Next Article in Journal
Interactive Mixed Reality Simulation Enhances Student Knowledge and Ultrasound Interpretation in Sheep Pregnancy Diagnosis
Previous Article in Journal
Effect of a Constant Rate Infusion of Ketamine on a Variable Rate Infusion of Xylazine in Standing Horses Undergoing Ventriculocordectomy and Laryngoplasty
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Investigation and Correlation Analysis of Pathogens Carried by Ticks and Cattle in Tumen River Basin, China

1
Engineering Research Center of North-East Cold Region Beef Cattle Science & Technology Innovation, Ministry of Education, Yanbian University, Yanji 133002, China
2
State Key Laboratory for Diagnosis and Treatment of Severe Zoonotic Infectious Diseases, Key Laboratory for Zoonosis Research of the Ministry of Education, College of Veterinary Medicine, Jilin University, Changchun 130062, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Vet. Sci. 2026, 13(1), 78; https://doi.org/10.3390/vetsci13010078
Submission received: 25 November 2025 / Revised: 30 December 2025 / Accepted: 8 January 2026 / Published: 13 January 2026
(This article belongs to the Topic Ticks and Tick-Borne Pathogens: 2nd Edition)

Simple Summary

Ticks are a significant external parasite of livestock, capable of transmitting diseases to animals through blood-feeding, resulting in substantial economic losses to the livestock industry. The Tumen River is located in the northeastern border region of China, and there is little information about which tick species infest cattle and which can carry harmful blood parasites. This study was conducted in seven regions of the Tumen River Basin. There are 5 species of ticks in the Tumen River basin including Haemaphysalis longicornis, Haemaphysalis concinna, Haemaphysalis japonica, Dermacentor silvarum and Ixodes persulcatus. Three pathogens posing significant threats to livestock, particularly cattle, were detected in blood samples from ticks and cattle: Babesia ovata, Theileria orientalis, and Theileria sinensis. The pathogens detected in tick and cow blood are highly homologous. These findings indicate that ticks in the Tumen River basin may serve as vectors for B. ovata, T. orientalis, and T. sinensis. Cattle populations within the basin are susceptible to contracting these three diseases through tick bites. Additionally, these ticks pose a potential threat to public health. Although there is currently insufficient evidence to indicate that humans can be infected by the above three pathogens, ticks as the primary vectors for other zoonotic pathogens—such as Borrelia burgdorferi—should be taken seriously, necessitating heightened vigilance and control measures by farmers and livestock breeders. These results improve knowledge of tick species in the border region of China and show the importance of continued monitoring to protect animal health and farming.

Abstract

Ticks and tick-borne diseases pose a significant threat to public health. The Tumen River Basin is located at the junction of China, North Korea and Russia, whose warm climate and favorable ecological environment are suitable for the growth and reproduction of ticks. At the same time, the cattle industry in this region is highly developed, with cattle serving as the primary economic source for the area. This study performed an epidemiological investigation and analysis of pathogens carried by ticks and cattle in the Tumen River basin. A total of 913 ticks and 247 bovine blood samples were collected from seven cities primarily focused on cattle farming in the Tumen River basin. Morphological and molecular biological identification of ticks was carried out to determine the distribution of ticks and their pathogens in the region. Through the detection of pathogens carried by cattle blood samples in the surrounding area, the correlation with tick distribution was confirmed. The species and distribution of ticks of different genders and in different collection environments, and the infection of pathogens in bovine blood samples were statistically analyzed. The results showed that the 913 ticks had 5 species, including Haemaphysalis longicornis, Haemaphysalis concinna, Haemaphysalis japonica, Dermacentor silvarum and Ixodes persulcatus. Three pathogens, Babesia ovata, Theileria orientalis and Theileria sinensis, were detected in the blood samples of vector ticks and cattle. These results provide a theoretical basis for the prevention and control of ticks and tick-borne diseases in the Tumen River basin.

