Morphological and Phylogenetic Analyses Reveal Dictyostelids (Cellular Slime Molds) Colonizing the Ascocarp of Morchella
Abstract
1. Introduction
2. Materials and Methods
2.1. Specimens
2.2. Morphological Study of Dictyostelids
2.2.1. Macroscopic Morphological Observation
2.2.2. Microscopic Morphological Observation
2.3. DNA Extraction, Sequencing, and Phylogenetic Analyses
3. Results
3.1. Molecular Phylogenetic Analysis of the Morchella Specimen
3.2. Morphological Observation of Dictyostelids
- Dictyostelium sp.
3.3. Molecular Phylogenetic Analysis of Dictyostelium Implicatum Specimens
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Du, X.H.; Zhao, Q.; Yang, Z.L. A review on research advances, issues, and perspectives of morels. Mycology 2015, 6, 78–85. [Google Scholar] [CrossRef] [PubMed]
- Tian, J.F.; Shang, Y.; Xiao, Z.N. Research progress on nutrient composition, function and processing of morels. Sci. Technol. Food Ind. 2023, 45, 419–428. [Google Scholar]
- Li, Y.T.; Chen, H.Y.; Zhang, X. Cultivation, nutritional value, bioactive compounds of morels, and their health benefits: A systematic review. Front. Nutr. 2023, 10, 1159029. [Google Scholar] [CrossRef]
- Jiang, K.; Li, L.; Yang, Z.; Chen, H.; Qin, Y.; Brennan, C. Variable characteristics of microbial communities and volatile organic compounds during post-harvest storage of wild morel mushrooms. Postharvest Biol. Technol. 2023, 203, 112401. [Google Scholar] [CrossRef]
- Liu, W.; Chen, L.F.; Cai, Y.L.; Zhang, Q.Q.; Bian, Y.B. Opposite polarity monospore genome de novo sequencing and comparative analysis reveal the possible heterothallic life cycle of Morchella importuna. Int. J. Mol. Sci. 2018, 19, 2525. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.Y.; Tang, J.; Wang, Y.; He, X.L.; Tan, H.; Yu, Y.; Chen, Y.; Peng, W.H. Large scale commercial cultivation of morels: Current state and perspectives. Appl. Microbiol. Biot. 2022, 106, 4401–4412. [Google Scholar] [CrossRef]
- Du, X.H.; Yang, Z.L. Mating systems in true morels (Morchella). Microbiol. Mol. Biol. Rev. 2021, 85, e0022020. [Google Scholar] [CrossRef]
- Fu, Y.W.; Wu, H.H.; Wang, S.; Yu, Q.; Tian, D.S.; Xu, X. First report of Trichoderma atroviride causing rot of Morchella sextelata in Anhui Province, China. Crop Prot. 2023, 168, 106206. [Google Scholar] [CrossRef]
- Gupta, S.; Saxena, S. Endophytes: Saviour of apples from post-harvest fungal pathogens. Biol. Control 2023, 182, 105234. [Google Scholar] [CrossRef]
- Masaphy, S. First report on Purpureocillium lilacinum infection of indoor-cultivated morel primordia. Agriculture 2022, 12, 695. [Google Scholar] [CrossRef]
- Shi, X.F.; Liu, D.; He, X.H.; Liu, W.; Yu, F.Q. Epidemic identification of fungal diseases in Morchella cultivation across China. J. Fungi 2022, 8, 1107. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.X.; Peng, J.Y.; Sun, L.; Bonito, G.; Guo, Y.X.; Li, Y.; Fu, Y.P. Genome sequencing of Paecilomyces Penicillatus provides insights into its phylogenetic placement and mycoparasitism mechanisms on morel mushrooms. Pathogens 2020, 9, 834. [Google Scholar] [CrossRef] [PubMed]
- Wei, Y.F.; Fu, M.H.; Li, W.L.; Luo, Y.; Zhang, Y.T.; Sun, W.L.; Zou, J. First report on apothecium deformity of Morchella importuna caused by Alternaria alternata in China. Plant Dis. 2024, 108, 1398. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.; Yang, C.B.; Wang, S.; Jiao, C.Y.; Sun, J.Z.; Fan, X.Y.; Wang, X.J.; Xiang, W.S.; Zhao, J.W. Penicillium raperi causes rot disease on Morchella sextelata in Heilongjiang Province, China. Crop Prot. 2024, 175, 106479. [Google Scholar] [CrossRef]
