaf, stem, and root samples. Also, in this case, co-occurrence raises questions about potential interactions between these genera and the specific role of Plectosphaerella species in disease development. These results suggest that the host range of the Plectosphaerella genus may encompass a broad spectrum of species within the Brassicaceae family, thus highlighting the importance of further research into its epidemiology, pathogenicity, and host specificity. To the best of our knowledge, this is the first detection of P. cucumerina associated with B. oleracea var. italica (broccoli) in Italy and with B. oleracea var. italica (mugnoli), B. oleracea var. botrytis (cauliflower), and B. rapa var. cymosa (turnip) worldwide. Additionally, this is the first detection of P. pauciseptata and P. plurivora associated with symptomatic B. oleracea, B. italica, and B. rapa plants worldwide.
Given the limited reports of Plectosphaerella species associated with Brassica crops, our findings expand the fungal diversity and geographic distribution of the genus in these crops. However, their pathogenic significance cannot be inferred without targeted pathogenicity assays, which will be carried out for this purpose.
Lastly, F. solani species complex and S. sclerotiorum were also isolated from Brassica plants with lower IF than Alternaria and Plectosphaerella, although their involvement in Brassica diseases is already well-documented. Several Fusarium species are known to infect Brassica crops, including both vascular Fusarium species (causing Fusarium wilt and yellows) and parenchymatous species (causing head and root rots). Among the wilt- and yellow-inducing Fusarium species, Fusarium oxysporum f. sp. conglutinans has been reported on canola in Argentina [16]; F. oxysporum f. sp. raphani on B. oleracea in Italy [17]; F. equiseti on cabbage and cauliflower in Korea and China [15,17]; and F. solani species complex on cauliflower in China [42]. As far as the parenchymatous Fusarium species are concerned, F. verticillioides has been identified as the agent of head rot in B. rapa subsp. parachinensis in China [43], while F. avenaceum has been reported as an agent of head rot in B. oleracea var. botrytis in Poland [19]. Our results are in line with Chai et al. [42], because we collected F. solani species complex from all Brassica samples showing symptoms of wilting and leaf yellowing. These findings reinforce their established pathogenic roles in Brassica diseases. To the best of our knowledge, this is the first study that associated the F. solani species complex with symptomatic B. oleracea var. italica (broccoli and mugnoli) and B. rapa var. cymosa (turnip) plants worldwide.
Sclerotinia sclerotiorum is a well-known and economically significant pathogen of cultivated Brassica species, and it is considered the most important pathogen of B. napus in China [55]. Over the past decade, S. sclerotiorum has been reported as a pathogen of cabbage [29,31] and broccoli [30]. This pathogen is not limited to field-grown Brassica, but it also causes post-harvest injuries during transit and storage [40]. In our study, S. sclerotiorum was collected from corymbs of cauliflower, broccoli, and turnip, showing water-soaked lesions with white fluffy mycelia and black sclerotia. To the best of our knowledge, this is the first study that associated S. sclerotiorum with symptomatic B. oleracea var. botrytis (cauliflower) and B. rapa var. cymosa (turnip) plants both in Italy and worldwide.
In conclusion, this study highlights the complexity of the fungal species associated with cultivated Brassica crops in Southern Italy and addresses the need to conduct regular and detailed surveys in order to confirm and accurately identify the fungal species involved. The molecular tools revealed substantial intra- and interspecific diversities across several fungal genera. The frequent co-occurrence of multiple fungal taxa from the same symptomatic plants highlights the complexity of fungal diversity associated with cultivated Brassica crops and underscores the need for further studies. Moreover, infections on Brassica plants by Alternaria, Stemphylium, and Fusarium pathogens are also linked to the production of several mycotoxins, which may pose risks to human health. In light of this, comprehensive pathogenicity studies on newly reported fungal species associated with cultivated Brassica crops are essential to: deepen our knowledge; investigate the pathogenicity, ecological, and epidemiological role; clarify the biological significance of the fungal species here detected; and support the development of effective disease management strategies.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/jof12010013/s1. Table S1: Brassica samples information (host, locality, incidence, and disease severity); Table S2: Information on Alternaria, Plectosphaerella, and Stemphylium sequences used in the multilocus analyses. Ex-type strains are highlighted in bold.

Author Contributions

Conceptualization, M.L.R. and A.C.; investigation, M.M., M.L.R., M.S., G.R. and M.G.M.; software, M.L.R. and M.S.; validation, M.M., M.L.R., M.S. and A.C.; formal analysis, M.L.R. and M.S.; resources, A.E. and A.C.; data curation, M.M., M.L.R., M.S. and A.C.; writing—original draft preparation, M.M., M.S., M.L.R. and A.C.; writing—review and editing, M.M., M.L.R., M.S., F.L., A.E. and A.C.; visualization, M.M., M.L.R. and A.C.; supervision, M.L.R., A.E. and A.C.; project administration, A.C.; funding acquisition, A.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research was published with a contribution from 5 × 1000 IRPEF funds in favour of the University of Foggia, in memory of Gianluca Montel; the Apulia Region (Italy), Assegni di RIcerca per riPARTire con le Imprese—POC PUGLIA FESR-FSE 2014/2020, grant number N. 3/FSE/2021.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The newly generated DNA sequences have been uploaded to NCBI; the accession numbers are shown in this article and Supplementary Materials. The original contributions presented in this study are included in this article and Supplementary Materials.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Gómez-Campo, C. Taxonomy. In Biology of Brassica Coenospecies; Gómez-Campo, C., Ed.; Elsevier: Amsterdam, The Netherlands, 1999; pp. 3–32. [Google Scholar]
  2. Kapusta-Duch, J.; Kopeć, A.; Piątkowska, E.; Borczak, B.; Leszczyńska, T. The beneficial effects of Brassica vegetables on human health. Rocz. Państw. Zakł. Hig. 2012, 63, 389–395. [Google Scholar] [PubMed]
  3. Brennan, E.B.; Acosta-Martínez, V. Cover cropping frequency is the main driver of soil microbial changes during six years of organic vegetable production. Soil Biol. Biochem. 2017, 109, 188–204. [Google Scholar] [CrossRef]
  4. Rakow, G. Species origin and economic importance of Brassica. In Brassica; Pua, E.C., Douglas, C.J., Eds.; Springer: Berlin/Heidelberg, Germany, 2004; Volume 54, pp. 3–11. [Google Scholar] [CrossRef]
  5. Subramanian, P.; Kim, S.H.; Hahn, B.S. Brassica biodiversity conservation: Prevailing constraints and future avenues for sustainable distribution of plant genetic resources. Front. Plant Sci. 2023, 14, 1220134. [Google Scholar] [CrossRef]
  6. Istituto Nazionale di Statistica (ISTAT). Available online: https://esploradati.istat.it/databrowser/#/it/dw/categories/IT1,Z1000AGR,1.0/AGR_CRP/DCSP_COLTIVAZIONI/ (accessed on 17 March 2025).