1. Introduction

The tick is a blood-sucking arthropod found on every land on Earth and is parasitic on most vertebrates, such as humans, mammals, reptiles and birds [1,2]. There are records of tick infestation as early as 1550 BC [3]. The survival time of ticks is generally two years. Except for individual ticks, all four stages of tick growth require blood. Ixodes takes a blood meal once at different stages of growth, while soft ticks can take blood meals multiple times [4,5]. In addition to the physical bite of the tick, which can make people and animals feel pain and develop allergic reactions, wasting, poisoning and other adverse effects, the most harmful is the vector role of the tick [2]. Ticks can transmit pathogens such as protozoa, viruses and bacteria as they feed [6]. Tick-borne pathogens need to be acquired from susceptible hosts and passed on to new hosts as they move to the next stage of growth, so that tick-borne pathogens remain. The number of zoonotic pathogens transmitted by ticks as vectors is the largest and increasing [7,8,9]. This directly damages human and animal health and indirectly affects the economy and development of society. Ticks are most common in tropical and subtropical regions, and therefore cause the greatest economic damage in these regions [10]. With the expansion of tick distribution and tick-borne disease epidemic areas, more effective control methods and risk monitoring are urgently needed. In recent years, various newly discovered tick-borne pathogens have brought great challenges to the prevention and control of tick-borne diseases.
Piroplasmida is a genus of protozoan parasites that infect the red blood cells and lymphocytes of vertebrates, primarily transmitted by ticks. It can infect domestic animals such as horses, cattle, sheep, and camels, posing the greatest threat to cattle. Babesia and Theileria are the two main families of Piroplasmida [11]. Babesia is divided into numerous subspecies, including Babesia caballi, Babesia ovata, Babesia bigemina and others [12]. The Theileria is primarily divided into three subtypes: Theileria sergenti, Theileria orientalis and Theileria sinensis [13]. The Tumen River Basin, as a major livestock breeding base in Northeast China, has seen limited research on the three pathogens Babesia ovata, Theileria orientalis and Theileria sinensis, despite their significant harm to cattle.
The Tumen River basin is located at the junction of China, North Korea and Russia, with high forest coverage, rich vegetation, a wide variety of wild animals and relatively developed animal husbandry [14]. The basin’s warm climate and favorable ecological environment are suitable for tick growth and reproduction. The Tumen River Basin is an important ecological functional area, but the species of ticks and the prevalence of tick-borne diseases in the basin are still unclear. Therefore, it is necessary to carry out investigation and research to better understand the tripartite relationship between ticks, tick-borne diseases and animal hosts. This study provides a scientific basis for the prevention and control of ticks and tick-borne diseases in the Tumen River Basin, and provides guidance for the treatment of tick-borne diseases in the basin.

2. Materials and Methods

2.1. Sample Collection

From March 2021 to October 2022, ticks living free in forest and grassland and ticks living on the body surface of cattle were collected in seven counties and cities primarily focused on cattle farming around the Tumen River basin, including Antu, Helong, Hunchun, Longjing, Tumen, Wangqing and Yanji (Figure 1). Free ticks were collected using the cloth flag method. Ticks on the bovine body surface are collected using tweezers. EDTA-containing bovine venous blood samples were collected from cattle ranches and cattle farmers in the tick collection areas of Antu, Hunchun, Helong, Tumen and Yanji. Cattle are classified by sex into male and female, by management into graze and farm, and by age into three stages: <1 years old; 1–2 years old; >2 years old. The sampling season corresponds to the period of peak tick activity in the region—spring. The months involved are April through June each year. Samples are collected once per month, totaling six collections over a two-year period. Ticks and bovine blood samples are collected on the same day. Ticks were classified according to location, time, breed, environment, sex and other information. A total of 913 ticks and 247 bovine blood samples were collected.

2.2. Tick Classification and Nucleic Acid Extraction

The morphological structures of different species of male and female ticks were observed with a stereomicroscope. Each tick was washed three times in normal saline solution and placed in a 1.5 mL centrifuge tube, and 600 μL phosphate-buffered saline was added. The ticks were then ground with a tissue breaker, followed by centrifugation at 1300× g for 1 min. Approximately 200 μL of the supernatant was collected to extract the nucleic acid. The genomic DNA from the tick was extracted using the TIANamp Genomic DNA kit (TIANGEN, Beijing, China). DNA should be stored at −20 °C.

2.3. Bovine Blood Nucleic Acid Extractio

The genomic DNA from the bovine blood was extracted using the TIANamp Blood DNA Kit (TIANGEN, Beijing, China). DNA should be stored at −20 °C.

2.4. Detection of Pathogens in Ticks and Bovine Blood

Polymerase Chain Reaction (PCR) was used to detect pathogens in DNA extracted from ticks and bovine blood. Species-specific primers were used to amplify the chaperonin-containing t-complex polypeptide 1 (CCTeta) gene of Babesia ovata and the major piroplasm surface protein (MPSP) gene of Theileria sinensis and Theileria orientalis. The primers used in this study are listed in Table 1. The PCR was conducted with a 25 µL reaction volume comprising 1 µL of reverse and forward primer (10 pmol), 2 µL of template DNA (60–80 ng/µL), 12.5 µL of Green Taq Mix (Vazyme, Nanjing, China) and 10.5 µL of distilled water. The PCR conditions are presented in Table 2.

2.5. Sequence Identity and Phylogenetic Analyses

The PCR products of the positive samples were sent to Shanghai Shenggong Biotechnology Company for Sanger sequencing. Newly obtained sequences were compared with the National Center for Biotechnology Information database (https://www.ncbi.nlm.nih.gov/, accessed on 15 May 2023) using the Basic Local Alignment Search Tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 15 May 2023) and related sequences were retrieved from the GenBank database (https://www.ncbi.nlm.nih.gov/genbank/, accessed on 15 May 2023). ClustalW software (https://clustalw.com/, accessed on 20 May 2023) was used for multiple sequence alignment. Phylogenetic trees were constructed using the Neighbor-Joining method with a p-distance model and bootstrapping of 1000 replicates to calculate the evolutionary relationship using Molecular Evolutionary Genetics Analysis software (v.11.0; https://www.megasoftware.net/, accessed on 6 June 2023)

2.6. Statistical Analysis

The chi-squared test was used to compare proportions of detected sample positivity in different condition via Prism 9 software (GraphPad Software, LLC, San Diego, CA, USA). When the p-value was lower than 0.05, the difference was considered statistically significant.