- Zhu, X.T.; Ma, K.L.; Sun, M.Y.; Zhang, J.M.; Liu, L.J.; Niu, S.Q. Isolation and identification of pathogens of Morchella sextelata bacterial disease. Front. Microbiol. 2023, 14, 1231353. [Google Scholar] [CrossRef]
- Guo, M.P.; Chen, K.; Wang, G.Z.; Bian, Y.B. First report of stipe rot disease on Morchella importuna caused by Fusarium incarnatum–F. equiseti species complex in China. Plant Dis. 2016, 100, 2530. [Google Scholar] [CrossRef]
- He, P.X.; Li, C.C.; Cai, Y.L.; Ya, Z.; Bian, Y.B.; Liu, W. First report of pileus rot disease on cultivated Morchella importuna caused by Diploöspora longispora in China. J. Gen. Plant Pathol. 2018, 84, 65–69. [Google Scholar] [CrossRef]
- Hyde, K.D.; Maharachchikumbura SS, N.; Hongsanan, S.; Samarakoon, M.C.; Lücking, R.; Pem, D.; Harishchandra, D.; Jeewon, R.; Zhao, R.L.; Xu, J.C.; et al. The ranking of fungi: A tribute to David L. Hawksworth on his 70th birthday. Fungal Divers. 2017, 84, 1–23. [Google Scholar] [CrossRef]
- Liu, J.M.; Feng, J.C.; Wu, Z.T.; Yang, X.Z. Study on pathogen identification and biological morel of Morchella white mold disease in Hexi area. North. Hortic. 2023, 116–123. [Google Scholar]
- Tu, S.; Zhang, Y.; Chen, X.; Song, L.; Lv, B.; Chen, Y. First report of Aspergillus niger causing rot of Morchella sextelata in China. Plant Dis. 2024, 108, 804. [Google Scholar] [CrossRef]
- Yu, F.M.; Jayawardena, R.S.; Luangharn, T.; Zeng, X.Y.; Li, C.J.Y.; Bao, S.X.; Ba, H.; Zhou, D.Q.; Tang, S.M.; Hyde, K.D.; et al. Species diversity of fungal pathogens on cultivated mushrooms: A case study on morels (Morchella, Pezizales). Fungal Divers. 2024, 125, 157–220. [Google Scholar] [CrossRef]
- Liu, W.; Cai, Y.L.; He, P.X.; Ma, X.L.; Bian, Y.B. Occurrence and control of pests and diseases in field cultivation of Morchella mushrooms. Acta Edulis Fungi 2019, 26, 128–134. [Google Scholar]
- Lv, B.; Yu, S.; Chen, Y.; Yu, H.; Mo, Q. First report of Lecanicillium aphanocladii causing rot of Morchella sextelata in China. Plant Dis. 2022, 106, 3202. [Google Scholar] [CrossRef] [PubMed]
- Peng, B.; Bian, Y.B.; Gong, Y.H.; Xiao, Y. Diseases of Morchella and their comprehensive prevention and control techniques. Edible Med. Mushrooms 2024, 32, 129–135. [Google Scholar]
- Zhao, Q.; Lü, M.L.; Li, L.; Huang, W.; Zhang, Y.F.; Hao, Z. Temptation and trap of morel industry in China. J. Fungal Res. 2021, 19, 1232–1237. [Google Scholar]
- Sun, J.Z.; Yu, S.; Lu, Y.Z.; Liu, H.W.; Liu, X.Z. Proposal of a new family Pseudodiploösporeaceae fam. nov. (Hypocreales) based on phylogeny of Diploöspora longispora and Paecilomyces penicillatus. Mycology 2022, 14, 60–73. [Google Scholar] [CrossRef]
- Liu, Q.Z.; Ma, H.S.; Zhang, Y.; Dong, C.H. Artificial cultivation of true morels: Current state, issues and perspectives. Crit. Rev. Biotechnol. 2018, 38, 259–271. [Google Scholar] [CrossRef]
- Liu, Z.H.; Cong, Y.L.; Sossah, F.L.; Lu, Y.Z.; Kang, J.C.; Li, Y. Characterization and genome analysis of Cladobotryum mycophilum, the causal agent of cobweb disease of Morchella sextelata in China. J. Fungi 2023, 9, 411. [Google Scholar] [CrossRef]
- He, X.S.; Wang, J.; Wang, Y.P.; Li, X.Y.; Wang, Y.Z.; Zhu, X.Q.; Zhou, L.; Zhao, M.; Zhang, N.; Xie, J.Y. The high-yield operating procedures of morels cultivation in southwest China. Edible Med. Mushrooms 2020, 28, 454–460. [Google Scholar]
- Li, S.; Dou, W.J.; Peng, X.Y.; Wang, Q.; Li, Y. Research progress of Myxomycetes resources in China. J. Fungal Res. 2023, 21, 93–102. [Google Scholar]
- Adl, S.M.; Leander, B.S.; Simpson AG, B.; Archibald, J.M.; Anderson, O.R.; Bass, D.; Bowser, S.S.; Brugerolle, G.; Farmer, M.A.; Karpov, S.; et al. Diversity, nomenclature, and taxonomy of protists. Syst. Biol. 2007, 56, 684–689. [Google Scholar] [CrossRef] [PubMed]