  7. Mourou, M.; Raimondo, M.L.; Lops, F.; Carlucci, A. Fungi and Chromista diseases: Molecular detection and host–plant interaction. Plants 2023, 12, 1033. [Google Scholar] [CrossRef]
  8. Akram, W.; Li, G.; Ahmad, A.; Anjum, T.; Ali, B.; Luo, W.; Guo, J.; Xie, D.; Wang, Q. Leaf spot disease caused by Alternaria arborescens, A. tenuissima, and A. infectoria on Brassica rapa subsp. parachinensis in China. Plant Dis. 2019, 103, 2480. [Google Scholar] [CrossRef]
  9. Hinchliffe, E.R.; Keinath, A.P.; Meadows, I.M. First report of Alternaria leaf spot caused by Alternaria brassicae on broccoli in North Carolina, U.S.A. Plant Dis. 2024, 108, 3659. [Google Scholar] [CrossRef]
  10. Matić, S.; Gilardi, G.; Varveri, M.; Garibaldi, A.; Gullino, M.L. Molecular diversity of Alternaria spp. from leafy vegetable crops, and their sensitivity to azoxystrobin and boscalid. Phytopathol. Mediterr. 2019, 58, 519–533. [Google Scholar] [CrossRef]
  11. Nishikawa, J.; Nakashima, C. Japanese species of Alternaria and their species boundaries based on host range. Fungal Syst. Evol. 2020, 5, 197–282. [Google Scholar] [CrossRef]
  12. Ramirez-Villacis, D.X.; Barriga-Medina, N.; Llerena-Llerena, S.; Pazmino-Guevara, C.; Leon-Reyes, A. First report of Alternaria alternata causing leaf spot on broccoli in Ecuador. Plant Dis. 2023, 107, 2866. [Google Scholar] [CrossRef]
  13. Salybekova, N.; Basim, E.; Basim, H.; Zhusupovna, G. Characterization of Alternaria brassicae causing black leaf spot disease of cabbage (Brassica oleracea var. capitata) in the southern part of Kazakhstan. Acta Sci. Pol. Hortorum Cultus 2019, 18, 3–13. [Google Scholar] [CrossRef]
  14. Park, K.; Kim, C.-H. Occurrence of anthracnose on cabbage caused by Colletotrichum dematium. Mycobiology 2001, 29, 61–62. [Google Scholar] [CrossRef]
  15. Afroz, T.; Jee, S.; Aktaruzzaman, M.; Choi, M.H.-W.; Kim, J.H.; Assefa, A.D.; Hahn, B.S.; Lee, H.-S. First report of Fusarium wilt caused by Fusarium equiseti on cabbage (Brassica oleracea var. capitata L.) in Korea. Plant Dis. 2021, 105, 1198. [Google Scholar] [CrossRef]
  16. Gaetán, S.A. Occurrence of Fusarium wilt on canola caused by Fusarium oxysporum f. sp. conglutinans in Argentina. Plant Dis. 2005, 89, 432. [Google Scholar] [CrossRef] [PubMed]
  17. Garibaldi, A.; Gilardi, G.; Gullino, M.L. Evidence for an expanded host range of Fusarium oxysporum f. sp. raphani. Phytoparasitica 2006, 34, 115–121. [Google Scholar] [CrossRef]
  18. Li, P.L.; Shi, Y.X.; Guo, M.Y.; Xie, X.W.; Chai, A.L.; Li, B.J. Fusarium wilt of cauliflower caused by Fusarium equiseti in China. Can. J. Plant Pathol. 2017, 39, 77–82. [Google Scholar] [CrossRef]
  19. Robak, J.; Czubatka, A.; Czajka, A.; Smolinska, U. First report of cabbage head rot caused by Fusarium avenaceum in Poland. Plant Dis. 2014, 98, 1741. [Google Scholar] [CrossRef]
  20. Claassen, B.J.; Berry, P.A.; Thomas, W.J.; Mallory-Smith, C.; Ocamb, C.M. Black leg and chlorotic leaf spot occurrence on Brassicaceae crop and weed hosts. Plant Dis. 2021, 105, 3418–3425. [Google Scholar] [CrossRef]
  21. Gautam, A.K.; Avasthi, S.; Prasher, I.B.; Sushma; Verma, R.K. Diversity and distribution of cercosporoid fungi in Himachal Pradesh: An annotated checklist. Stud. Fung. 2020, 5, 17–49. [Google Scholar] [CrossRef]
  22. Gunasinghe, N.; Barbetti, M.J.; You, M.P.; Burrell, D.; Neate, S. White leaf spot caused by Neopseudocercosporella capsellae: A re-emerging disease of Brassicaceae. Front. Cell. Infect. Microbiol. 2020, 10, 588090. [Google Scholar] [CrossRef]
  23. Videira, S.I.R.; Groenewald, J.Z.; Nakashima, C.; Braun, U.; Barreto, R.W.; de Wit, P.J.G.M.; Crous, P.W. Mycosphaerellaceae—Chaos or clarity? Stud. Mycol. 2017, 87, 257–421. [Google Scholar] [CrossRef] [PubMed]
  24. Garibaldi, A.; Gilardi, G.; Ortu, G.; Gullino, M.L. First report of Plectosphaerella cucumerina on greenhouse-cultured wild rocket (Diplotaxis tenuifolia) in Italy. Plant Dis. 2012, 96, 1825. [Google Scholar] [CrossRef] [PubMed]
  25. Li, P.L.; Chai, A.-L.; Shi, Y.-X.; Xie, X.-W.; Li, B.-J. First report of root rot caused by Plectosphaerella cucumerina on cabbage in China. Mycobiology 2017, 45, 110–113. [Google Scholar] [CrossRef] [PubMed]
  26. Misawa, T.; Aoki, M. First report of Rhizoctonia solani AG-1 IC causing head rot of cabbage in Japan. New Dis. Rep. 2017, 36, 12. [Google Scholar] [CrossRef]
  27. Turkkan, M.; Kilicoglu, M.C.; Erper, I. Characterization and pathogenicity of Rhizoctonia isolates collected from Brassica oleracea var. acephala in Ordu, Turkey. Phytoparasitica 2020, 48, 273–286. [Google Scholar] [CrossRef]
  28. Yang, G.H.; Chen, J.Y.; Pu, W.Q. First report of head rot of cabbage and web blight of snap bean caused by Rhizoctonia solani AG-4 HGI. Plant Pathol. 2007, 56, 351. [Google Scholar] [CrossRef]
  29. Mahalingam, T.; Guruge, B.M.A.; Somachandra, K.P.; Rajapakse, C.S.; Attanayake, R.N. First report of white mold caused by Sclerotinia sclerotiorum on cabbage in Sri Lanka. Plant Dis. 2017, 101, 249. [Google Scholar] [CrossRef]
  30. Shrestha, U.; Swilling, K.J.; Butler, D.M.; Ownley, B.H. First report of basal drop and white mold on lettuce, broccoli, and mustard caused by Sclerotinia sclerotiorum in Tennessee, USA. Plant Dis. 2018, 102, 249. [Google Scholar] [CrossRef]
  31. Sanogo, S.; Lujan, P.A.; Baucom, D. First report of Sclerotinia sclerotiorum on cabbage in New Mexico. Plant Dis. 2015, 99, 891. [Google Scholar] [CrossRef]
  32. Hattab, Z.; Ben Lasfar, N.; Abid, M.; Bellazreg, F.; Fathallah, A.; Letaief, A. Alternaria alternata infection causing rhinosinusitis and orbital involvement in an immunocompetent patient. New Microbes New Infect. 2019, 32, 100561. [Google Scholar] [CrossRef]
  33. Pastor, F.J.; Guarro, J. Alternaria infections: Laboratory diagnosis and relevant clinical features. Clin. Microbiol. Infect. 2008, 14, 734–746. [Google Scholar] [CrossRef]
  34. Hongsanan, S.; Hyde, K.; Phookamsak, R.; Wanasinghe, D.; McKenzie, E.; Sarma, V.V.; Boonmee, S.; Lücking, R.; Bhat, J.D.; Liu, N.; et al. Refined families of Dothideomycetes: Dothideomycetidae and Pleosporomycetidae. Mycosphere 2020, 11, 2107. [Google Scholar] [CrossRef]
  35. Wijayawardene, N.; Hyde, K.; Dai, D.; Sánchez-García, M.; Goto, B.; Saxena, R.; Erdoğdu, M.; Selçuk, F.; Rajeshkumar, K.; Aptroot, A.; et al. Outline of fungi and fungus-like taxa—2021. Mycosphere 2022, 13, 53–453. [Google Scholar] [CrossRef]
  36. De Britto, S.; Kapera, D.; Jogaiah, S. First report of leaf spot disease caused by Alternaria brassicicola on broccoli in Papua New Guinea. Plant Dis. 2020, 104, 3073. [Google Scholar] [CrossRef]
  37. Gannibal, P.B.; Gasich, E.L. Causal agents of the alternariosis of cruciferous plants in Russia: Species composition, geography, and ecology. Mikol. Fitopatol. 2009, 43, 447–456. [Google Scholar]