3. Results

3.1. Tick Species Survey Results

According to the identification results, there were three genera and five species of ticks in Tumen River basin, which included 148 Haemaphysalis longicornis, 152 Haemaphysalis japonica, 164 Haemaphysalis concinna, 39 Ixodes persulcatus, and 410 Dermacentor silvarum with proportions of 16.21%, 16.65%, 17.96%, 4.27%, and 44.91% (Figure 2A–J and Table 3).

3.2. Results of Pathogen Investigation

We detected Babesia ovata in H. longicornis, I. persulcatus, H. japonica and H. concinna; Theileria orientalis in H. longicornis, H. japonica and H. concinna; and Theileria sinensis in H. longicornis and H. japonica. In terms of age, adult ticks are more likely to carry pathogens than nymphs. In different environments, the detection rate of T. sinensis on the body surface was significantly increased, the detection rate of T. orientalis on the body surface of animals was lower than that of forest and grassland, and the detection rate of B. ovata was not significantly changed in the three environments (Table 4). All three pathogens were detected in bovine blood. Age and sex had significant effects on the infection rate of T. orientalis in cattle, but feeding style did not affect the infection rate. The opposite is true for T. sinensis and B. ovata (Table 5).

3.3. Phylogenetic Analysis of Pathogen

Phylogenetic analysis showed that the T. orientalis MPSP gene sequences generated from ticks (PQ539364) and cattle (PQ539365) in the Tumen River Basin clustered with the South Korea strain (MF893198), Brazil strain (AB581601), and Australia strain (MG758109) (Figure 3). In a similar manner, the T. sinensis MPSP gene sequences generated from ticks (PQ539363) and cattle (PQ539362) obtained in this study shared 100% identities and clustered with sequences from Gansu China (MG784422), Baishan China (KX375401), and Malaysia (MT240816) (Figure 4). The nucleotide sequence identity data demonstrated that sequences of the B. ovata CCTeta gene obtained in this study shared more than 95% identity with most of the B. ovata CCTeta gene sequences previously identified in Japan. The phylogenetic analysis showed the B. ovata CCTeta gene sequence from ticks (PQ487801) and cattle (PQ539366) in the Tumen River Basin in the same clade as the B. ovata CCTeta gene sequence (AB367928) from Hokkaido cattle in Japan (Figure 5).