- Cavalier-Smith, T. Protist phylogeny and the high-level classification of Protozoa. Eur. J. Protistol. 2003, 39, 338–348. [Google Scholar] [CrossRef]
- Cavalier-Smith, T.; Chao, E.E.Y. Phylogeny and megasystematics of phagotrophic heterokonts (kingdom Chromista). J. Mol. Evol. 2006, 62, 388–420. [Google Scholar] [CrossRef]
- Chen, S.L. The taxonomic history of Myxomycetes (Myxogastrea). Mycosystema 2023, 42, 38–49. [Google Scholar]
- Ruggiero, M.A.; Gordon, D.P.; Orrell, T.M.; Bailly, N.; Bourgoin, T.; Brusca, R.C.; Cavalier-Smith, T.; Guiry, M.D.; Kirk, P.M. A higher level classification of all living organisms. PLoS ONE 2015, 10, e0119248. [Google Scholar]
- Howard, F.L.; Currie, M.E. Parasitism of myxomycete plasmodia on fungous mycelia. J. Arnold Arbor. 1932, 13, 438–447. [Google Scholar] [CrossRef]
- Michalczyk-Wetula, D.; Jakubowska, M.; Felska, M.; Skarżyński, D.; Mąkol, J.; Płonka, P.M. Tyrophagus putrescentiae (Sarcoptiformes: Acaridae) in the in vitro cultures of slime molds (Mycetozoa): Accident, contamination, or interaction? Exp. Appl. Acarol. 2021, 84, 445–458. [Google Scholar] [CrossRef] [PubMed]
- Stephenson, S.L.; Feest, A. Ecology of soil eumycetozoans. Acta Protozool. 2012, 51, 201–208. [Google Scholar]
- Zhang, Z.J.; Zhai, C.; Li, Y.; Stephenson, S.L.; Liu, P. Slime molds (Myxomycetes) causing a “disease” in crop plants and cultivated mushrooms. Front. Plant Sci. 2024, 15, 1411231. [Google Scholar] [CrossRef]
- Cubeta, M.A.; Cody, B.; Williams, P.H. First report of Plasmodiophora brassicae on cabbage in eastern North Carolina. Plant Dis. 1998, 82, 129. [Google Scholar] [CrossRef]
- Ledingham, G.A. Studies on Polymyxa graminis, n. gen.; n. sp.; a plasmodiophoraceous root parasite of wheat. Can. J. Res. 1939, 17, 38–51. [Google Scholar] [CrossRef]
- Lee, J.H.; Kim, D.R.; Kwak, Y.S. First report of Stemonitis splendens Rostaf causing bark decay of oak logs used for shiitake cultivation in Korea. Mycobiology 2014, 42, 279–281. [Google Scholar] [CrossRef]
- Li, Y.S.; Zhang, B.; Jiang, S.C.; Hsiang, T.; Li, Y.; Wang, X.L. First report of Physarella oblonga on Lentinula edodes in China. Plant Dis. 2017, 101, 2146. [Google Scholar] [CrossRef]
- Zhang, B.; Li, S.; Li, H.M.; Li, Y. First report of a new myxogastria (Stemonaria longa) causing rot disease on shiitake logs (Lentinula edodes) in China. Plant Dis. 2017, 102, 1032. [Google Scholar] [CrossRef]
- Liu, P.; Zou, Y.; Hou, J.; Stephenson, S.L.; Li, Y. Dictyostelium purpureum var. pseudosessile, a new variant of dictyostelid from tropical China. BMC Evol. Biol. 2019, 19, 78. [Google Scholar]
- Liu, P.; Zhang, S.; Zou, Y.; Li, Z.; Stephenson, S.L.; Li, Y. Distribution and ecology of dictyostelids in China. Fungal Biol. Rev. 2020, 34, 170–177. [Google Scholar] [CrossRef]
- Zhang, Z.; Yang, Y.; Zhao, J.; Li, Y.; Stephenson, S.L.; Qiu, J.; Liu, P. Environmental factors influencing the diversity and distribution of dictyostelid cellular slime molds in forest and farmland soils of western China. Microbio. Spectr. 2023, 11, e0173223. [Google Scholar] [CrossRef]
- Zou, Y.; Liu, P. Research progress on ecology of dictyostelid cellular slime molds. Mycosystema 2023, 42, 160–169. [Google Scholar]
- Li, Y.; Wang, Q.; Li, S. Development of myxomycetology. Mycosystema 2021, 40, 261–269. [Google Scholar]
- Zhou, Y. Biodiversity of Dictyostelid Cellular Slime Molds in Different Habitat Gradients of Changbai Mountain. Master’s Dissertation, Jilin Agricultural University, Jilin, China, 1 May 2019. [Google Scholar]