  38. Nowicki, M.; Nowakowska, M.; Niezgoda, A.; Kozik, E. Alternaria black spot of crucifers: Symptoms, importance of disease, and perspectives of resistance breeding. J. Fruit Ornam. Plant Res. 2012, 76, 5–19. [Google Scholar] [CrossRef]
  39. Humpherson-Jones, F.M.; Maude, R.B. Studies on the epidemiology of Alternaria brassicicola in Brassica oleracea seed production crops. Ann. Appl. Biol. 1982, 100, 61–71. [Google Scholar] [CrossRef]
  40. Rimmer, S.R.; Shattuck, V.I.; Buchwaldt, L. Compendium of Brassica Diseases; American Phytopathological Society: St. Paul, MN, USA, 2007; p. 117. ISBN 978-0-89054-344-3. [Google Scholar]
  41. Arie, T. Fusarium diseases of cultivated plants: Control, diagnosis, and molecular and genetic studies. J. Pestic. Sci. 2019, 44, 275–281. [Google Scholar] [CrossRef]
  42. Chai, A.; Li, X.; Kang, H.J.; Zhao, Q.; Shi, Y.; Li, B. First report of Fusarium cucurbiticola causing vascular wilt on cauliflower in China. Plant Dis. 2022, 106, 2993. [Google Scholar] [CrossRef]
  43. Akram, W.; Ahmad, A.; Guo, J.; Yasin, N.A.; Akbar, M.; Luo, W.; Wu, T.; Wang, Q.; Lu, M.; Xie, D.; et al. Occurrence of head rot disease caused by Fusarium verticillioides on Chinese flowering cabbage (Brassica rapa L. subsp. parachinensis) in China. Crop Prot. 2020, 134, 105180. [Google Scholar] [CrossRef]
  44. Howlett, B.J.; Idnurm, A.; Pedras, M.S.C. Leptosphaeria maculans, the causal agent of blackleg disease of Brassicas. Fungal Genet. Biol. 2001, 33, 1–14. [Google Scholar] [CrossRef] [PubMed]
  45. Humpherson-Jones, F.M. The incidence of Alternaria spp. and Leptosphaeria maculans in commercial Brassica seed in the United Kingdom. Plant Pathol. 1985, 34, 385–390. [Google Scholar] [CrossRef]
  46. Šašek, V.; Nováková, M.; Dobrev, P.I.; Valentová, O.; Burketová, L. β-Aminobutyric acid protects Brassica napus plants from infection by Leptosphaeria maculans: Resistance induction or a direct antifungal effect? Eur. J. Plant Pathol. 2011, 133, 279–289. [Google Scholar] [CrossRef]
  47. Fitt, B.D.L.; Brun, H.; Barbetti, M.J.; Rimmer, S.R. Worldwide importance of phoma stem canker (Leptosphaeria maculans and L. biglobosa) on oilseed rape (Brassica napus). Eur. J. Plant Pathol. 2006, 114, 3–15. [Google Scholar] [CrossRef]
  48. Kutcher, H.R.; Melfort, S.; Rimmer, S.R. Determination of Pathogenic Variability of Leptosphaeria maculans in Western Canada and Resistance in Canadian Brassica napus Cultivars; Agriculture and Agri-Food Canada: Saskatoon, SK, Canada, 2009. [Google Scholar]
  49. Gunasinghe, N.; You, M.P.; Barbetti, M.J. Phenotypic and phylogenetic studies associated with the crucifer white leaf spot pathogen, Pseudocercosporella capsellae, in Western Australia. Plant Pathol. 2016, 65, 205–217. [Google Scholar] [CrossRef]
  50. Inman, A.J. The Biology and Epidemiology of White Leaf Spot (Pseudocercosporella capsellae) on Oilseed Rape. Ph.D. Thesis, University of London, London, UK, 1992. [Google Scholar]
  51. Ocamb, C. Disease Alert—White Leaf Spot and Gray Stem in Crucifer Seed Crops in Western Oregon; Oregon State University: Corvallis, OR, USA, 2014. [Google Scholar]
  52. Ocamb, C. A Clinic Close-Up: Blackleg, Light Leaf Spot, and White Leaf Spot in Western Oregon; Oregon State University Extension Service: Corvallis, OR, USA, 2016. [Google Scholar]
  53. Murtza, T.; You, M.; Barbetti, M. Geographic location and year determine virulence, and yearly genetic change, in populations of Neopseudocercosporella capsellae. Plant Pathol. 2019, 68, 1706–1718. [Google Scholar] [CrossRef]
  54. Van de Wouw, A.P.; Idnurm, A.; Davidson, J.A.; Sprague, S.J.; Khangura, R.K.; Ware, A.; Lindbeck, K.D.; Marcroft, S.J. Fungal diseases of canola in Australia: Identification of trends, threats and potential therapies. Australas. Plant Pathol. 2016, 45, 415–423. [Google Scholar] [CrossRef]
  55. Dixelius, C.; Bohman, S.; Wretblad, S. Disease resistance. In Biotechnology in Agriculture and Forestry; Douglas, C., Pua, E., Eds.; Springer: Berlin, Germany, 2004; pp. 253–271. [Google Scholar]
  56. Siciliano, I.; Gilardi, G.; Ortu, G.; Gisi, U.; Gullino, M.L.; Garibaldi, A. Identification and characterization of Alternaria species causing leaf spot on cabbage, cauliflower, wild and cultivated rocket by using molecular and morphological features and mycotoxin production. Eur. J. Plant Pathol. 2017, 149, 401–413. [Google Scholar] [CrossRef]
  57. Garibaldi, A.; Gilardi, G.; Bertoldo, C.; Gullino, M.L. First report of leaf spot of wild (Diplotaxis tenuifolia) and cultivated (Eruca vesicaria) rocket caused by Alternaria japonica in Italy. Plant Dis. 2011, 95, 1316. [Google Scholar] [CrossRef] [PubMed]
  58. Gilardi, G.; Gullino, M.L.; Garibaldi, A. New diseases of wild and cultivated rocket in Italy. Acta Hortic. 2013, 1005, 569–572. [Google Scholar] [CrossRef]
  59. Fisher, P.J.; Petrini, O.; Petrini, L.E.; Descals, E. A preliminary study of fungi inhabiting xylem and whole stems of Olea europaea. Sydowia 1992, 44, 117–121. [Google Scholar]
  60. Carlucci, A.; Raimondo, M.L.; Santos, J.; Phillips, A.J.L. Plectosphaerella species associated with root and collar rots of horticultural crops in southern Italy. Persoonia 2012, 28, 34–48. [Google Scholar] [CrossRef] [PubMed]
  61. De Hoog, G.S.; Guarro, J.; Gené, J.; Figueras, M.J. Atlas of Clinical Fungi, 3rd ed.; Centraalbureau voor Schimmelcultures: Utrecht, The Netherlands, 2000. [Google Scholar]
  62. Sousa Melo, B.; Voltan, A.R.; Arruda, W.; Lopes, F.A.C.; Georg, R.C.; Ulhoa, C.J. Morphological and molecular aspects of sclerotial development in the phytopathogenic fungus Sclerotinia sclerotiorum. Microbiol. Res. 2019, 229, 126326. [Google Scholar] [CrossRef] [PubMed]
  63. Woudenberg, J.H.C.; Hanse, B.; van Leeuwen, G.C.M.; Groenewald, J.Z.; Crous, P.W. Stemphylium revisited. Stud. Mycol. 2017, 87, 77–103. [Google Scholar] [CrossRef]
  64. Carlucci, A.; Raimondo, M.L.; Cibelli, F.; Phillips, A.J.L.; Lops, F. Pleurostomophora richardsiae, Neofusicoccum parvum and Phaeoacremonium aleophilum associated with a decline of olives in southern Italy. Phytopathol. Mediterr. 2013, 52, 517–527. [Google Scholar] [CrossRef]
  65. Meyer, W.; Mitchell, T.G.; Freedman, E.Z.; Vilgalys, R. Hybridization probes for conventional DNA fingerprinting used as single primers in the polymerase chain reaction to distinguish strains of Cryptococcus neoformans. J. Clin. Microbiol. 1993, 31, 2274–2280. [Google Scholar] [CrossRef]
  66. Santos, J.M.; Phillips, A.J.L. Resolving the complex of Diaporthe (Phomopsis) species occurring on Foeniculum vulgare in Portugal. Fungal Divers. 2009, 34, 111–125. [Google Scholar]