4. Discussion

Tumen River Basin is located at 41°59′~44°1′ North latitude, 128°17′–131°18′ East longitude, with a total drainage area of 33,168 square kilometers. This basin is located in the main area of Changbai Mountain, affected by the topographic height, and the climate elements have vertical changes. The Tumen River Basin serves as a vital ecological functional zone, featuring diverse wetland types, fertile soils, and abundant water resources. The mild climate and rich biodiversity in the Tumen River Basin are conducive to tick breeding. Therefore, it is of great significance to investigate the species and distribution of ticks in the Tumen River Basin for the prevention and control of tick-borne diseases. In this study, 913 ticks collected from seven counties and cities in the Tumen River Basin were classified and analyzed. Among the five identified species, D. silvarum was the dominant tick species in the Tumen River Basin.
B. ovata mainly parasitizes the red blood cells of cattle [15]. It is a kind of large piroplasms; the piroplasms is round, oval and pear seed in shape; each body contains 1~2 clusters of chromatin; and the central cavity is often formed [18]. B. ovata produces asexually in the red blood cells of the intermediate host, such as cattle and sheep, forming two or four bodies by way of budding [19]. Chinese scholars have also found B. ovata in ticks collected from the body surface of naturally infected cattle [20]. The positive rate of B. ovata among 913 ticks in the Tumen River Basin was 5.36%. All counties and cities had different degrees of infection. According to regional distribution, the infection rate of B. ovata in the middle reaches of the Tumen River Basin was the highest. B. ovata was detected in H. longicornis, H. concinna, H. japonica and I. persulcatus. The infection rate of H. longicornis was the highest as the main transmission vector. There was no obvious change trend in B. ovata in different environments. According to the investigation results, B. ovata was detected in tick and bovine blood samples in the upper, middle and lower reaches of the Tumen River basin, indicating that the Tumen River basin is an endemic area of B. ovata. The positive rate in ticks was significantly lower than that in bovine blood samples. In addition, B. ovata was detected in the blood samples and ticks collected in the same county and city, and the sequence analysis homology was 100%, indicating that there is a certain correlation between B. ovata infection in cattle and ticks. Attention should be paid to preventing tick transmission of B. ovata in the Tumen River basin. B. ovata poses the most severe threat to cattle. Currently, there is insufficient evidence to indicate that humans can contract B. ovata through tick bites. However, this does not mean we can lower our guard. For farmers and livestock breeders in particular, preventing cattle from being bitten by ticks remains a key concern that requires their attention.
T. orientalis is very harmful to cattle and can kill cattle in severe cases [21]. It is mainly transmitted by ticks, and cases of transmission of T. orientalis by the invasive H. longicornis have been reported in Virginia, USA [22]. The disease is found all over the world, with New Zealand, Australia and Japan among the endemic countries [23]. In this study, the positive rate of T. orientalis detected in ticks was 12.04%, and seven counties and cities were infected. This indicates that T. orientalis is widely distributed in the Tumen River basin. According to the regional distribution characteristics, the positive rate in the middle reaches of the Tumen River basin was the highest, and the positive rate in the upper reaches was significantly lower than that in the middle and lower reaches. H. longicornis, H. concinna, H. japonica and T. orientalis were detected. The detection rate of H. longicornis was the highest. These results indicate that different species of ticks have great differences in the transmission of T. orientalis. T. orientalis was detected in the blood of ticks and cattle in all counties and cities of the Tumen River basin. The sequence homology analysis of ticks and cattle showed 98.7%, indicating that cattle infection with T. orientalis was related to tick transmission.
T. sinensis was first discovered in Gansu, China, and Haemaphysalis Qinghaiensis and H. japonica have the ability to transmit T. sinensis [24,25]. T. sinensis is currently considered to be a novel tick-borne pathogen. It has been reported that the existence of T. sinensis has been confirmed in yaks in Qinghai for the first time [26]. T. sinensis was detected in H. longicornis and H. japonica in Hunchun, which may be related to environmental differences between regions. This survey is the first time that T. sinensis in H. japonica and H. longicornis was found in the Tumen River basin, and, especially, the discovery of T. sinensis in H. japonica should be paid attention to. The homology of tick and bovine origin of T. sinensis was 100%, indicating that T. sinensis prevalent in the Tumen River basin was of the same origin, but the positive rate of T. sinensis in ticks was only 0.87%. Whether the main cause of T. sinensis infection in cattle was tick transmission remains to be further studied.
The prevention and control of ticks and tick-borne diseases remain a serious challenge. For most farmers and livestock breeders, scientifically effective tick prevention remains the key to interrupting the transmission of tick-borne diseases. Currently, classic topical medications such as permethrins play a vital role in preventing tick infestations. Surveys indicate that treating clothing with permethrin is highly effective against ticks. It can reduce the probability of being bitten by ticks by 93% [27]. In animal studies, permethrins also demonstrated good preventive and curative effects [28]. Treating farmers’ and livestock breeders’ clothing with pesticides is a simple and effective method for tick control. This approach is not only effective against ticks but also useful for controlling insects such as mosquitoes [29]. However, each method has certain limitations. Reports indicate that while traditional acaricides may yield some results in small-scale experiments, their effectiveness significantly diminishes as the scope of research expands [30]. Additional studies indicate that employing the classic “4-Posters” method can significantly reduce tick populations within the study area [31]. These also proved, although effective, not ‘cost-effective’ given the tons of corn required to attract deer. In summary, there are ‘strategic’ and practical measures that the farmers or public health infrastructures can adopt to reduce the scourge of ticks and tick-vectored diseases. This is a key focus area for our future research.
The primary method employed in our study was PCR, a highly specific detection technique. Of course, our research has certain limitations. While PCR is the most common method for detecting tick-borne pathogens, it can only detect a single pathogen at a time, making it prone to overlooking co-infections [32]. With technological advancements, Next-Generation Sequencing (NGS) has gained widespread application in pathogen detection. This technology can identify tens of millions of sequences within a sample and, through bioinformatics analysis, determine all potential pathogens present in the sample [33]. NGS has a significantly enhanced detection efficiency and is likely to become a hotspot for future research. Additionally, this study did not perform serological testing to determine which tick-borne pathogens elicited immune responses in the animals. This work will be conducted in our subsequent research. As is well known, ticks can carry a wide variety of pathogens, with Babesia alone exhibiting numerous genotypes [34]. However, due to limited research funding, we selected only a few representative pathogens for illustration in this study. We plan to conduct in-depth research and discussion on the gaps identified in this investigation in our next phase.

5. Conclusions

There are 5 species of ticks in the Tumen River basin. Three pathogens Babesia ovata, Theileria orientalis and Theileria sinensis were detected in ticks and cattle blood in Tumen River basin. The pathogens detected in tick and cow blood are highly homologous. This study suggests that ticks may be the transmission vector of the above three pathogens, and farmers should focus on prevention. Our research provides theoretical support for future disease prevention and control in the Tumen River Basin and enables precise prevention and control of imported risks through early warning systems. This offers theoretical support for promoting the sustainable development of animal husbandry and fostering harmonious coexistence between humans and nature.