- Du, X.H.; Zhao, Q.; O’Donnell, K.; Rooney, A.P.; Yang, Z.L. Multigene molecular phylogenetics reveals true morels (Morchella) are especially species-rich in China. Fungal Genet. Biol. 2012, 49, 455–469. [Google Scholar] [CrossRef]
- White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, H.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: San Diego, CA, USA, 1990; Volume 8, pp. 315–322. [Google Scholar]
- An, Y.; Li, Y. Molecular phylogeny of dictyostelid cellular slime molds from China. J. Jilin Agric. Univ. 2019, 41, 294–302. [Google Scholar]
- Kauserud, H.; Schumacher, T. Outcrossing or inbreeding: DNA markers provide evidence for type of reproductive mode in Phellinus nigrolimitatus (Basidiomycota). Mycol. Res. 2001, 105, 676–683. [Google Scholar] [CrossRef]
- Rehner, S.A.; Buckley, E. A Beauveria phylogeny inferred from nuclear ITS and EF1-α sequences: Evidence for cryptic diversification and links to Cordyceps teleomorphs. Mycologia 2005, 97, 84–98. [Google Scholar] [CrossRef] [PubMed]
- Gardes, M.; Bruns, T.D. ITS primers with enhanced specificity for basidiomycetes-application to the identification of mycorrhizae and rusts. Mol. Ecol. 1993, 2, 113–118. [Google Scholar] [CrossRef]
- Du, X.H.; Wu, D.M.; He, G.Q.; Wei, W.; Xu, N.; Li, T.L. Six new species and two new records of Morchella in China using phylogenetic and morphological analyses. Mycologia 2019, 111, 857–870. [Google Scholar] [CrossRef]
- Katoh, K.; Misawa, K.; Kuma, K.; Miyata, T. MAFFT: A novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res. 2002, 30, 3059–3066. [Google Scholar] [CrossRef]
- Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- Stamatakis, A. RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 2014, 30, 1312–1313. [Google Scholar] [CrossRef] [PubMed]
- Ronquist, F.; Teslenko, M.; Van Der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef]
- Posada, D. ModelTest server: A web-based tool for the statistical selection of models of nucleotide substitution online. Nucleic Acids Res. 2006, 34, W700–W703. [Google Scholar] [CrossRef]
- O’Donnell, K.; Rooney, A.P.; Mills, G.L.; Kuo, M.; Weber, N.S.; Rehner, S.A. Phylogeny and historical biogeography of true morels (Morchella) reveals an early Cretaceous origin and high continental endemism and provincialism in the Holarctic. Fungal Genet. Biol. 2011, 48, 252–265. [Google Scholar] [CrossRef] [PubMed]
- Schaap, P.; Winckler, T.; Nelson, M.; Alvarez-Curto, E.; Elgie, B.; Hagiwara, H.; Cavender, J.; Milano-Curto, A.; Rozen, D.E.; Dingermann, T.; et al. Molecular phylogeny and evolution of morphology in the social amoebas. Science 2006, 314, 661–663. [Google Scholar] [CrossRef] [PubMed]
- Sun, J.Y. Studies on the Life Cycle of Important Taxa in Dictyosteliaceae. Master’s Dissertation, Jilin Agricultural University, Jilin, China, 1 June 2011. [Google Scholar]
- Cavender, J.C. Dictyostelium dimigraformum, Dictyostelium laterosorum and Acytostelium ellipticum: New Acrasieae from the American tropics. J. Gen. Microbiol. 1970, 62, 113–123. [Google Scholar] [CrossRef]
- Cavender, J.C.; Lakhanpal, T.N. Distribution of dictyostelid cellular slime molds in forest soils of India. Mycologia 1986, 78, 56–65. [Google Scholar] [CrossRef]
- Cavender, J.C.; Cavender-Bares, J.; Hohl, H.R. Ecological distribution of cellular slime molds in forest soils of Germany. Bot. Helv. 1995, 105, 199–219. [Google Scholar]
- Cavender, J.C.; Vadell, E.M.; Perrigo, A.L.; Landolt, J.C.; Stephenson, S.L.; Liu, P. Four new species of dictyostelids from soil systems in northern Thailand. J. Fungi 2022, 8, 593. [Google Scholar] [CrossRef]
- Hagiwara, H. The Taxonomic Study of Japanese Dictyostelid Cellular Slime Molds; National Science Museum Monographs: Tokyo, Japan, 1989; pp. 1–128. [Google Scholar]