  67. White, T.J.; Bruns, T.D.; Lee, S.B.; Taylor, J.W. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Academic Press: San Diego, CA, USA, 1990; pp. 315–322. [Google Scholar]
  68. Carbone, I.; Kohn, L.M. A method for designing primer sets for speciation studies in filamentous Ascomycetes. Mycologia 1999, 91, 553–556. [Google Scholar] [CrossRef]
  69. Pavón, M.Á.; González, I.; Pegels, N.; Martín, R.; García, T. PCR detection and identification of Alternaria species-groups in processed foods based on the genetic marker Alt a 1. Food Control 2010, 21, 1745–1756. [Google Scholar] [CrossRef]
  70. Sung, G.H.; Sung, J.M.; Hywel-Jones, N.L.; Spatafora, J.W. A multi-gene phylogeny of Clavicipitaceae (Ascomycota, Fungi): Identification of localized incongruence using a combinational bootstrap approach. Mol. Phylogenet. Evol. 2007, 44, 1204–1223. [Google Scholar] [CrossRef]
  71. Berbee, M.L.; Pirseyedi, M.; Hubbard, S. Cochliobolus phylogenetics and the origin of known, highly virulent pathogens, inferred from ITS and glyceraldehyde-3-phosphate dehydrogenase gene sequences. Mycologia 1999, 91, 964–977. [Google Scholar] [CrossRef]
  72. Giraldo, A.; Hernández-Restrepo, M.; Crous, P.W. New plectosphaerellaceous species from Dutch garden soil. Mycol. Prog. 2019, 18, 1135–1154. [Google Scholar] [CrossRef]
  73. O’Donnell, K.; Kistler, H.C.; Cigelnik, E.; Ploetz, R.C. Multiple evolutionary origins of the fungus causing Panama disease of banana: Concordant evidence from nuclear and mitochondrial gene genealogies. Proc. Natl. Acad. Sci. USA 1998, 95, 2044–2049. [Google Scholar] [CrossRef] [PubMed]
  74. Rehner, S.A.; Buckley, E. A Beauveria phylogeny inferred from nuclear ITS and EF1-α sequences: Evidence for cryptic diversification and links to Cordyceps teleomorphs. Mycologia 2005, 97, 84–98. [Google Scholar] [CrossRef]
  75. Vaidya, G.; Lohman, D.J.; Meier, R. SequenceMatrix: Concatenation software for the fast assembly of multi-gene datasets with character set and codon information. Cladistics 2011, 27, 171–180. [Google Scholar] [CrossRef]
  76. Minh, B.Q.; Schmidt, H.A.; Chernomor, O.; Schrempf, D.; Woodhams, M.D.; von Haeseler, A.; Lanfear, R. IQ-TREE 2: New models and efficient methods for phylogenetic inference in the genomic era. Mol. Biol. Evol. 2020, 37, 1530–1534. [Google Scholar] [CrossRef]
  77. Ronquist, F.; Huelsenbeck, J.P. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 2003, 19, 1572–1574. [Google Scholar] [CrossRef]
  78. Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef]
  79. Posada, D. jModelTest: Phylogenetic model averaging. Mol. Biol. Evol. 2008, 25, 1253–1256. [Google Scholar] [CrossRef]
  80. Letunic, I.; Bork, P. Interactive Tree Of Life (iTOL) v5: An online tool for phylogenetic tree display and annotation. Nucleic Acids Res. 2021, 49, W293–W296. [Google Scholar] [CrossRef]
  81. Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [PubMed]
  82. Swofford, D.L.; Sullivan, J. Phylogeny inference based on parsimony and other methods using PAUP*. In The Phylogenetic Handbook: A Practical Approach to DNA and Protein Phylogeny; Cambridge University Press: Cambridge, UK, 2003; pp. 160–206. [Google Scholar]
  83. Page, R.D.M. TreeView: An application to display phylogenetic trees on personal computers. Bioinformatics 1996, 12, 357–358. [Google Scholar] [CrossRef]
  84. O’Donnell, K.; Whitaker, B.K.; Laraba, I.; Proctor, R.H.; Brown, D.W.; Broders, K.; Kim, H.S.; McCormick, S.P.; Busman, M.; Aoki, T.; et al. DNA sequence-based identification of Fusarium: A work in progress. Plant Dis. 2022, 106, 1597–1609. [Google Scholar] [CrossRef]
  85. El-Gremi, S.; Attia, S.M. Production and characterization of microbial dye produced by the saprophytic fungus Epicoccum sp. J. Agric. Chem. Biotechnol. 2007, 32, 7685–7692. [Google Scholar] [CrossRef]
  86. Martins, L.; Hartmann, I.; Alves, D.O.; Martins, P.C.; Garcia, C.H.; Leclercq, C.C.; Ferreira, R.; He, J.; Renaut, J.; Becker, J.D.; et al. Elucidating how the saprophytic fungus Aspergillus nidulans uses the plant polyester suberin as a carbon source. BMC Genom. 2014, 15, 613. [Google Scholar] [CrossRef] [PubMed]
  87. Ziaee, A.; Zia, M.; Goli, M. Identification of saprophytic and allergenic fungi in indoor and outdoor environments. Environ. Monit. Assess. 2018, 190, 574. [Google Scholar] [CrossRef]
  88. Saharan, G.S.; Mehta, N.; Meena, P.D. Alternaria Diseases of Crucifers: Biology, Ecology and Disease Management; Springer: Singapore; Berlin/Heidelberg, Germany; New York, NY, USA, 2016; p. 299. [Google Scholar] [CrossRef]
  89. Blagojević, J.D.; Vukojević, J.B.; Ivanović, Ž.S. Occurrence and characterization of Alternaria species associated with leaf spot disease in rapeseed in Serbia. Plant Pathol. 2020, 69, 883–900. [Google Scholar] [CrossRef]
  90. Al-Lami, H.F.D.; You, M.P.; Barbetti, M.J. Incidence, pathogenicity and diversity of Alternaria spp. associated with Alternaria leaf spot of canola (Brassica napus) in Australia. Plant Pathol. 2019, 68, 492–503. [Google Scholar] [CrossRef]
  91. Ren, X.X.; Zhang, G.Z.; Dai, W.A. First report of damping-off caused by Alternaria japonica on Chinese cabbage seedlings in China. Plant Dis. 2012, 96, 1378. [Google Scholar] [CrossRef] [PubMed]
  92. Bassimba, D.D.M.; Mira, J.L.; Vicent, A. First report of Alternaria japonica causing black spot of turnip in Spain. Plant Dis. 2013, 97, 1505. [Google Scholar] [CrossRef] [PubMed]
  93. Keinath, A.P.; Toporek, S.M.; DuBose, V.B.; Zardus, S.H.; Ballew, J.B. First report of Alternaria japonica, a causal agent of black spot, on kale in South Carolina, U.S.A. Plant Dis. 2021, 105, 2016. [Google Scholar] [CrossRef]
  94. Gilardi, G.; Demarchi, S.; Ortu, G.; Gullino, M.L.; Garibaldi, A. Occurrence of Alternaria japonica on seeds of wild and cultivated rocket. J. Phytopathol. 2014, 163, 419–422. [Google Scholar] [CrossRef]
  95. Tidwell, T.E.; Blomquist, C.L.; Rooney-Latham, S.; Scheck, H.J. Leaf spot of arugula, caused by Alternaria japonica, in California. Plant Dis. 2014, 98, 1272. [Google Scholar] [CrossRef]
  96. Hong, S.G.; Cramer, R.A.; Lawrence, C.B.; Pryor, B.M. Alt a 1 allergen homologs from Alternaria and related taxa: Analysis of phylogenetic content and secondary structure. Fungal Genet. Biol. 2005, 42, 119–129. [Google Scholar] [CrossRef] [PubMed]
  97. Chalbi, A.; Sghaier-Hammami, B.; Meca, G.; Quiles, J.M.; Abdelly, C.; Masiello, M. Characterization of mycotoxigenic Alternaria species isolated from the Tunisian halophyte Cakile maritima. Phytopathol. Mediterr. 2020, 59, 107–108. [Google Scholar] [CrossRef]
  98. Lawrence, D.P.; Gannibal, P.B.; Peever, T.L.; Pryor, B.M. The sections of Alternaria: Formalizing species-group concepts. Mycologia 2013, 105, 530–546. [Google Scholar] [CrossRef]