Author Contributions

Conceptualization, P.M. and L.J.; investigation, P.M. and F.Z.; data curation, P.M., J.S.,Y.M. and S.Z.; writing—original draft preparation, P.M., L.J. and L.W.; writing—review and editing, Z.T., Z.W., S.L. and M.L.; funding acquisition, L.J. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Scientific Research and Innovation Team Project of Yanbian University and Jilin Province (20200301034RQ), supported by the 111 Project (D20034) and supported by State Key Laboratory for Diagnosis and Treatment of Severe Zoonotic Infectious Diseases, Jilin University, and Key Research and Development Project of the Department of Science and Technology of Jilin Province (20260205029GH).

Institutional Review Board Statement

This study was approved by the Animal Welfare and Ethics Review Committee of Yanbian University, China (animal protocol approval number: YD20210510004; date: 10 May 2021).

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

The original data presented in the study are openly available in GenBank database with the accession numbers PQ487801 PQ539362–PQ539366.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Hornok, S.; Abichu, G.; Meli, M.L.; Tanczos, B.; Sulyok, K.M.; Gyuranecz, M.; Gonczi, E.; Farkas, R.; Hofmann-Lehmann, R. Influence of the biotope on the tick infestation of cattle and on the tick-borne pathogen repertoire of cattle ticks in Ethiopia. PLoS ONE 2014, 9, e106452. [Google Scholar] [CrossRef] [Scilit]
  2. Jongejan, F.; Uilenberg, G. The global importance of ticks. Parasitology 2004, 129, S3–S14. [Google Scholar] [CrossRef] [Scilit]
  3. Anderson, J.F.; Magnarelli, L.A. Biology of ticks. Infect. Dis. Clin. N. Am. 2008, 22, 195–215. [Google Scholar] [CrossRef] [Scilit]
  4. Beati, L.; Klompen, H. Phylogeography of Ticks (Acari: Ixodida). Annu. Rev. Entomol. 2019, 64, 379–397. [Google Scholar] [CrossRef] [Scilit]
  5. Rodriguez, Y.; Rojas, M.; Gershwin, M.E.; Anaya, J.M. Tick-borne diseases and autoimmunity: A comprehensive review. J. Autoimmun. 2018, 88, 21–42. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Pfaffle, M.; Littwin, N.; Muders, S.V.; Petney, T.N. The ecology of tick-borne diseases. Int. J. Parasitol. 2013, 43, 1059–1077. [Google Scholar] [CrossRef] [Scilit]
  7. Colwell, D.D.; Dantas-Torres, F.; Otranto, D. Vector-borne parasitic zoonoses: Emerging scenarios and new perspectives. Vet. Parasitol. 2011, 182, 14–21. [Google Scholar] [CrossRef] [Scilit]
  8. Gilbert, L. The Impacts of Climate Change on Ticks and Tick-Borne Disease Risk. Annu. Rev. Entomol. 2021, 66, 373–388. [Google Scholar] [CrossRef] [Scilit]
  9. Zhao, G.P.; Wang, Y.X.; Fan, Z.W.; Ji, Y.; Liu, M.J.; Zhang, W.H.; Li, X.L.; Zhou, S.X.; Li, H.; Liang, S.; et al. Mapping ticks and tick-borne pathogens in China. Nat. Commun. 2021, 12, 1075. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  10. Parola, P.; Raoult, D. Ticks and tickborne bacterial diseases in humans: An emerging infectious threat. Clin. Infect. Dis. 2001, 32, 897–928. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  11. Gray, J.; Kahl, O.; Zintl, A. Pathogens transmitted by Ixodes ricinus. Ticks Tick-Borne Dis. 2024, 15, 102402. [Google Scholar] [CrossRef] [Scilit]
  12. Uilenberg, G. Babesia—A historical overview. Vet. Parasitol. 2006, 138, 3–10. [Google Scholar] [CrossRef] [Scilit]
  13. Chen, Y.; Chen, Y.Y.; Liu, G.; Lyu, C.; Hu, Y.; An, Q.; Qiu, H.Y.; Zhao, Q.; Wang, C.R. Prevalence of Theileria in cattle in China: A systematic review and meta-analysis. Microb. Pathog. 2022, 162, 105369. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Cao, G.; Tsuchiya, K.; Zhu, W.; Okuro, T. Vegetation dynamics of abandoned paddy fields and surrounding wetlands in the lower Tumen River Basin, Northeast China. PeerJ 2019, 7, e6704. [Google Scholar] [CrossRef] [Scilit]