- Hagiwara, H. Dictyostelid cellular some molds of Pakistan. I. Distribution and occurrence in soils of forests, cultivated fields and alpine pastures. In Cryptogamic Flora of Pakistan; Nakaike, T., Malik, S., Eds.; Bulletin of the National Science Museum: Tokyo, Japan, 1992; Volume 1, pp. 87–98. [Google Scholar]
- Liu, P.; Li, Y. New species and new records of dictyostelids from Ukraine. Mycologia 2011, 103, 641–645. [Google Scholar] [CrossRef]
- Liu, P.; Zou, Y.; Li, S.; Stephenson, S.L.; Wang, Q.; Li, Y. Two new species of dictyostelid cellular slime molds in high-elevation habitats on the Qinghai-Tibet Plateau, China. Sci. Rep. 2019, 9, 5. [Google Scholar] [CrossRef]
- Liu, P.; Zou, Y.; Li, W.; Li, Y.; Li, X.; Che, S.; Stephenson, S.L. Dictyostelid cellular slime molds from Christmas Island, Indian Ocean. Msphere 2019, 4, 10–1128. [Google Scholar] [CrossRef]
- Hong, J.S.; Chang, N.K. A new species of cellular slime molds from Korea, Dictyostelium flavidum sp. nov. J. Plant Biol. 1992, 35, 393–401. [Google Scholar]
- Zhao, M.J. Studies on Taxonomy of Dictyostelid Cellular Slime Molds of Eastern China. Master’s Dissertation, Jilin Agricultural University, Jilin, China, 1 May 2014. [Google Scholar]
- Zou, Y.; Hou, J.; Guo, S.; Li, C.; Li, Z.; Stephenson, S.L.; Pavlov, I.N.; Liu, P.; Li, Y. Diversity of dictyostelid cellular slime molds, including two species new to science, in forest soils of Changbai Mountain, China. Microbiol. Spectr. 2022, 10, e0240222. [Google Scholar] [CrossRef] [PubMed]
- He, X.L. Preliminary Taxonomy Studies on Dictyosteliaceae in China. Master’s Dissertation, Jilin Agricultural University, Jilin, China, 1 June 2008. [Google Scholar]
- Bai, R.L. Preliminary study of Acrasiomycetes. Mycosystema 1983, 2, 173–178. [Google Scholar]
- Hagiwara, H.; Yeh, Z.Y.; Chien, C.Y. Dictyostelium macrocephalum, a new dictyostelid cellular slime mold from Taiwan. Bull. Natl. Sci. Mus. Ser. B 1985, 11, 103–108. [Google Scholar]
- Li, C. Studies on Taxonomy of Dictyostelid Cellular Slime Molds in Henan and Hunan Provinces. Master’s Dissertation, Jilin Agricultural University, Jilin, China, 29 May 2013. [Google Scholar]
- Ren, Y.Z. Studies on Distribution of Dictyostelid Cellular Slime Molds in the Tropic and Frigid Zone of China. Master’s Dissertation, Jilin Agricultural University, Jilin, China, 31 May 2013. [Google Scholar]
- Yuan, H.Y. Studies on Taxonomy of Dictyostelid Cellular Slime Molds in the Southwest of China. Master’s Dissertation, Jilin Agricultural University, Jilin, China, 28 May 2013. [Google Scholar]
- McCarroll, R.; Olsen, G.J.; Stahl, Y.D.; Woese, C.R.; Sogin, M.L. Nucleotide sequence of the Dictyostelium discoideum small-subunit ribosomal ribonucleic acid inferred from the gene sequence: Evolutionary implications. Biochemistry 1983, 22, 5858–5868. [Google Scholar] [CrossRef]
- Triviños-Lagos, L.; Ohmachi, T.; Albrightson, C.; Burns, R.G.; Ennis, H.L.; Chisholm, R.L. The highly divergent α- and β-tubulins from Dictyostelium discoideum are encoded by single genes. J. Cell Sci. 1993, 105, 903–912. [Google Scholar] [CrossRef]
- Romeralo, M.; Spiegel, F.W.; Baldauf, S.L. A fully resolved phylogeny of the social amoebas (Dictyostelia) based on combined SSU and ITS rDNA sequences. Protist 2010, 161, 539–548. [Google Scholar] [CrossRef] [PubMed]
- Romeralo, M.; Cavender, J.C.; Landolt, J.C.; Stephenson, S.L.; Baldauf, S.L. An expanded phylogeny of social amoebas (Dictyostelia) shows increasing diversity and new morphological patterns. BMC Evol. Biol. 2011, 11, 1–10. [Google Scholar] [CrossRef] [PubMed]
- NCBI Taxonomy: A Comprehensive Update on Curation, Resources and Tools. Database 2020, 2020, baaa062. [CrossRef]
- An, Y. Studies on Multigene and Fatty-Acids Biomarker in Representative Genera Taxonomy of Dictyostelid Cellular Slime Molds. Ph.D. Dissertation, Jilin Agricultural University, Jilin, China, 2 December 2015. [Google Scholar]
- Du, X.H. Review on species resources, reproductive modes and genetic diversity of black morels. J. Fungal Res. 2019, 17, 240–251. [Google Scholar]
- Cai, Y.L.; Ma, X.L.; Lu, D.X.; Zhang, Y.; Liu, W. Phylogenetic analysis and domestication of wild morel Mel-21. Acta Edulis Fungi 2020, 27, 23–29. [Google Scholar]
- Romeralo, M.; Fiz-Palacios, O.; Lado, C.; Cavender, J.C. A new concept for Dictyostelium sphaerocephalum based on morphology and phylogenetic analysis of nuclear ribosomal internal transcribed spacer region sequences. J. Can. Bot. 2007, 85, 104–110. [Google Scholar] [CrossRef][Green Version]
- Romeralo, M.A.; Escalante, R.; Sastre, L.; Lado, C. Molecular systematics of dictyostelids: 5.8S ribosomal DNA and internal transcribed spacer region analyses. Eukaryot. Cell 2007, 6, 110–116. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Sheikh, S.; Thulin, M.; Cavender, J.C.; Escalante, R.; Kawakami, S.I.; Lado, C.; Landolt, J.C.; Nanjundiah, V.; Queller, D.C.; Strassmann, J.E.; et al. A new classification of the dictyostelids. Protist 2018, 169, 1–28. [Google Scholar] [CrossRef] [PubMed]





| Locus | Primer | Sequence (5′-3′) | Taxon | Reference |
|---|---|---|---|---|
| 18S rRNA | NS1 | GTAGTCATATGCTTGTCTC | Dictyostelium | [52] |
| NS2 | GGCTGCTGGCACCAGACTTGC | |||
| EF1-a | EF-595F | CGTGACTTCATCAAGAACATG | Morchella | [54] |
| EF-1R | GGARGGAAYCATCTTGACGA | [51] | ||
| ITS rDNA | ITS1F | CTTGGTCATTTAGAGGAAGTAA | Morchella | [56] |
| ITS4 | TCCTCCGCTTATTGATATGC | [52] | ||
| RPB1 | RPB1B-F | AACCGGTATATCACGTYGGTAT | Morchella | [51] |
| RPB1B-R | GCCTCRAATTCGTTGACRACGT | |||
| RPB2 | RPB2B-F | TAGGTAGGTCCCAAGAACACC | Morchella | [51] |
| RPB2B-R | GATACCATGGCGAACATTCTG |
| Gene | PCR Program |
|---|---|
| 18S rRNA | 2′ −98 °C, 35× (10″ −98 °C, 10″ −45 °C, 20″ −72 °C), 10′ −72 °C |
| EF1-a | 2′ −98 °C, 35× (10″ −98 °C, 10″ −50 °C, 90″ −72 °C), 10′ −72 °C |
| ITS | 2′ −98 °C, 35× (10″ −98 °C, 10″ −50 °C, 20″ −72 °C), 10′ −72 °C |
| RPB1 | 2′ −98 °C, 35× (10″ −98 °C, 10″ −50 °C, 90″ −72 °C), 10′ −72 °C |
| RPB2 | 2′ −98 °C, 35× (10″ −98 °C, 10″ −50 °C, 90″ −72 °C), 10′ −72 °C |
| Species | Voucher | Locality | GenBank Accession Number |
|---|---|---|---|
| 18S rRNA | |||
| Acytostelium anastomosans | PP1 | America | AM168115 |
| A. amazonicum | HN1B1 | Honduras | HQ141511 |
| A. digitatum | OH517 | America | AM168114 |
| A. leptosomum | 212rjb | Portugal | HQ141512 |
| A. longisorophorum | DB10A | America | AM168109 |
| A. magnisorum | 08A | America | HQ141513 |
| A. serpentarium | SAB3A | America | AM168113 |
| A. singulare | FDIB | America | HQ141514 |
| A. subglobosum | LB1 | America | AM168110 |
| Dictyostelium aureum | SL1 | America | AM168028 |
| D. australe | NZ80B | New Zealand | AM168029 |
| D. bifurcatum | UK5 | America | AM168084 |
| D. brefeldianum | TNS-C-115 | Japan | AM168030 |
| D. brunneum | WS700 | America | AM168031 |
| D. capitatum | 91HO-50 | Japan | AM168032 |
| D. caveatum | WS695 | America | AM168077 |
| D. coeruleo-stipes | CRLC53B | America | AM168036 |
| D. crassicaule | 93HO-33 | Japan | AM168037 |
| D. delicatum | TNS-C-226 | Japan | AM168093 |
| D. deminutivum | MexM19A | America | AM168092 |
| D. discoideum | V34 | America | AM168039 |
| M1A | Costa Rica | KJ394476 | |
| D. exiguum | TNS-C-199 | Japan | AM168085 |
| D. gloeosporum | TCK52 | Japan | AM168074 |
| D. gracile | TNS-C-183 | Japan | AM168078 |
| D. implicatum | 93HO-1 | Japan | AM168043 |
| H1054 | China | PP658424 | |
| D. lacteum | / 1 | France | AM168045 |
| D. laterosorum | AE4 | America | AM168046 |
| D. longosporum | TNS-C-109 | Japan | AM168048 |
| D. macrocephalum | B33 | Japan | AM168049 |
| D. medium | TNS-C-205 | Japan | AM168050 |
| D. medusoides | OH592 | America | AM168088 |
| D. microsporum | TNS-C-38 | Japan | AM168090 |
| D. minutum | Boots_07_A1 | America | JN590753 |
| Boots_07_B1 | America | JN590758 | |
| D. monochasioides | HAG653 | Japan | AM168052 |
| D. mucoroides | Ice211A1 | Sweden | KC865597 |
| D. polycarpum | OhioWILDS | America | AM168058 |
| D. polycephalum | AP | India | GU562439 |
| D. potamoides | FP1A | America | AM168069 |
| D. pseudobrefeldianum | 91HO-8 | Japan | AM168059 |
| D. purpureum | cavender | America | HQ141481 |
| D. rhizopodium | AusKY-4 | Japan | AM168063 |
| D. rosarium | M45 | America | AM168065 |
| D. septentrionalis | AK2 | America | AM168067 |
| D.sphaerocephalum | Ice241A1 | America | KC865595 |
| Boots_14_A2 | America | JN590756 | |
| Boots_07_A2 | America | JN590754 | |
| Lamproderma puncticulatum | 162 | Switzerland | HQ687202 |
| Polysphondylium anisocaule | NZ47B | New Zealand | AM168096 |
| P. asymetricum | HN20C | Honduras | HQ141503 |
| P. australicum | NB1AP | Australia | HQ141508 |
| P. colligatum | HN13C1 | Honduras | HQ141505 |
| P. equisetoides | B7JB | America | AM168099 |
| P. filamentosum | SU-1 | America | AM168100 |
| P. luridum | LR-2 | America | AM168101 |
| P. multicystogenum | AS2 | Africa | HQ141506 |
| P. patagonicum | /1 | Argentina | GQ496156 |
| P. pseudocandidum | TNS-C-91 | America | AM168107 |
| P. stolonicoideum | K12A | Australia | HQ141507 |
| P. tikalense | HN1C1 | Honduras | HQ141509 |
| P. tikaliensis | OH595 | America | AM168106 |
| Species | Voucher | Locality | GenBank Accession Number | |||
|---|---|---|---|---|---|---|
| ITS | EF1-a | RPB1 | RPB2 | |||
| Morchella angusticeps | M304 | America | JQ723055 | GU551560 | GU551658 | GU551707 |
| M65 | America | GU551433 | GU551396 | GU551470 | GU551516 | |
| M.arbutiphila | HT193 | Turkey | JN085141 | JN085085 | JN085201 | JN085257 |
| M. australiana | M338 | Australia | KC753472 | KC753468 | KC753475 | KC753480 |
| T35077 | Australia | KC753470 | KC753466 | KC753477 | KC753478 | |
| M.brunnea | M35 | Canada | GU551415 | GU551378 | GU551452 | GU551492 |
| M431 | America | GU551414 | GU551377 | GU551451 | GU551491 | |
| M. confericola | HT106 | Turkey | JN085140 | JN085084 | JN085200 | JN085256 |
| HT479 | Turkey | JN085127 | JN085071 | JN085187 | JN085243 | |
| M. confusa | FCNU1027 | China | MK321848 | MK321866 | MK321854 | MK321860 |
| FCNU1028 | China | MK321849 | MK321867 | MK321855 | MK321861 | |
| M. eohespera | M215 | Sweden | GU551404 | GU551367 | GU551441 | GU551478 |
| HKAS62873 | China | JQ321878 | JQ321846 | JQ321942 | JQ321974 | |
| HKAS62875 | China | JQ321890 | JQ321858 | JQ321954 | JQ321986 | |
| M. eximioides | HKAS62883 | China | JQ321898 | JQ321866 | JQ321962 | JQ321994 |
| HKAS62884 | China | JQ321899 | JQ321867 | JQ321963 | JQ321995 | |
| M231 | Sweden | GU551428 | GU551391 | GU551465 | GU551508 | |
| M.fekeensis | HT401 | Turkey | JN085114 | JN085058 | JN085174 | JN085230 |
| HT510 | Turkey | JN085133 | JN085077 | JN085193 | JN085249 | |
| M. hispaniolensis | M374 | Dominican Republic | MH014725 | GU551554 | GU551652 | GU551484 |
| M. importuna | HKAS62868 | China | JQ321874 | JQ321842 | JQ321938 | JQ321970 |
| HKAS62871 | Germany | JQ321903 | JQ321871 | JQ321967 | JQ321999 | |
| M. kaibabensis | TAC-1376 | America | MH014727 | MH014721 | MH014732 | MH014737 |
| TAC-1708 | America | MH014728 | MH014722 | MH014733 | MH014738 | |
| M. laurentiana | 10.05.19AV02 | Canada | KT819376 | KT819387 | KT819353 | KT819364 |
| 13.05.14AV01 | Canada | KT819374 | KT819385 | KT819351 | KT819362 | |
| M.magnispora | HT470 | Turkey | JN085122 | JN085066 | JN085182 | JN085238 |
| HT471 | Turkey | JN085123 | JN085067 | JN085183 | JN085239 | |
| M.mediterraneensis | HT448 | Turkey | JN085118 | JN085062 | JN085178 | JN085234 |
| HT520 | Turkey | JN085135 | JN085079 | JN085195 | JN085251 | |
| M.pulchella | HT472 | Turkey | JN08512 | JN085068 | JN085184 | JN085240 |
| M.purpurascens | HKAS62876 | China | JQ321895 | JQ321863 | JQ321959 | JQ321991 |
| HT297 | Turkey | JN085111 | JN085055 | JN085171 | JN085227 | |
| M214 | Sweden | GU551406 | GU551369 | GU551443 | GU551480 | |
| M476 | China | GU551426 | GU551389 | GU551463 | GU551505 | |
| M. septentrionalis | M9 | America | JQ723064 | GU551556 | GU551654 | GU551703 |
| M. synderi | M299 | America | GU551413 | GU551376 | GU551450 | GU551490 |
| M433 | America | GU551425 | GU551388 | GU551462 | GU551503 | |
| Morchella sp. Mel-13 | HKAS62889 | China | JQ321884 | JQ321852 | JQ321948 | JQ321980 |
| HKAS62893 | China | JQ321888 | JQ321856 | JQ321952 | JQ321984 | |
| M424 | India | GU551429 | GU551392 | GU551466 | GU551511 | |
| Morchella sp. Mel-14 | HKAS62885 | China | JQ321887 | JQ321855 | JQ321951 | JQ321983 |
| HKAS62886 | China | JQ321891 | JQ321859 | JQ321955 | JQ321987 | |
| Morchella sp. Mel-17 | M315 | Bulgaria | JQ723057 | GU551561 | GU551659 | GU551708 |
| Morchella sp. Mel-21 | HKAS62878 | China | JQ321894 | JQ321862. | JQ321958 | JQ321990 |
| HKAS62880 | China | JQ321882 | JQ321850 | JQ321946 | JQ321978 | |
| M225 | Japan | JN085156 | GU551559 | GU551657 | GU551507 | |
| FCNU1120 | China | PP658423 | PP695543 | PP693901 | PP693900 | |
| Morchella sp. Mel-23 | M495 | Norway | JN085153 | GU551381 | JN085212 | GU551495 |
| M542 | Denmark | JQ723063 | GU551562 | GU551660 | GU551709 | |
| Morchella sp. Mel-26 | HT508 | Turkey | JN085131 | JN085075 | JN085191 | JN085247 |
| Morchella sp. Mel-34 | HKAS62877 | China | JQ321896 | JQ321864 | JQ321960 | JQ321992 |
| Morchella sp. Mel-37 | CIEFAP5 | Argentina | KJ439678 | KJ569626 | KJ569594 | KJ569620 |
| CIEFAP71 | Argentina | KJ439673 | KJ569630 | KJ569596 | KJ569624 | |
| CIEFAP74 | Argentina | KJ439674 | KJ569631 | KJ569598 | KJ569625 | |
| Morchella sp. Mel-38 | ALV3206 | Cyprus | KU865009 | KU865050 | KU865040 | KU865042 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hu, W.-S.; Jiang, L.-L.; Liu, P.; Zhang, X.-Y.; Wei, W.; Du, X.-H. Morphological and Phylogenetic Analyses Reveal Dictyostelids (Cellular Slime Molds) Colonizing the Ascocarp of Morchella. J. Fungi 2024, 10, 678. https://doi.org/10.3390/jof10100678
Hu W-S, Jiang L-L, Liu P, Zhang X-Y, Wei W, Du X-H. Morphological and Phylogenetic Analyses Reveal Dictyostelids (Cellular Slime Molds) Colonizing the Ascocarp of Morchella. Journal of Fungi. 2024; 10(10):678. https://doi.org/10.3390/jof10100678
Chicago/Turabian StyleHu, Wen-Shu, Lin-Lin Jiang, Pu Liu, Xiao-Yan Zhang, Wei Wei, and Xi-Hui Du. 2024. "Morphological and Phylogenetic Analyses Reveal Dictyostelids (Cellular Slime Molds) Colonizing the Ascocarp of Morchella" Journal of Fungi 10, no. 10: 678. https://doi.org/10.3390/jof10100678
APA StyleHu, W.-S., Jiang, L.-L., Liu, P., Zhang, X.-Y., Wei, W., & Du, X.-H. (2024). Morphological and Phylogenetic Analyses Reveal Dictyostelids (Cellular Slime Molds) Colonizing the Ascocarp of Morchella. Journal of Fungi, 10(10), 678. https://doi.org/10.3390/jof10100678