  99. Woudenberg, J.H.C.; Seidl, M.F.; Groenewald, J.Z.; de Vries, M.; Stielow, J.B.; Thomma, B.P.H.J.; Crous, P.W. Alternaria section Alternaria: Species, formae speciales or pathotypes? Stud. Mycol. 2015, 82, 1–21. [Google Scholar] [CrossRef]
  100. Köhl, J.; Groenenboom-de Haas, B.; Goossen-van de Geijn, H.; Speksnijder, A.; Kastelein, P.; de Hoog, S.; Ende, B.G.v.D. Pathogenicity of Stemphylium vesicarium from different hosts causing brown spot in pear. Eur. J. Plant Pathol. 2008, 124, 151–162. [Google Scholar] [CrossRef]
  101. Prados-Ligero, A.M.; González-Andújar, J.L.; Melero-Vara, J.M.; Basallote-Ureba, M.J. Development of Pleospora allii on garlic debris infected by Stemphylium vesicarium. Eur. J. Plant Pathol. 1998, 104, 861–870. [Google Scholar] [CrossRef]
  102. Aveling, T.A.S.; Snyman, H.G. Infection studies of Stemphylium vesicarium on onion leaves. Mycol. Res. 1993, 97, 984–988. [Google Scholar] [CrossRef]
  103. Pei, Y.-F.; Wang, Y.; Geng, Y.; Zhang, X.-G. Three new species of Stemphylium from Sinkiang, China. Mycotaxon 2010, 111, 167–173. [Google Scholar] [CrossRef]
  104. Ponti, I.; Cavanni, P.; Brunelli, A. Maculatura bruna delle pere: Eziologia e difesa. Inf. Fitopatol. 1982, 32, 35–40. [Google Scholar]
  105. Singh, P.; Bugiani, R.; Cavanni, P.; Nakajima, H.; Kodama, M.; Otani, H.; Kohmoto, K. Purification and biological characterization of host-specific SV-toxins from Stemphylium vesicarium causing brown spot of European pear. Phytopathology 1999, 89, 947–953. [Google Scholar] [CrossRef]
  106. Basallote-Ureba, M.J.; Prados-Ligero, A.M.; Melero-Vara, J.M. Aetiology of leaf spot of garlic and onion caused by Stemphylium vesicarium in Spain. Plant Pathol. 1999, 48, 139–145. [Google Scholar] [CrossRef]
  107. Andersen, B.; Solfrizzo, M.; Visconti, A. Metabolite profiles of common Stemphylium species. Mycol. Res. 1995, 99, 672–676. [Google Scholar] [CrossRef]
  108. Tsuge, T.; Harimoto, Y.; Akimitsu, K.; Ohtani, K.; Kodama, M.; Akagi, Y.; Egusa, M.; Yamamoto, M.; Otani, H. Host-selective toxins produced by the plant pathogenic fungus Alternaria alternata. FEMS Microbiol. Rev. 2013, 37, 44–66. [Google Scholar] [CrossRef]
  109. U.S. Environmental Protection Agency. Chemistry Dashboard. Available online: https://comptox.epa.gov/dashboard/DTXSID10198982 (accessed on 8 June 2020).
  110. Abad, P.; Pérez, A.; Marqués, M.C.; Vicente, M.J.; Bruton, B.D.; García-Jiménez, J. Assessment of vegetative compatibility of Acremonium cucurbitacearum and Plectosphaerella cucumerina isolates from diseased melon plants. EPPO Bull. 2000, 30, 199–204. [Google Scholar] [CrossRef]
  111. Raimondo, M.L.; Carlucci, A. Characterization and pathogenicity assessment of Plectosphaerella species associated with stunting disease on tomato and pepper crops in Italy. Plant Pathol. 2018, 67, 626–641. [Google Scholar] [CrossRef]
  112. Xu, J.; Xu, X.-D.; Cao, Y.-Y.; Zhang, W.-M. First report of greenhouse tomato wilt caused by Plectosphaerella cucumerina in China. Plant Dis. 2014, 98, 158. [Google Scholar] [CrossRef]
  113. Carrieri, R.; Pizzolongo, G.; Carotenuto, G.; Tarantino, P.; Lahoz, E. First report of necrotic leaf spot caused by Plectosphaerella cucumerina on lamb’s lettuce in southern Italy. Plant Dis. 2014, 98, 998. [Google Scholar] [CrossRef]
  114. Raimondo, M.L.; Carlucci, A. Characterization and pathogenicity of Plectosphaerella spp. collected from basil and parsley in Italy. Phytopathol. Mediterr. 2018, 57, 284–295. [Google Scholar] [CrossRef]
  115. Usami, T.; Morii, S.; Matsubara, C.; Amemiya, Y. Plectosphaerella rot of lettuce, coriander, and chervil caused by Plectosphaerella pauciseptata. J. Gen. Plant Pathol. 2012, 78, 368–371. [Google Scholar] [CrossRef]
  116. Chen, Z.S.; Chen, Y.Y.; Zhou, Y.Y.; Chen, P.Z.; Zhang, W.; Liu, M.; Yan, J.Y.; Wang, C.F. First report of Plectosphaerella pauciseptata associated with tomato root rot disease in China. Plant Dis. 2025, 109, 1377. [Google Scholar] [CrossRef]
  117. Han, L.; Zhou, X.; Zhao, Y.; Wu, L.; Ping, X.; He, Y.; Peng, S.; He, X.; Du, Y. First report of Plectosphaerella plurivora causing root rot disease in Panax notoginseng in China. J. Phytopathol. 2020, 168, 375–379. [Google Scholar] [CrossRef]
  118. Gilardi, G.; Garibaldi, A.; Gullino, M.L. Seed transmission of Plectosphaerella cucumerina, causal agent of leaf spot of Diplotaxis tenuifolia in Italy. Phytoparasitica 2013, 41, 411–416. [Google Scholar] [CrossRef]
Figure 1. Symptoms observed on cultivated Brassica crops. (ac) Concentric spots on leaves with chlorotic halo; (dg) irregular dark spots on corymb; (hj) elongated dark brown/black lesions on main leaf vein; (k,l) leaf yellowing; (m,n) collar and root rot; (os) water-soaked lesions with white fluffy mycelium and black sclerotia on corymb.
Figure 1. Symptoms observed on cultivated Brassica crops. (ac) Concentric spots on leaves with chlorotic halo; (dg) irregular dark spots on corymb; (hj) elongated dark brown/black lesions on main leaf vein; (k,l) leaf yellowing; (m,n) collar and root rot; (os) water-soaked lesions with white fluffy mycelium and black sclerotia on corymb.
Jof 12 00013 g001
Figure 2. Consensus cladogram from MSP-PCR profiles obtained for Alternaria strains (53) with primer M13. The vertical dashed line corresponds to the reproducibility level from which eleven groups of isolates are inferred (indicated by numbered circles).
Figure 2. Consensus cladogram from MSP-PCR profiles obtained for Alternaria strains (53) with primer M13. The vertical dashed line corresponds to the reproducibility level from which eleven groups of isolates are inferred (indicated by numbered circles).
Jof 12 00013 g002
Figure 3. Consensus cladogram from MSP-PCR profiles obtained for Pletosphaerella strains (47) with primer M13. The vertical dashed line corresponds to the reproducibility level from which three groups of isolates are inferred (indicated by numbered circles).
Figure 3. Consensus cladogram from MSP-PCR profiles obtained for Pletosphaerella strains (47) with primer M13. The vertical dashed line corresponds to the reproducibility level from which three groups of isolates are inferred (indicated by numbered circles).
Jof 12 00013 g003
Figure 4. Maximum likelihood tree generated from the combined (ITS, tef 1-α, Alt-a1, and rbp2) Alternaria dataset. Support values of both methods bootstrap (BS) and posterior probabilities (pp) labelled at the nodes. Values below 75% (BS) and 0.85 (pp) support are not shown or indicated with a hyphen. Asterisk represents bootstrap values of 100%. Strains obtained in this study are written in red. T indicates ex-type strain.