  15. Mosqueda, J.; Hernandez-Silva, D.J.; Ueti, M.W.; Cruz-Resendiz, A.; Marquez-Cervantez, R.; Valdez-Espinoza, U.M.; Dang-Trinh, M.A.; Nguyen, T.T.; Camacho-Nuez, M.; Mercado-Uriostegui, M.A.; et al. Spherical Body Protein 4 from Babesia bigemina: A Novel Gene That Contains Conserved B-Cell Epitopes and Induces Cross-Reactive Neutralizing Antibodies in Babesia ovata. Pathogens 2023, 12, 495. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Ota, N.; Mizuno, D.; Kuboki, N.; Igarashi, I.; Nakamura, Y.; Yamashina, H.; Hanzaike, T.; Fujii, K.; Onoe, S.; Hata, H.; et al. Epidemiological survey of Theileria orientalis infection in grazing cattle in the eastern part of Hokkaido, Japan. J. Vet. Med. Sci. 2009, 71, 937–944. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Liu, A.; Guan, G.; Liu, Z.; Liu, J.; Leblanc, N.; Li, Y.; Gao, J.; Ma, M.; Niu, Q.; Ren, Q.; et al. Detecting and differentiating Theileria sergenti and Theileria sinensis in cattle and yaks by PCR based on major piroplasm surface protein (MPSP). Exp. Parasitol. 2010, 126, 476–481. [Google Scholar] [CrossRef] [Scilit]
  18. Nguyen, T.T.; Dang-Trinh, M.A.; Higuchi, L.; Mosqueda, J.; Hakimi, H.; Asada, M.; Yamagishi, J.; Umemiya-Shirafuji, R.; Kawazu, S.I. Initiated Babesia ovata Sexual Stages under In Vitro Conditions Were Recognized by Anti-CCp2 Antibodies, Showing Changes in the DNA Content by Imaging Flow Cytometry. Pathogens 2019, 8, 104. [Google Scholar] [CrossRef] [Scilit]
  19. Umemiya-Shirafuji, R.; Hatta, T.; Okubo, K.; Sato, M.; Maeda, H.; Kume, A.; Yokoyama, N.; Igarashi, I.; Tsuji, N.; Fujisaki, K.; et al. Transovarial persistence of Babesia ovata DNA in a hard tick, Haemaphysalis longicornis, in a semi-artificial mouse skin membrane feeding system. Acta Parasitol. 2018, 63, 433. [Google Scholar] [CrossRef] [Scilit]
  20. Maeda, H.; Hatta, T.; Alim, M.A.; Tsubokawa, D.; Mikami, F.; Kusakisako, K.; Matsubayashi, M.; Umemiya-Shirafuji, R.; Tsuji, N.; Tanaka, T. Initial development of Babesia ovata in the tick midgut. Vet. Parasitol. 2017, 233, 39–42. [Google Scholar] [CrossRef] [Scilit]
  21. Baghel, K.R.; Saravanan, B.C.; Jeeva, K.; Chandra, D.; Singh, K.P.; Ghosh, S.; Tewari, A.K. Oriental theileriosis associated with a new genotype of Theileria orientalis in buffalo (Bubalus bubalis) calves in Uttar Pradesh, India. Ticks Tick-Borne Dis. 2023, 14, 102077. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Thompson, A.T.; Garrett, K.B.; Kirchgessner, M.; Ruder, M.G.; Yabsley, M.J. A survey of piroplasms in white-tailed deer (Odocoileus virginianus) in the southeastern United States to determine their possible role as Theileria orientalis hosts. J. Parasitol. Parasites Wildl. 2022, 18, 180–183. [Google Scholar] [CrossRef] [Scilit]
  23. Selim, A.; Attia, K.; AlKahtani, M.D.F.; Albohairy, F.M.; Shoulah, S. Molecular epidemiology and genetic characterization of Theileria orientalis in cattle. Trop. Anim. Health Prod. 2022, 54, 178. [Google Scholar] [CrossRef] [Scilit]
  24. Agina, O.A.; Cheah, K.T.; Sayuti, N.S.A.; Shaari, M.R.; Isa, N.M.M.; Ajat, M.; Zamri-Saad, M.; Mazlan, M.; Hamzah, H. High Granulocyte-Macrophage Colony Stimulating Factor to Interleukin 10 Ratio and Marked Antioxidant Enzyme Activities Predominate in Symptomatic Cattle Naturally Infected with Candidatus Mycoplasma haemobos, Theileria orientalis, Theileria sinensis and Trypanosoma evansi. Animals 2021, 11, 2235. [Google Scholar] [CrossRef] [Scilit]
  25. Jia, L.; Zhao, S.; Xie, S.; Li, H.; Wang, H.; Zhang, S. Molecular prevalence of Theileria infections in cattle in Yanbian, north-eastern China. Parasite 2020, 27, 19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Wang, Y.; Wang, B.; Zhang, Q.; Li, Y.; Yang, Z.; Han, S.; Yuan, G.; Wang, S.; He, H. The Common Occurrence of Theileria ovis in Tibetan Sheep and the First Report of Theileria sinensis in Yaks from Southern Qinghai, China. Acta Parasitol. 2021, 66, 1177–1185. [Google Scholar] [CrossRef] [Scilit]
  27. Vaughn, M.F.; Meshnick, S.R. Pilot study assessing the effectiveness of long-lasting permethrin-impregnated clothing for the prevention of tick bites. Vector Borne Zoonotic Dis. 2011, 11, 869–875. [Google Scholar] [CrossRef] [Scilit]
  28. Solberg, V.B.; Miller, J.A.; Hadfield, T.; Burge, R.; Schech, J.M.; Pound, J.M. Control of Ixodes scapularis (Acari: Ixodidae) with topical self-application of permethrin by white-tailed deer inhabiting NASA, Beltsville, Maryland. J. Vector Ecol. 2003, 28, 117–134. [Google Scholar] [PubMed]
  29. Jordan, R.A.; Schulze, T.L.; Dolan, M.C. Efficacy of plant-derived and synthetic compounds on clothing as repellents against Ixodes scapularis and Amblyomma americanum (Acari: Ixodidae). J. Med. Entomol. 2012, 49, 101–106. [Google Scholar] [CrossRef] [Scilit]
  30. Ostfeld, R.S.; Keesing, F. Does Experimental Reduction of Blacklegged Tick (Ixodes scapularis) Abundance Reduce Lyme Disease Incidence? Pathogens 2023, 12, 714. [Google Scholar] [CrossRef] [Scilit]
  31. Grear, J.S.; Koethe, R.; Hoskins, B.; Hillger, R.; Dapsis, L.; Pongsiri, M. The effectiveness of permethrin-treated deer stations for control of the Lyme disease vector Ixodes scapularis on Cape Cod and the islands: A five-year experiment. Parasites Vectors 2014, 7, 292. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Sanchez-Vicente, S.; Tokarz, R. Tick-Borne Co-Infections: Challenges in Molecular and Serologic Diagnoses. Pathogens 2023, 12, 1371. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Tokarz, R.; Lipkin, W.I. Discovery and Surveillance of Tick-Borne Pathogens. J. Med. Entomol. 2021, 58, 1525–1535. [Google Scholar] [CrossRef] [Scilit]
  34. Sanchez-Vicente, S.; Tagliafierro, T.; Coleman, J.L.; Benach, J.L.; Tokarz, R. Polymicrobial Nature of Tick-Borne Diseases. mBio 2019, 10, 10–1128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Map of sampling districts in Tumen River Basin, China. The different colors represent the various districts sampled in this study. The blue line represents the Tumen River.
Figure 1. Map of sampling districts in Tumen River Basin, China. The different colors represent the various districts sampled in this study. The blue line represents the Tumen River.
Vetsci 13 00078 g001
Figure 2. Morphological identification of ticks. (A,B) Dermacentor silvarum; (C,D) Haemaphysalis concinna; (E,F) Haemaphysalis japonica; (G,H) Haemaphysalis Iongicornis; (I,J) Ixodes persulcatus.
Figure 2. Morphological identification of ticks. (A,B) Dermacentor silvarum; (C,D) Haemaphysalis concinna; (E,F) Haemaphysalis japonica; (G,H) Haemaphysalis Iongicornis; (I,J) Ixodes persulcatus.
Vetsci 13 00078 g002
Figure 3. ML-based phylogenetic analysis of MPSP gene sequences of the T. orientalis isolate. Tamura 3-parameter model with 1000 bootstrap replications. The sequences obtained in this study are in black bold text. The phylogenetic tree was visualized using ITOL software (version v7).
Figure 3. ML-based phylogenetic analysis of MPSP gene sequences of the T. orientalis isolate. Tamura 3-parameter model with 1000 bootstrap replications. The sequences obtained in this study are in black bold text. The phylogenetic tree was visualized using ITOL software (version v7).
Vetsci 13 00078 g003
Figure 4. ML-based phylogenetic analysis of MPSP gene sequences of the T. sinensis isolate. Tamura 3-parameter model with 1000 bootstrap replications. The sequences obtained in this study are in black bold text. The phylogenetic tree was visualized using ITOL software.
Figure 4. ML-based phylogenetic analysis of MPSP gene sequences of the T. sinensis isolate. Tamura 3-parameter model with 1000 bootstrap replications. The sequences obtained in this study are in black bold text. The phylogenetic tree was visualized using ITOL software.
Vetsci 13 00078 g004
Figure 5. ML-based phylogenetic analysis of CCTeta gene sequences of the B. ovata isolate. Tamura 3-parameter model with 1000 bootstrap replications. The sequences obtained in this study are in black bold text. The phylogenetic tree was visualized using ITOL software.
Figure 5. ML-based phylogenetic analysis of CCTeta gene sequences of the B. ovata isolate. Tamura 3-parameter model with 1000 bootstrap replications. The sequences obtained in this study are in black bold text. The phylogenetic tree was visualized using ITOL software.
Vetsci 13 00078 g005
Table 1. Primer sequences used for the gene amplification of different pathogens.
Table 1. Primer sequences used for the gene amplification of different pathogens.
Pathogen GenePrimer NameSequence (5′–3′)Fragment Size (bp)Reference
B. ovata CCTetaP1GCCCGCAGGTCATCATAAAGT1008[15]
P2CATTTTGTGCCAGCGTTTTG
T. orientalis MPSPP3CCAAGTTCACCCCAACTGTCG499[16]
P4GCACTGTTCATGGCGTGCAAA
T. sinensis MPSPP5CACTGCTATGTTGTCCAAGAGATATT887[17]
P6AATGCGCCTAAAGATAGTAGAAAAC
Table 2. Reaction conditions of various primers.
Table 2. Reaction conditions of various primers.
Pathogen GenePre-Denaturation
Temperature (°C)
/Time (s)
Denaturation
Temperature (°C)
/Time (s)
Annealing
Temperature (°C)
/Time (s)
Stretching
Temperature (°C)
/Time (s)
Temperature of Re-Extension (°C)
/Time (s)
CycleStorage Temperature (°C)
/Time (s)
B. ovata CCTeta95/30095/3051.4/3072/3072/480354
T. orientalis MPSP94/30094/6058/6072/6072/420354
T. sinensis MPSP94/30094/6056/6072/6072/420354
Table 3. Composition of tick species in seven counties and cities of Tumen River Basin.
Table 3. Composition of tick species in seven counties and cities of Tumen River Basin.
LocationHaemaphysalis
longicornis
Ixodes
persulcatus
Haemaphysalis
japonica
Dermacentor
silvarum
Haemaphysalis
concinna
Total
QuantityConstituent
Ratio (%)
QuantityConstituent
Ratio (%)
QuantityConstituent
Ratio (%)
QuantityConstituent
Ratio (%)
QuantityConstituent
Ratio (%)
QuantityConstituent
Ratio (%)
Hunchun13655.9772.8883.296325.932911.93243100.00
Tumen00.0000.0023.394779.661016.9559100.00
Yanji00.0000.003315.0016575.002210.00220100.00
Helong00.0000.001976.0000.00624.0025100.00
Longjing00.0063.113116.065930.579750.26193100.00
Antu128.452014.093423.947653.5200.00142100.00
Wangqing00.00619.352580.6500.0000.0031100.00
Total14816.21394.2715216.6541044.9116417.96913100.00
Table 4. Pathogens statistics from ticks.
Table 4. Pathogens statistics from ticks.
VariableBabesia ovata Positive Rate (%)Theileria orientalis Positive Rate (%)Theileria sinensis Positive Rate (%)
Region
Hunchun11.1125.112.88
Tumen3.391.690.00
Yanji2.725.450.00
Helong8.0028.004.00
Longjing3.103.620.00
Antu2.819.850.00
Wangqing19.3520.580.00
Type
Haemaphysalis longicornis18.9142.562.70
Ixodes persulcatus5.100.000.00
Haemaphysalis japonica11.2512.122.64
Dermacentor silvarum0.000.000.00
Haemaphysalis concinna1.2111.510.00
Sex
Male5.8313.700.00
Female6.4011.601.37
Nymph0.006.500.16
Ambient
Forest5.1011.600.00
Grass6.4113.270.88
Body surface5.704.205.71
Table 5. Pathogens statistics from cattle.
Table 5. Pathogens statistics from cattle.
VariableBabesia ovata Positive Rate (%)Theileria orientalis Positive Rate (%)Theileria sinensis Positive Rate (%)
Region
Hunchun26.7554.6531.39
Yanji0.0010.8118.92
Helong7.8931.5763.15
Longjing38.0916.6740.47
Antu45.4538.6320.45
Sex
Male24.4938.4632.87
Female25.9630.7735.58
Management
Graze27.3835.7136.9
Farm20.2534.1827.85
Age
<1 years old26.9240.3832.69
1–2 years old25.0031.6735.83
>2 years old24.0037.3332
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Min, P.; Song, J.; Meng, Y.; Zhao, S.; Tang, Z.; Wang, Z.; Lin, S.; Zhao, F.; Liu, M.; Wang, L.; et al. Investigation and Correlation Analysis of Pathogens Carried by Ticks and Cattle in Tumen River Basin, China. Vet. Sci. 2026, 13, 78. https://doi.org/10.3390/vetsci13010078

AMA Style

Min P, Song J, Meng Y, Zhao S, Tang Z, Wang Z, Lin S, Zhao F, Liu M, Wang L, et al. Investigation and Correlation Analysis of Pathogens Carried by Ticks and Cattle in Tumen River Basin, China. Veterinary Sciences. 2026; 13(1):78. https://doi.org/10.3390/vetsci13010078

Chicago/Turabian Style

Min, Pengfei, Jianchen Song, Yinbiao Meng, Shaowei Zhao, Zeyu Tang, Zhenyu Wang, Sicheng Lin, Fanglin Zhao, Meng Liu, Longsheng Wang, and et al. 2026. "Investigation and Correlation Analysis of Pathogens Carried by Ticks and Cattle in Tumen River Basin, China" Veterinary Sciences 13, no. 1: 78. https://doi.org/10.3390/vetsci13010078

APA Style

Min, P., Song, J., Meng, Y., Zhao, S., Tang, Z., Wang, Z., Lin, S., Zhao, F., Liu, M., Wang, L., & Jia, L. (2026). Investigation and Correlation Analysis of Pathogens Carried by Ticks and Cattle in Tumen River Basin, China. Veterinary Sciences, 13(1), 78. https://doi.org/10.3390/vetsci13010078

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop