Detection of Chicken Respiratory Pathogens in Live Markets of Addis Ababa, Ethiopia, and Epidemiological Implications
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Design and Sample Collection
2.2. Laboratory Analysis
3. Results
3.1. Nucleic Acid Detection of Respiratory Pathogens in Respiratory Tract Swabs
3.2. Culture-Based Bacteria Detection in Respiratory Tract Swabs
3.3. Detection of Antibodies against Respiratory Pathogens
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Assefa, H. The role of poultry for poor livelihoods in Ethiopia. Int. J. Vet. Sci. Anim. Husb. 2019, 4, 1–4. [Google Scholar]
- Dana, N. Breeding programs for indigenous chicken in Ethiopia: Analysis of diversity in production systems and chicken populations. Ph.D. Thesis, Wageningen University and Research, Wageningen, The Netherlands, 2011. [Google Scholar]
- Alemneh, T.; Getabalew, M. Exotic chicken production performance, status and challenges in Ethiopia. Int. J. Vet. Sci. Res. 2019, 5, 39–45. [Google Scholar]
- Moges, F.; Nega, M.; Zeleke, G. Characterization of village chicken production and marketing systems in selected districts of North Western Amhara region, Ethiopia. Afr. J. Agric. Res. 2014, 9, 3091–3097. [Google Scholar]
- Assefa, H.; Bogale, A.; Gebremedhin, B.; Mekuriaw, Z.; Derso, T.; Dessalegn, Y.; Tegegne, A.; Hoekstra, D. Village chicken production and marketing in West Gojjam zone, Ethiopia. Curr. Res. Agric. Sci. 2016, 3, 64–73. [Google Scholar] [CrossRef]
- Yemane, N.; Tamir, B.; Belihu, K. Characterization of village chicken production performance under scavenging system in Halaba district of southern Ethiopia. Ethiop. Vet. J. 2013, 17, 68–80. [Google Scholar] [CrossRef]
- Milkias, M. Chicken Meat Production, Consumption and Constraints in Ethiopia. Food Sci. Qual. Manag. 2016, 54, 1–12. [Google Scholar]
- Habte, T.; Amare, A.; Bettridge, J.; Collins, M.; Christley, R.; Wigley, P. Guide to Chicken Health and Management in Ethiopia: For Farmers and Development Agents; ILRI: Nairobi, Kenya, 2017. [Google Scholar]
- Haile, B.; Fentie, T.; Kassa, T. The role of live chicken markets as a source of replication and dissemination of Newcastle disease virus in chickens, northwest Ethiopia. Poult. Sci. 2020, 99, 5415–5421. [Google Scholar] [CrossRef]
- Luo, S.; Xie, Z.; Xie, Z.; Xie, L.; Huang, L.; Huang, J.; Deng, X.; Zeng, T.; Wang, S.; Zhang, Y. Surveillance of live poultry markets for low pathogenic avian influenza viruses in Guangxi Province, Southern China, from 2012–2015. Sci. Rep. 2017, 7, 1–9. [Google Scholar] [CrossRef]
- Chen, Y.; Cheng, J.; Xu, Z.; Hu, W.; Lu, J. Live poultry market closure and avian influenza A (H7N9) infection in cities of China, 2013–2017: An ecological study. BMC Infect. Dis. 2020, 20, 1–10. [Google Scholar] [CrossRef]
- Habte, T.; Gerber, P.F.; Ibrahim, F.; Groves, P.J.; Walkden-Brown, S.W. Seroprevalence of major respiratory diseases of chickens in central Ethiopia in different chicken production systems. Poult. Sci. 2022, 101, 102065. [Google Scholar] [CrossRef]
- Chanie, M.; Negash, T.; Tilahun, S.B. Occurrence of concurrent infectious diseases in broiler chickens is a threat to commercial poultry farms in Central Ethiopia. Trop. Anim. Health Prod. 2009, 41, 1309–1317. [Google Scholar] [CrossRef] [PubMed]
- Wilson, R. Poultry production and performance in the Federal Democratic Republic of Ethiopia. World’s Poult. Sci. J. 2010, 66, 441–454. [Google Scholar] [CrossRef]
- Abdelaziz, A.M.; Mohamed, M.H.; Fayez, M.M.; Al-Marri, T.; Qasim, I.; Al-Amer, A.A. Molecular survey and interaction of common respiratory pathogens in chicken flocks (field perspective). Vet. World 2019, 12, 1975. [Google Scholar] [CrossRef]
- Malik, Y.S.; Patnayak, D.P.; Goyal, S.M. Detection of three avian respiratory viruses by single-tube multiplex reverse transcription–polymerase chain reaction assay. J. Vet. Diagn. Investig. 2004, 16, 244–248. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nasser, M.; Lohr, J.; Mebratu, G.; Zessin, K.-H.; Baumann, M.; Ademe, Z. Oral Newcastle disease vaccination trials in Ethiopia. Avian Pathol. 2000, 29, 27–34. [Google Scholar] [CrossRef] [PubMed]
- Tadesse, S.; Ashenafi, H.; Aschalew, Z. Seroprevalence study of Newcastle disease in local chickens in central Ethiopia. Int. J. Appl. Res. Vet. Med. 2005, 3, 25–29. [Google Scholar]
- Zeleke, A.; Sori, T.; Gelaye, E.; Ayelet, G. Newcastle disease in village chickens in the southern and rift valley districts in Ethiopia. Int. J. Poult. Sci. 2005, 4, 507–510. [Google Scholar]
- Chaka, H.; Goutard, F.; Bisschop, S.; Thompson, P.N. Seroprevalence of Newcastle disease and other infectious diseases in backyard chickens at markets in Eastern Shewa zone, Ethiopia. Poult. Sci. 2012, 91, 862–869. [Google Scholar] [CrossRef]
- Mazengia, H. Review on major viral diseases of chickens reported in Ethiopia. J. Infect. Dis. Immun. 2012, 4, 1–9. [Google Scholar] [CrossRef]
- Chaka, H.; Goutard, F.; Roger, F.; Bisschop, S.P.; Thompson, P.N. Household-level risk factors for Newcastle disease seropositivity and incidence of Newcastle disease virus exposure in backyard chicken flocks in Eastern Shewa zone, Ethiopia. Prev. Vet. Med. 2013, 109, 312–320. [Google Scholar] [CrossRef]
- Sori, T.; Eshetu, A.; Tesfaye, A.; Garoma, A.; Mengistu, S. Seroprevalence of Newcastle disease in backyard chickens in Sebata Hawas District, central Ethiopia. World Appl. Sci. J. 2016, 34, 540–544. [Google Scholar]
- Mamo, T.; Yimer, L. Serological Investigation of Newcastle Disease in Selected Districts of Buno Bedelle Zone, Ethiopia. Vet. Med. Res. Rep. 2021, 12, 253. [Google Scholar] [CrossRef] [PubMed]
- Hutton, S.; Bettridge, J.; Christley, R.; Habte, T.; Ganapathy, K. Detection of infectious bronchitis virus 793B, avian metapneumovirus, Mycoplasma gallisepticum and Mycoplasma synoviae in poultry in Ethiopia. Trop. Anim. Health Prod. 2017, 49, 317–322. [Google Scholar] [CrossRef] [PubMed]
- Jibril, Y.; Asfaw, Y.; Gebregziabher, B.; Issa, A. Seroprevalence of Mycoplasma gallisepticum in domestic chickens, East Shewa, Ethiopia. Ethiop. Vet. J. 2018, 22, 74–86. [Google Scholar] [CrossRef]
- Tesfaye, A.; Sahle, M.; Sori, T.; Kassa, T.; Garoma, A.; Koran, T.; Dima, C.; Guyassa, C.; Hilu, H.; Guta, S. Infectious laryngotracheitis virus in commercial and backyard chicken production systems in central and South Ethiopia (First report) ILT in Ethiopian poultry production. J. Appl. Poult. Res. 2019, 28, 1324–1329. [Google Scholar] [CrossRef]
- Roba, Y.T.; Tadesse, D.; Assefa, Z.; Tesfaye, A. Seroprevalence of infectious laryngotracheitis disease in backyard chickens in villages of Ada’a district, Oromia, Ethiopia: First report. Trop. Anim. Health Prod. 2020, 52, 3109–3112. [Google Scholar] [CrossRef]
- Birhan, M.; Temesgen, M.; Shite, A.; Berhane, N.; Bitew, M.; Gelaye, E.; Abayneh, T.; Getachew, B. Seroprevalence and Associated Risk Factors of Infectious Bronchitis Virus in Chicken in Northwest Ethiopia. Sci. World J. 2021, 2021, 4553890. [Google Scholar] [CrossRef]
- Tulu, D. Newcastle disease and its different applicable control options in poultry in Ethiopia. Int. J. Agric. Ext. 2020, 8, 43–56. [Google Scholar] [CrossRef]
- Asfaw, Y.T.; Ameni, G.; Medhin, G.; Gumi, B.; Wieland, B. Poultry health services in Ethiopia: Availability of diagnostic, clinical, and vaccination services. Poult. Sci. 2021, 100, 101023. [Google Scholar] [CrossRef]
- De Boeck, C.; Kalmar, I.; Dumont, A.; Vanrompay, D. Longitudinal monitoring for respiratory pathogens in broiler chickens reveals co-infection of Chlamydia psittaci and Ornithobacterium rhinotracheale. J. Med. Microbiol. 2015, 64, 565–574. [Google Scholar] [CrossRef]
- Work, T.M. Avian Necropsy Manual for Biologists in Remote Refuges; National Wildlife Health Center, Hawaii Field Station: Hilo, HI, USA, 2000. [Google Scholar]
- Rubin, L.G.; Rizvi, A.; Baer, A. Effect of swab composition and use of swabs versus swab-containing skim milk-tryptone-glucose-glycerol (STGG) on culture-or PCR-based detection of Streptococcus pneumoniae in simulated and clinical respiratory specimens in STGG transport medium. J. Clin. Microbiol. 2008, 46, 2635–2640. [Google Scholar] [CrossRef] [PubMed]
- Cavanagh, D.; Mawditt, K.; Britton, P.; Naylor, C. Longitudinal field studies of infectious bronchitis virus and avian pneumovirus in broilers using type-specific polymerase chain reactions. Avian Pathol. 1999, 28, 593–605. [Google Scholar] [CrossRef] [PubMed]
- Ganapathy, K.; Ball, C.; Forrester, A. Genotypes of infectious bronchitis viruses circulating in the Middle East between 2009 and 2014. Virus Res. 2015, 210, 198–204. [Google Scholar] [CrossRef] [PubMed]
- Bayraktar, E.; Umar, S.; Yilmaz, A.; Turan, N.; Franzo, G.; Tucciarone, C.; Cecchinato, M.; Cakan, B.; Iqbal, M.; Yilmaz, H. First Molecular Characterization of Avian Metapneumovirus (aMPV) in Turkish Broiler Flocks. Avian Dis. 2018, 62, 425–430. [Google Scholar] [CrossRef]
- Mescolini, G.; Lupini, C.; Franzo, G.; Quaglia, G.; Legnardi, M.; Cecchinato, M.; Tucciarone, C.M.; Blanco, A.; Turblin, V.; Biarnés, M. What is new on molecular characteristics of Avian metapneumovirus strains circulating in Europe? Transbound. Emerg. Dis. 2021, 68, 1314–1322. [Google Scholar] [CrossRef]
- Damena, D.; Fusaro, A.; Sombo, M.; Belaineh, R.; Heidari, A.; Kebede, A.; Kidane, M.; Chaka, H. Characterization of Newcastle disease virus isolates obtained from outbreak cases in commercial chickens and wild pigeons in Ethiopia. Springerplus 2016, 5, 1–8. [Google Scholar] [CrossRef]
- Chacon, J.L.; Mizuma, M.Y.; Piantino Ferreira, A.J. Characterization by restriction fragment length polymorphism and sequence analysis of field and vaccine strains of infectious laryngotracheitis virus involved in severe outbreaks. Avian Pathol. 2010, 39, 425–433. [Google Scholar] [CrossRef] [Green Version]
- Diallo, I.S.; Taylor, J.; Gibson, J.; Hoad, J.; De Jong, A.; Hewitson, G.; Corney, B.G.; Rodwell, B.J. Diagnosis of a naturally occurring dual infection of layer chickens with fowlpox virus and gallid herpesvirus 1 (infectious laryngotracheitis virus). Avian Pathol. 2010, 39, 25–30. [Google Scholar] [CrossRef]
- Moscoso, H.; Thayer, S.G.; Hofacre, C.L.; Kleven, S.H. Inactivation, storage, and PCR detection of mycoplasma on FTA® filter paper. Avian Dis. 2004, 48, 841–850. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
- Cook, J. Avian pneumovirus infections of turkeys and chickens. Vet. J. 2000, 160, 118–125. [Google Scholar] [CrossRef]
- Rautenschlein, S.; Munir, M.; Seal, B.S. 11 Avian Metapneumoviruses. In Mononegaviruses of Veterinary Importance, Volume 1: Pathobiology and Molecular Diagnosis; CABI: Wallingford, Oxfordshire, UK, 2013; Volume 1, p. 185. [Google Scholar]
- MacLachlan, N.; Dubovi, E. Paramyxoviridae and pneumoviridae. In Fenner’s Veterinary Virology; Elsevier: New York, NY, USA, 2017; pp. 327–356. [Google Scholar]
- Fentie, T.; Heidari, A.; Aiello, R.; Kassa, T.; Capua, I.; Cattoli, G.; Sahle, M. Molecular characterization of Newcastle disease viruses isolated from rural chicken in northwest Ethiopia reveals the circulation of three distinct genotypes in the country. Trop. Anim. Health Prod. 2014, 46, 299–304. [Google Scholar] [CrossRef] [PubMed]
- Bari, F.D.; Gelaye, E.; Tekola, B.G.; Harder, T.; Beer, M.; Grund, C. Antigenic and molecular characterization of virulent Newcastle disease viruses circulating in Ethiopia between 1976 and 2008. Vet. Med. Res. Rep. 2021, 12, 129. [Google Scholar] [CrossRef] [PubMed]
- Bekele, L. Isolation, Molecular Identification and Vaccine Trial of Mycoplasma gallisepticum in Ethiopia. Master’s Thesis, Department of Microbiology, Immunology and Veterinary Public Health, Addis Ababa University, Debre Zeit, Ethiopia, 2015. [Google Scholar]
- Tegegne, D.; Deneke, Y.; Sori, T.; Abdurahaman, M.; Kebede, N.; Cecchinato, M.; Franzo, G. Molecular epidemiology and genotyping of infectious bronchitis virus and avian metapneumovirus in backyard and commercial chickens in Jimma zone, southwestern Ethiopia. Vet. Sci. 2020, 7, 187. [Google Scholar] [CrossRef]
- Shiferaw, J.; Shifara, F.; Tefera, M.; Feyisa, A.; Tamiru, Y. Seroprevalence and Associated Risk Factors of Mycoplasma gallisepticum Infection in Poultry Farms of Hawasa and Bishoftu, Central Ethiopia. Vet. Med. Res. Rep. 2022, 13, 101. [Google Scholar] [CrossRef]
Pathogen | Target Gene | Primers (5′–3′) | Product Size (bp) | Reference |
---|---|---|---|---|
IBV (nested) | Spike 1 (S1) gene | PCR 1 SX1+ CACCTAGAGGTTTGT/CT A/T GCAT SX2- TCCACCTCTAAACACC C/T TT | 380–393 (nested) | [35,36] |
PCR 2 SX3+ TAATACTGGC/T AATTTTTCAGA SX4- AATACAGATTGCTTACAACCAC | ||||
aMPV (nested) | Glycoprotein (G) gene | PCR 1 G1+ GGGACAAGTATCYMAT G6- CTGACAAATTGGTCCTGATT | 361 (nested) | [35,37,38] |
PCR 2 G5- CAAAGAGCCAATAAGCCCA G8+B TAGTCCTCAAGCAAGTCCTC | ||||
NDV | Fusion (F) gene | NOHR AGT CGG AGG ATG TGT TGG CAG NOHF TAC ACC TCA TCC CAG ACA GG | 260 | [39] |
ILTV | Thymidine kinase (TK) gene | TKF ACC TAC CTC CAA CGT ACA T TKR CCC ATA TCA GCA TTC TAG CG | 395 | [40,41] |
Infected cell protein 4 (ICP4) | ICP4F CTTCAGACTCCAGCTCATCTG ICP4R AGTCATGCGTCTATGGCGTTGAC | 688 | ||
Mg | 16 S gene | MG-16SF GAC CTA ATC TGT AAA GTT GGT MG-16S R GCT TCC TTG CGG TTA GCA AC | 186 | [42] |
Cytadhesion 2 (C2) gene | Mgc2F CGC AAT TTG GTC CTA ATC CCC AAC A Mgc2R TAA ACC CAC CTC CAG CTT TAT TTC C | 237–303 |
Chicken No. | Market | Date of Collection | Sex | Nucleic Acid Detection | Bacteriological Findings | Total Number of Pathogens | ||||
---|---|---|---|---|---|---|---|---|---|---|
MPV | IBV | ILTV | NDV | Mg | ||||||
Ch 1 | Shola | 09.8.21 | M | + | – | – | – | + x | S. pyogenes, Klebsiella pneumoniae | 4 |
Ch 2 | Shola | 20.8.21 | M | + | – | – | + | ++ xy | E. coli, Serratia | 5 |
Ch 3 | Shola | 21.8.21 | M | + | + | – | + | ++ xy | Citrobacter | 5 |
Ch 4 | Shola | 21.8.21 | M | + | + | – | – | – | E. coli | 3 |
Ch 5 | Shola | 23.8.21 | M | + | + | – | – | – | E. coli | 3 |
Ch 6 | Shola | 23.8.21 | F | + | – | + u | + | + y | Serratia, E. coli | 6 |
Ch 7 | Shola | 23.8.21 | F | + | – | – | + | + y | S. aureus | 4 |
Ch 8 | Shola | 24.8.21 | F | + | – | – | + | – | Citrobacter, S. aureus | 4 |
Ch 9 | Shola | 24.8.21 | M | + | – | – | – | – | Klebsiella, S. aureus | 3 |
Ch 10 | Shola | 24.8.21 | F | + | + | ++ uv | – | – | E. coli, S. aureus, Enterobacter | 6 |
Ch 11 | Merkato | 09.8.21 | M | + | + | – | – | ++ xy | S. pyogenes, Klebsiella | 5 |
Ch 12 | Merkato | 21.8.21 | M | + | – | – | + | – | Klebsiella | 3 |
Ch 13 | Merkato | 21.8.21 | M | + | – | – | + | ++ xy | Klebsiella | 4 |
Ch 14 | Merkato | 23.8.21 | F | + | – | – | + | + y | Citrobacter, S. aureus | 5 |
Ch 15 | Merkato | 25.8.21 | F | + | – | – | + | – | - | 2 |
Ch 16 | Merkato | 25.8.21 | M | + | + | – | – | ++ xy | E. coli | 4 |
Ch 17 | Merkato | 26.8.21 | M | + | + | – | – | – | E. coli, Citrobacter, S. pyogenes, S. aureus | 6 |
Ch 18 | Merkato | 26.8.21 | F | + | – | – | – | – | E. coli, Citrobacter, Klebsiella | 4 |
Total | 18 | 7 | 2 | 9 | 9 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tekelemariam, T.H.; Walkden-Brown, S.; Atire, F.A.; Tefera, D.A.; Alemayehu, D.H.; Gerber, P.F. Detection of Chicken Respiratory Pathogens in Live Markets of Addis Ababa, Ethiopia, and Epidemiological Implications. Vet. Sci. 2022, 9, 503. https://doi.org/10.3390/vetsci9090503
Tekelemariam TH, Walkden-Brown S, Atire FA, Tefera DA, Alemayehu DH, Gerber PF. Detection of Chicken Respiratory Pathogens in Live Markets of Addis Ababa, Ethiopia, and Epidemiological Implications. Veterinary Sciences. 2022; 9(9):503. https://doi.org/10.3390/vetsci9090503
Chicago/Turabian StyleTekelemariam, Tadiose Habte, Stephen Walkden-Brown, Fekadu Alemu Atire, Dessalegne Abeje Tefera, Dawit Hailu Alemayehu, and Priscilla F. Gerber. 2022. "Detection of Chicken Respiratory Pathogens in Live Markets of Addis Ababa, Ethiopia, and Epidemiological Implications" Veterinary Sciences 9, no. 9: 503. https://doi.org/10.3390/vetsci9090503
APA StyleTekelemariam, T. H., Walkden-Brown, S., Atire, F. A., Tefera, D. A., Alemayehu, D. H., & Gerber, P. F. (2022). Detection of Chicken Respiratory Pathogens in Live Markets of Addis Ababa, Ethiopia, and Epidemiological Implications. Veterinary Sciences, 9(9), 503. https://doi.org/10.3390/vetsci9090503