Figure 4. Maximum likelihood tree generated from the combined (ITS, tef 1-α, Alt-a1, and rbp2) Alternaria dataset. Support values of both methods bootstrap (BS) and posterior probabilities (pp) labelled at the nodes. Values below 75% (BS) and 0.85 (pp) support are not shown or indicated with a hyphen. Asterisk represents bootstrap values of 100%. Strains obtained in this study are written in red. T indicates ex-type strain.
Jof 12 00013 g004aJof 12 00013 g004b
Figure 5. Maximum likelihood tree generated from the combined (ITS, gapdh) Stemphylium dataset. Bootstrap support values from maximum likelihood/maximum parsimony labelled at the nodes. Values below 75% (BS) support are not shown or indicated with a hyphen. Star symbols represent bootstrap values of 100%. Strains obtained in this study are written in red. Ex-type isolates are in bold face.
Figure 5. Maximum likelihood tree generated from the combined (ITS, gapdh) Stemphylium dataset. Bootstrap support values from maximum likelihood/maximum parsimony labelled at the nodes. Values below 75% (BS) support are not shown or indicated with a hyphen. Star symbols represent bootstrap values of 100%. Strains obtained in this study are written in red. Ex-type isolates are in bold face.
Jof 12 00013 g005
Figure 6. Maximum likelihood tree generated from the combined (ITS, tef-1α and rpb2) Plectosphaerella dataset. Bootstrap support values from maximum likelihood/maximum parsimony labelled at the nodes. Values below 75% (BS) support are not shown or indicated with a hyphen. Star symbols represent bootstrap values of 100%. Strains obtained in this study are written in red. Ex-type isolates are in bold face.
Figure 6. Maximum likelihood tree generated from the combined (ITS, tef-1α and rpb2) Plectosphaerella dataset. Bootstrap support values from maximum likelihood/maximum parsimony labelled at the nodes. Values below 75% (BS) support are not shown or indicated with a hyphen. Star symbols represent bootstrap values of 100%. Strains obtained in this study are written in red. Ex-type isolates are in bold face.
Jof 12 00013 g006
Table 2. Information on Alternaria, Fusarium, Plectosphaerella, Sclerotinia, and Stemphylium strains isolated from Brassica crops collected in Foggia province, Italy. Isolate numbers in bold indicate representative isolates selected for molecular characterization.
Table 2. Information on Alternaria, Fusarium, Plectosphaerella, Sclerotinia, and Stemphylium strains isolated from Brassica crops collected in Foggia province, Italy. Isolate numbers in bold indicate representative isolates selected for molecular characterization.
SpeciesIsolate NumberLocationHostVarietyYear Part of Plant GenBank Accession Number
ITStef1-αAlt-a1rpb2gapdh
Alternaria alternataALT1LuceraBrassica oleracea var. botrytisTrinacria2022LeavesPV872872PV952645PV929800PV934163-
ALT2LuceraBrassica oleracea var. botrytisTrinacria2022Leaves-----
ALT3LuceraBrassica oleracea var. botrytisTrinacria2022Leaves-----
ALT4LuceraBrassica oleracea var. botrytisAkinen2023StemPV872878PV952651PV929806PV934169-
C1LuceraBrassica oleracea var. botrytisAkinen2023StemPV872873PV952646PV929801PV934164-
C5LuceraBrassica oleracea var. botrytisAprilia2023StemPV872877PV952650PV929805PV934168-
3AACerignolaBrassica oleracea var. italicaParthenon2022LeavesPV872876PV952649PV929804PV934167-
C3LuceraBrassica oleracea var. italicaParthenon2023Stem-----
1ACerignolaBrassica oleracea var. italicaMugnoli2022Leaves-----
2ACerignolaBrassica oleracea var. italicaMugnoli2022Leaves-----
2ARCerignolaBrassica oleracea var. italicaMugnoli2022LeavesPV872871PV952644PV929799PV934161-
3BCerignolaBrassica oleracea var. italicaMugnoli2022Leaves-----
3BCCerignolaBrassica oleracea var. italicaMugnoli2023Leaves-----
3BDCerignolaBrassica oleracea var. italicaParthenon2023LeavesPV872874PV952647PV929802PV934165-
4AACerignolaBrassica oleracea var. italicaParthenon2023Leaves-----
4BDCerignolaBrassica rapa var. cymosa (Turnip)Centoventina2023Leaves-----
6AAFoggiaBrassica rapa var. cymosa (Turnip)Centoventina2023Leaves-----
6BBCerignolaBrassica oleracea var. italicaParthenon2023LeavesPV872870PV952643PV929798PV934162-
10BACerignolaBrassica oleracea var. italicaParthenon2023LeavesPV872875PV952648PV929803PV934166-
3ACerignolaBrassica oleracea var. italicaMugnoli2022Leaves-----
3BsCerignolaBrassica rapa var. cymosa (Turnip)Centoventina2022LeavesPV872869PV952642PV929797PV934160-
A. brassicicolaALT5LuceraBrassica oleracea var. botrytisAkinen2023Leaves-----
2AACerignolaBrassica oleracea var. italicaParthenon2022Stem-----
2ABCerignolaBrassica oleracea var. italicaParthenon2023Stem-----
2ACCerignolaBrassica oleracea var. italicaParthenon2022StemPV920688PV952661PV934179PV942081-
4ABCerignolaBrassica oleracea var. italicaParthenon2022Leaves-----
7ABCerignolaBrassica oleracea var. italicaParthenon2022Leaves-----
7ADCerignolaBrassica oleracea var. italicaParthenon2023LeavesPV920689PV952662PV934180PV942082-
10ACCerignolaBrassica oleracea var. italicaParthenon2023LeavesPV920690PV952663PV934181PV942083-
A. japonica1BBCerignolaBrassica oleracea var. italicaParthenon2023StemPV920679PV952652PV934170PV942072-
Alternaria sp.1B1LuceraBrassica oleracea var. botrytisAkinen2023Leaves-----
1B2LuceraBrassica oleracea var. botrytisAkinen2023Leaves-----
2CCerignolaBrassica oleracea var. italicaMugnoli2022LeavesPV920684PV952657PV934175PV942077-
5ACerignolaBrassica oleracea var. italicaMugnoli2022LeavesPV920680PV952653PV934171PV942073-
3ABFoggiaBrassica oleracea var. italicaParthenon2023Leaves-----
4BBCerignolaBrassica oleracea var. italicaParthenon2023StemPV920685PV952658PV934176PV942078-
6ABCerignolaBrassica oleracea var. italicaParthenon2023Stem-----
7ACCerignolaBrassica oleracea var. italicaParthenon2023StemPV920686PV952659PV934177PV942079-
7AECerignolaBrassica oleracea var. italicaParthenon2023Corymb-----
10AACerignolaBrassica oleracea var. italicaParthenon2023LeavesPV920683PV952656PV934174PV942076-
10ABCerignolaBrassica oleracea var. italicaParthenon2023Leaves-----
10BBCerignolaBrassica oleracea var. italicaParthenon2022CorymbPV920682PV952655PV934173PV942075-
10BCCerignolaBrassica oleracea var. italicaParthenon2022Leaves-----
3BGCerignolaBrassica rapa var. cymosa (Turnip)Centoventina2023LeavesPV920681PV952654PV934172PV942074-
4BFoggiaBrassica oleracea var. italicaParthenon2023Leaves-----
4BACerignolaBrassica oleracea var. italicaParthenon2022LeavesPV920687PV952660PV934178PV942080-
Fusarium solani species complex1GLuceraBrassica oleracea var. botrytisAkinen2022Stem -----
1FCerignolaBrassica oleracea var. italicaParthenon2023StemPV920568PV952664---
1HCerignolaBrassica oleracea var. italicaParthenon2023Stem-----
2GCerignolaBrassica oleracea var. italicaParthenon2023Stem-----
3FCerignolaBrassica oleracea var. italicaParthenon2023Stem-----
3GACerignolaBrassica oleracea var. italicaParthenon2023Stem-----
3HCerignolaBrassica oleracea var. italicaParthenon2023Stem-----
5ECerignolaBrassica oleracea var. italicaMugnoli2023Stem PV920570PV952666---
6DCerignolaBrassica oleracea var. italicaMugnoli2023Stem-----
6EDFoggiaBrassica oleracea var. italicaParthenon2022Leaves -----
7GACerignolaBrassica oleracea var. italicaMugnoli2023Stem-----
7BCCerignolaBrassica oleracea var. italicaMugnoli2023Leaves -----
7DCerignolaBrassica oleracea var. italicaParthenon2022Leaves-----
7FCerignolaBrassica oleracea var. italicaMugnoli2023Leaves-----
9DCerignolaBrassica oleracea var. italicaParthenon2022Leaves-----
9EFCerignolaBrassica oleracea var. italicaParthenon2022Leaves-----
10HCerignolaBrassica oleracea var. italicaParthenon2022Leaves-----
11ACerignolaBrassica oleracea var. italicaParthenon2022Corymb-----
11DEFoggiaBrassica oleracea var. italicaParthenon2022Corymb-----
19ACerignolaBrassica oleracea var. italicaParthenon2022Corymb-----
4FGCerignolaBrassica rapa var. cymosa (Turnip)Centoventina2022StemPV920569PV952665---
10CCerignolaBrassica rapa var. cymosa (Turnip)Centoventina2022Stem-----
18BCerignolaBrassica rapa var. cymosa (Turnip)Centoventina2022Stem-----
19ECerignolaBrassica rapa var. cymosa (Turnip)Centoventina2022Leaves -----
23ACerignolaBrassica rapa var. cymosa (Turnip)Centoventina2022Leaves -----
Plectosphaerella cucumerina4FLuceraBrassica oleracea var. botrytisAkinen2023Corymb-----
6FLuceraBrassica oleracea var. botrytisAkinen2023Stem-----
11FLuceraBrassica oleracea var. botrytisAkinen2023Leaves -----
15FLuceraBrassica oleracea var. botrytisAkinen2023Leaves -----
19CLuceraBrassica oleracea var. botrytisAkinen2023Leaves -----
2GFoggiaBrassica oleracea var. italicaParthenon2022Leaves -----
4GCerignolaBrassica oleracea var. italicaParthenon2022Leaves -----
7BCCerignolaBrassica oleracea var. italicaMugnoli2023Leaves -----
11GCerignolaBrassica oleracea var. italicaParthenon2022Leaves -----
12BCerignolaBrassica oleracea var. italicaParthenon2022Leaves -----
13BCerignolaBrassica oleracea var. italicaMugnoli2023Leaves PV920675PV952639-PV929767-
14BCerignolaBrassica oleracea var. italicaMugnoli2023Stem -----
15ABCerignolaBrassica oleracea var. italicaMugnoli2023Stem-----
1ECerignolaBrassica rapa var. cymosa (Turnip)Centoventina2023Stem -----
2EFCerignolaBrassica rapa var. cymosa (Turnip)Centoventina2023Stem PV920674PV952638-PV929766-
7ECerignolaBrassica rapa var. cymosa (Turnip)Centoventina2023Stem -----
10ECerignolaBrassica rapa var. cymosa (Turnip)Centoventina2023Leaves -----
10EFCerignolaBrassica rapa var. cymosa (Turnip)Centoventina2023Leaves -----
12ECerignolaBrassica rapa var. cymosa (Turnip)Centoventina2023Leaves -----
13DFoggiaBrassica rapa var. cymosa (Turnip)Centoventina2023Corymb -----
P. pauciseptata6BFLuceraBrassica oleracea var. botrytisAprilia 2022Stem -----
9BCLuceraBrassica oleracea var. botrytisAkinen2022Leaves-----
C1ABLuceraBrassica oleracea var. botrytisAkinen2022Leaves -----
2ADCerignolaBrassica oleracea var. italicaMugnoli2023Leaves -----
2AECerignolaBrassica oleracea var. italicaMugnoli2023Leaves --- -
3BECerignolaBrassica oleracea var. italicaParthenon2022Stem-----
3FCerignolaBrassica oleracea var. italicaParthenon2022Stem-----
4BECerignolaBrassica oleracea var. italicaMugnoli2023Stem-----
5AFCerignolaBrassica oleracea var. italicaMugnoli2023LeavesPV920673PV952637-PV929765-
5BCCerignolaBrassica oleracea var. italicaParthenon2023Leaves-----
6BCCerignolaBrassica oleracea var. italicaParthenon2022Leaves-----
7BFCerignolaBrassica oleracea var. italicaParthenon2022Leaves-----
10AECerignolaBrassica oleracea var. italicaParthenon2023Leaves-----
C1ACerignolaBrassica oleracea var. italicaParthenon2022Leaves-----
C3ACerignolaBrassica oleracea var. italicaParthenon2023Leaves-----
1CCerignolaBrassica rapa var. cymosa (Turnip)Centoventina2022StemPV920672PV952636-PV929764-
3CACerignolaBrassica rapa var. cymosa (Turnip)Centoventina2022Leaves-----
9CFoggiaBrassica rapa var. cymosa (Turnip)Centoventina2022Leaves-----
16ACerignolaBrassica oleracea var. botrytisAkinen2022Stem PV920676PV952640 PV929768
18ALuceraBrassica oleracea var. botrytisAkinen2022Leaves-----
21ALuceraBrassica oleracea var. botrytisAkinen2022Leaves-----
P. plurivora14ACCerignolaBrassica oleracea var. italicaParthenon2022Stem -----
14CCerignolaBrassica oleracea var. italicaMugnoli2023Leaves-----
17CCerignolaBrassica oleracea var. italicaParthenon2022Leaves-----
20CCerignolaBrassica oleracea var. italicaMugnoli2023Leaves -----
18DCerignolaBrassica rapa var. cymosa (Turnip)Centoventina2022Stem PV920677PV952641-PV929769
22ACerignolaBrassica rapa var. cymosa (Turnip)Centoventina2022Leaves -----
Sclerotinia sclerotiorum1CCerignolaBrassica oleracea var. botrytisAkinen2022Corymb-----
3ELuceraBrassica oleracea var. botrytisAkinen2022Corymb-----
6CLuceraBrassica oleracea var. botrytisAkinen2022Corymb-----
12ABLuceraBrassica oleracea var. botrytisAkinen2022Corymb-----
14DLuceraBrassica oleracea var. botrytisAkinen2022Corymb-----
15BLuceraBrassica oleracea var. botrytisAkinen2022Corymb-----
17ACLuceraBrassica oleracea var. botrytisAkinen2022Corymb-----
18ELuceraBrassica oleracea var. botrytisAkinen2022Corymb-----
2FCerignolaBrassica oleracea var. italicaParthenon2022Corymb-----
3DCerignolaBrassica oleracea var. italicaParthenon2022Corymb-----
4CCerignolaBrassica oleracea var. italicaParthenon2022Corymb-----
11CFoggiaBrassica oleracea var. italicaParthenon2022Corymb-----
13FCerignolaBrassica oleracea var. italicaParthenon2022CorymbPV920572----
16DCerignolaBrassica oleracea var. italicaParthenon2022Corymb-----
4DCerignolaBrassica rapa var. cymosa (Turnip)Centoventina2023Corymb-----
5CDCerignolaBrassica rapa var. cymosa (Turnip)Centoventina2023CorymbPV920571----
7BCerignolaBrassica rapa var. cymosa (Turnip)Centoventina2023Corymb-----
Stemphylium vesicarium1BACerignolaBrassica oleracea var. italicaParthenon2022Leaves-----
2BACerignolaBrassica oleracea var. italicaMugnoli2023Leaves-----
3CLuceraBrassica oleracea var. botrytisAkinen2022Stem-----
3BAFoggiaBrassica oleracea var. italicaParthenon2022Leaves-----
6BCerignolaBrassica oleracea var. italicaMugnoli2023LeavesPV920566---PV942084
7CCerignolaBrassica oleracea var. italicaParthenon2022StemPV920567---PV942085
7DBCerignolaBrassica oleracea var. italicaParthenon2022Stem-----
Table 3. Fungal species from four common Brassicaceae species collected in Northern Apulia.
Table 3. Fungal species from four common Brassicaceae species collected in Northern Apulia.
No. of Isolates (IF, %)
Fungal Species IsolatedBrassica oleracea var. botrytis
“Cauliflower” (Sample Number = 4)
Brassica oleracea var. italica
“Broccoli” (n = 8)
Brassica oleracea var. italica
“Mugnoli” (n = 5)
Brassica rapa var. cymosa
“Turnip” (n = 5)
Total (n = 22)
StemLeafCorymbSubtotalStemLeafCorymbSubtotalStemLeafCorymbSubtotalStemLeafCorymbSubtotal
A. alternata3 (7.5)3 (7.5)0 (0.0)6 (15.0)1 (0.7)5 (3.3)0 (0.0)6 (4.0)0 (0.0)6 (9.0)0 (0.0)6 (9.0)0 (0.0)3 (4.2)0 (0.0)3 (4.2)21 (6.4)
A. brassicicola0 (0.0)1 (2.5)0 (0.0)1 (2.5)3 (2.0)4 (2.6)0 (0.0)7 (4.6)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)8 (2.4)
A. japonica0 (0.0)0 (0.0)0 (0.0)0 (0.0)1 (0.7)0 (0.0)0 (0.0)1 (0.7)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)1 (0.3)
Alternaria spp. 0 (0.0)2 (5.0)0 (0.0)2 (5.0)3 (2.0)6 (4.0)2 (1.3)11 (7.3)0 (0.0)2 (3.0)0 (0.0)2 (3.0)0 (0.0)1 (1.4)0 (0.0)1 (1.4)16 (4.8)
S. vesicarium1 (2.5)0 (0.0)0 (0.0)1 (2.5)2 (1.3)2 (1.3)0 (0.0)4 (2.6)0 (0.0)2 (3.0)0 (0.0)2 (3.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)7 (2.1)
Subtotal Alternaria/Stemphylium spp.4 (10.0)6 (15.0)0 (0.0)10 (25.0)10 (6.7)17 (11.2)2 (1.3)29 (19.2)0 (0.0)10 (15.0)0 (0.0)10 (15.0)0 (0.0)4 (5.6)0 (0.0)4 (5.6)53 (16.0)
P. cucumerina1 (2.5)3 (7.5)1 (2.5)5 (12.5)0 (0.0)4 (2.6)0 (0.0)4 (2.6)2 (3.0)2 (3.0)0 (0.0)4 (6.0)3 (4.2)3 (4.2)1 (1.4)7 (9.7)20 (6.1)
P. pauciseptata1 (2.5)2 (5.0)0 (0.0)3 (7.5)2 (1.3)6 (4.0)0 (0.0)8 (5.3)1 (1.5)3 (4.5)0 (0.0)4 (6.0)1 (1.4)2 (2.8)0 (0.0)3 (4.2)18 (5.5)
P. plurivora1 (2.5)2 (5.0)0 (0.0)3 (7.5)1 (0.7)1 (0.7)0 (0.0)2 (1.3)1 (1.5)1 (1.5)0 (0.0)2 (3.0)1 (1.4)1 (1.4)0 (0.0)2 (2.8)9 (2.7)
Subtotal Plectosphaerella spp.3 (7.5)7 (17.5)1 (2.5)11 (27.5)3 (2.0)11 (7.3)0 (0.0)14 (9.2)3 (4.5)6 (9.0)0 (0.0)9 (13.5)5 (6.6)6 (7.0)1 (1.4)12 (16.7)47 (14.2)
F. solani species complex1 (2.5)0 (0.0)0 (0.0)1 (2.5)6 (4.0)5 (3.3)3 (2.0)14 (9.3)3 (4.5)2 (3.0)0 (0.0)5 (7.5)3 (4.2)2 (2.8)0 (0.0)5 (6.9)25 (7.6)
S. sclerotiorum0 (0.0)0 (0.0)8 (20.0)8 (20.0)0 (0.0)0 (0.0)6 (4.0)6 (4.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)3 (4.2)3 (4.2)17 (5.2)
Aspergillus spp.0 (0.0)1 (2.5)1 (2.5)2 (5.0)5 (3.3)8 (5.3)9 (6.0)22 (14.6)0 (0.0)3 (4.5)3 (4.5)6 (9.0)1 (1.4)3 (4.2)2 (2.8)6 (8.3)36 (10.9)
Epicoccum spp.1 (2.5)1 (2.5)0 (0.0)2 (5.0)3 (2.0)7 (4.6)6 (4.0)16 (10.6)0 (0.0)4 (6.0)3 (4.5)7 (10.4)1 (1.4)5 (6.9)2 (2.8)8 (11.1)33 (10.0)
Penicillium spp.0 (0.0)1 (2.5)2 (5.0)3 (7.5)7 (4.6)8 (5.3)11 (7.3)26 (17.2)0 (0.0)4 (6.0)4 (6.0)8 (11.9)2 (2.8)3 (4.2)6 (8.3)11 (15.3)48 (14.5)
Total fungi9 (22.5)16 (40.0)12 (30.0)37 (92.5)34 (22.5)56 (37.1)37 (24.5)127 (84.1)6 (8.9)29 (43.2)11 (16.5)46 (68.6)12 (16.6)23 (32.0)14 (19.5)49 (68.1)259 (78.5)
Opportunistic bacteria1 (2.5)0 (0.0)1 (2.5)2 (5.0)0 (0.0)5 (3.3)2 (1.3)7 (4.6)0 (0.0)6 (9.0)0 (0.0)6 (9.0)3 (4.2)5 (6.9)0 (0.0)8 (11.1)23 (7.0)
No growth0 (0.0)0 (0.0)1 (2.5)1 (2.5)2 (1.3)7 (4.6)8 (5.3)17 (11.3)2 (3.0)5 (7.5)8 (11.9)15 (22.4)3 (4.2)5 (6.9)7 (9.7)15 (20.8)48 (14.5)
Total10 (25.0)16 (40.0)14 (35.0)40 (100.0)36 (23.8)68 (45.0)47 (31.1)151 (100.0)8 (11.9)40 (59.7)19 (28.4)67 (100.0)18 (25.0)33 (45.8)21 (29.2)72 (100.0)330 (100.0)
Table 4. Detailed characteristics of individual region/gene and the best model selected for each gene in the multigenic analyses.
Table 4. Detailed characteristics of individual region/gene and the best model selected for each gene in the multigenic analyses.
LocusNo. of SequencesNo. of CharactersParsimony-InformativeConstantUniqueModel
AlternariaITS1445709743043GTR + I + G
tef-1α14034411718443SYM + G
Alt a1109147854616HKY + I + G
rpb214678024746370SYM + I + G
Total 18415461123172-
StemphyliumITS305646548910K2P + I
gapdh305821174587K2P + G4
Total 114618294717-
PlectosphaerellaITS445296744616TN + F + I + G4
tef-1α4474917752646TIM3 + F + I + G4
rpb2441284221946117TN + F + I + G4
Total 25624651918179-
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Mourou, M.; Raimondo, M.L.; Spetik, M.; Lops, F.; Ricciardi, G.; Morea, M.G.; Eichmeier, A.; Carlucci, A. Diversity of Fungi Associated with Diseases of Cultivated Brassicaceae in Southern Italy. J. Fungi 2026, 12, 13. https://doi.org/10.3390/jof12010013

AMA Style

Mourou M, Raimondo ML, Spetik M, Lops F, Ricciardi G, Morea MG, Eichmeier A, Carlucci A. Diversity of Fungi Associated with Diseases of Cultivated Brassicaceae in Southern Italy. Journal of Fungi. 2026; 12(1):13. https://doi.org/10.3390/jof12010013

Chicago/Turabian Style

Mourou, Marwa, Maria Luisa Raimondo, Milan Spetik, Francesco Lops, Gaetana Ricciardi, Maria Grazia Morea, Ales Eichmeier, and Antonia Carlucci. 2026. "Diversity of Fungi Associated with Diseases of Cultivated Brassicaceae in Southern Italy" Journal of Fungi 12, no. 1: 13. https://doi.org/10.3390/jof12010013

APA Style

Mourou, M., Raimondo, M. L., Spetik, M., Lops, F., Ricciardi, G., Morea, M. G., Eichmeier, A., & Carlucci, A. (2026). Diversity of Fungi Associated with Diseases of Cultivated Brassicaceae in Southern Italy. Journal of Fungi, 12(1), 13. https://doi.org/10.3390/jof12010013

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop