Inhibition of NOX4-Mediated ROS Production Contributes to Selenomethionine’s Anti-Inflammatory Effect in LPS-Stimulated Bovine Endometrial Epithelial Cells
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Design and Treatment
2.2. Cell Culture
2.3. Cell Viability Detection
2.4. Intracellular ROS Detection
2.5. RNA Isolation and RT-qPCR
2.6. Western Blot
2.7. Statistical Analysis
3. Results
3.1. Changes in NOX Gene Expression in LPS-Stimulated BEEC
3.2. DPI Reduced ROS Production and Inhibited NF-κB Activation in LPS-Stimulated BEEC
3.3. PDTC Decreased ROS Production and NOX4 Expression in LPS-Stimulated BEEC
3.4. NOX Suppression Amplified the Inhibitory Effect of SeMet on ROS Generation and Inflammation in LPS-Stimulated BEEC
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| E. coli | Escherichia coli |
| BEEC | bovine endometrial epithelial cells |
| CYBB | cytochrome B-245 beta chain |
| DPI | diphenyleneiodonium |
| IL1β/IL1B | interleukin 1 beta |
| LPS | lipopolysaccharide |
| MyD88 | myeloid differentiation factor 88 |
| NAC | N-acetylcysteine |
| NADPH | nicotinamide adenine dinucleotide phosphate |
| NF-κB | nuclear factor kappaB |
| NOS | nitric oxide synthase |
| NOX | NADPH oxidase |
| NOX4/NOX4 | NADPH Oxidase 4 |
| NOX-ROS | NOX-derived ROS |
| Nrf2 | nuclear factor erythroid 2-related factor 2 |
| PDTC | pyrrolidine dithiocarbamate |
| ROS | Reactive oxygen species |
| Se | Selenium |
| SEM | standard error of mean |
| SeMet | selenomethionine |
| TLR4 | Toll-like receptor 4 |
| TNF | tumor necrosis factor |
| TNF-α | tumor necrosis factor α |
| TRX | thioredoxin |
| TrxR | thioredoxin reductase |
References
- Paiano, R.B.; Birgel, D.B.; Bonilla, J.; Junior, E.H.B. Alterations in biochemical profiles and reproduction performance in postpartum dairy cows with metritis. Reprod. Domest. Anim. 2020, 55, 1599–1606. [Google Scholar] [CrossRef]
- Lindsay, C.V.; Potter, J.A.; Grimshaw, A.A.; Abrahams, V.M.; Tong, M. Endometrial responses to bacterial and viral infection: A scoping review. Hum. Reprod. Update 2023, 29, 675–693. [Google Scholar] [CrossRef]
- Hu, N.; Wang, C.; Dai, X.; Zhou, M.; Gong, L.; Yu, L.; Peng, C.; Li, Y. Phillygenin inhibits LPS-induced activation and inflammation of LX2 cells by TLR4/MyD88/NF-κB signaling pathway. J. Ethnopharmacol. 2020, 248, 112361. [Google Scholar] [CrossRef] [PubMed]
- Dong, J.; Qu, Y.; Li, J.; Cui, L.; Wang, Y.; Lin, J.; Wang, H. Cortisol inhibits NF-κB and MAPK pathways in LPS activated bovine endometrial epithelial cells. Int. Immunopharmacol. 2018, 56, 71–77. [Google Scholar] [CrossRef]
- Cui, L.; Zheng, F.; Zhang, M.; Wang, Z.; Meng, X.; Dong, J.; Liu, K.; Guo, L.; Wang, H.; Li, J. Selenium suppressed the LPS-induced oxidative stress of bovine endometrial stromal cells through Nrf2 pathway with high cortisol background. J. Anim. Sci. 2024, 102, skae260. [Google Scholar] [CrossRef] [PubMed]
- Begum, R.; Thota, S.; Abdulkadir, A.; Kaur, G.; Bagam, P.; Batra, S. NADPH oxidase family proteins: Signaling dynamics to disease management. Cell. Mol. Immunol. 2022, 19, 660–686. [Google Scholar] [CrossRef]
- Boni, R.; Gualandi, S.C. Relationship between oxidative stress and endometritis: Exploiting knowledge gained in mares and cows. Animals 2022, 12, 2403. [Google Scholar] [CrossRef] [PubMed]
- Li, P.; Liu, Q.; Zhang, T.; Guo, W.; Qiao, W.; Deng, M. Protective effects of lixisenatide against lipopolysaccharide-induced inflammation response in MAC-T bovine mammary epithelial cells: A therapeutic implication in mastitis. Chem. Res. Toxicol. 2020, 33, 982–987. [Google Scholar] [CrossRef]
- Jiang, K.; Ye, W.; Bai, Q.; Cai, J.; Wu, H.; Li, X. Therapeutic role of miR-30a in lipoteichoic acid-induced endometritis via targeting the MyD88/Nox2/ROS signaling. Oxidative Med. Cell. Longev. 2021, 2021, 5042048. [Google Scholar] [CrossRef]
- Jiang, K.; Yang, J.; Xue, G.; Dai, A.; Wu, H. Fisetin ameliorates the inflammation and oxidative stress in lipopolysaccharide-induced endometritis. J. Inflamm. Res. 2021, 14, 2963–2978. [Google Scholar] [CrossRef]
- Morgan, M.J.; Liu, Z.G. Crosstalk of reactive oxygen species and NF-κB signaling. Cell Res. 2011, 21, 103–115. [Google Scholar] [CrossRef]
- Yu, C.; Zhang, C.; Huai, Y.; Liu, D.; Zhang, M.; Wang, H.; Zhao, X.; Bo, R.; Li, J.; Liu, M. The inhibition effect of caffeic acid on NOX/ROS-dependent macrophages M1-like polarization contributes to relieve the LPS-induced mice mastitis. Cytokine 2024, 174, 156471. [Google Scholar] [CrossRef] [PubMed]
- Xiao, J.; Khan, M.Z.; Ma, Y.; Alugongo, G.M.; Ma, J.; Chen, T.; Khan, A.; Cao, Z. The antioxidant properties of selenium and Vitamin E; their role in periparturient dairy cattle health regulation. Antioxidants 2021, 10, 1555. [Google Scholar] [CrossRef]
- Gong, J.; Xiao, M. Effect of organic selenium supplementation on selenium status, oxidative stress, and antioxidant status in selenium-adequate dairy cows during the periparturient period. Biol. Trace Elem. Res. 2018, 186, 430–440. [Google Scholar] [CrossRef]
- Hall, J.A.; Bobe, G.; Vorachek, W.R.; Klopfenstein, J.J.; Thompson, I.O.; Cruz, C.L.Z.; Dolan, B.P.; Jin, L.; Davis, T.Z. Effects of supranutritional selenium supplementation during different trimesters of pregnancy on humoral Iimmunity in beef cattle at parturition. Biol. Trace Elem. Res. 2024, 203, 3709–3723. [Google Scholar] [CrossRef]
- Yazlık, M.O.; Çolakoğlu, H.E.; Pekcan, M.; Kaya, U.; Küplülü, Ş.; Kaçar, C.; Polat, M.; Vural, M.R. Effects of injectable trace element and vitamin supplementation during the gestational, peri-parturient, or early lactational periods on neutrophil functions and pregnancy rate in dairy cows. Anim. Reprod. Sci. 2021, 225, 106686. [Google Scholar] [CrossRef]
- Chen, Y.; Zhao, Y.F.; Yang, J.; Jing, H.Y.; Liang, W.; Chen, M.Y.; Yang, M.; Wang, Y.; Guo, M.Y. Selenium alleviates lipopolysaccharide-induced endometritis via regulating the recruitment of TLR4 into lipid rafts in mice. Food Funct. 2020, 11, 200–210. [Google Scholar] [CrossRef] [PubMed]
- Cui, L.; Zhong, J.; Duan, J.; Li, W.; Mao, P.; Dong, J.; Liu, K.; Guo, L.; Wang, H.; Li, J. The antioxidant effect of selenium is enhanced by cortisol through Nrf2 pathway in bovine endometrial epithelial cells. Animals 2025, 15, 1075. [Google Scholar] [CrossRef] [PubMed]
- Cui, L.; Zhang, M.; Zheng, F.; Yuan, C.; Wang, Z.; Qiu, S.; Meng, X.; Dong, J.; Liu, K.; Guo, L.; et al. Selenium elicited an enhanced anti-inflammatory effect in primary bovine endometrial stromal cells with high cortisol background. BMC Vet. Res. 2024, 20, 383. [Google Scholar] [CrossRef] [PubMed]
- Lv, D.; Xu, Y.; Cheng, H.; Ke, Y.; Zhang, X.; Ying, K. A novel cell-based assay for dynamically detecting neutrophil extracellular traps-induced lung epithelial injuries. Exp. Cell Res. 2020, 394, 112101. [Google Scholar] [CrossRef]
- Huang, T.; Gao, D.; Jiang, X.; Hu, S.; Zhang, L.; Fei, Z. Resveratrol inhibits oxygen-glucose deprivation-induced MMP-3 expression and cell apoptosis in primary cortical cells via the NF-κB pathway. Mol. Med. Rep. 2014, 10, 1065–1071. [Google Scholar] [CrossRef]
- Muniroh, M.; Khan, N.; Koriyama, C.; Akiba, S.; Vogel, C.F.; Yamamoto, M. Suppression of methylmercury-induced IL-6 and MCP-1 expressions by N-acetylcysteine in U-87MG human astrocytoma cells. Life Sci. 2015, 134, 16–21. [Google Scholar] [CrossRef]
- Tao, L.; Liu, K.; Li, J.; Zhang, Y.; Cui, L.; Dong, J.; Meng, X.; Zhu, G.; Wang, H. Selenomethionine alleviates NF-κB-mediated inflammation in bovine mammary epithelial cells induced by Escherichia coli by enhancing autophagy. Int. Immunopharmacol. 2022, 110, 108989. [Google Scholar] [CrossRef]
- Dong, J.; Li, J.; Li, J.; Cui, L.; Meng, X.; Qu, Y.; Wang, H. The proliferative effect of cortisol on bovine endometrial epithelial cells. Reprod. Biol. Endocrinol. 2019, 17, 97. [Google Scholar] [CrossRef]
- Williams, E.J.; Fischer, D.P.; Noakes, D.E.; England, G.C.W.; Rycroft, A.; Dobson, H.; Sheldon, I.M. The relationship between uterine pathogen growth density and ovarian function in the postpartum dairy cow. Theriogenology 2007, 68, 549–559. [Google Scholar] [CrossRef]
- Sheldon, I.M.; Cronin, J.G.; Bromfield, J.J. Tolerance and innate immunity shape the development of postpartum uterine disease and the impact of endometritis in dairy cattle. Annu. Rev. Anim. Biosci. 2019, 7, 361–384. [Google Scholar] [CrossRef]
- Guo, J.; Li, C.G.; Mai, F.Y.; Liang, J.R.; Chen, Z.H.; Luo, J.; Zhou, M.C.; Wang, Y.L.; Yang, W.T. Lithospermic acid targeting heat shock protein 90 attenuates LPS-induced inflammatory response via NF-κB signalling pathway in BV2 microglial cells. Immunol. Res. 2025, 73, 54. [Google Scholar] [CrossRef] [PubMed]
- Vermot, A.; Petit-Härtlein, I.; Smith, S.M.E.; Fieschi, F. NADPH oxidases (NOX): An overview from discovery, molecular mechanisms to physiology and pathology. Antioxidants 2021, 10, 890. [Google Scholar] [CrossRef] [PubMed]
- Islam, S.U.; Lee, J.H.; Shehzad, A.; Ahn, E.M.; Lee, Y.M.; Lee, Y.S. Decursinol angelate inhibits LPS-induced macrophage polarization through modulation of the NFκB and MAPK signaling pathways. Molecules 2018, 23, 1880. [Google Scholar] [CrossRef] [PubMed]
- Menden, H.; Tate, E.; Hogg, N.; Sampath, V. LPS-mediated endothelial activation in pulmonary endothelial cells: Role of Nox2-dependent IKK-β phosphorylation. Am. J. Physiol. Lung Cell. Mol. Physiol. 2013, 304, L445–L455. [Google Scholar] [CrossRef]
- Cho, R.L.; Yang, C.C.; Lee, I.T.; Lin, C.C.; Chi, P.L.; Hsiao, L.D.; Yang, C.M. Lipopolysaccharide induces ICAM-1 expression via a c-Src/NADPH oxidase/ROS-dependent NF-κB pathway in human pulmonary alveolar epithelial cells. Am. J. Physiol. Lung Cell. Mol. Physiol. 2016, 310, L639–L657. [Google Scholar] [CrossRef]
- Palumbo, S.; Shin, Y.J.; Ahmad, K.; Desai, A.A.; Quijada, H.; Mohamed, M.; Knox, A.; Sammani, S.; Colson, B.A.; Wang, T.; et al. Dysregulated Nox4 ubiquitination contributes to redox imbalance and age-related severity of acute lung injury. Am. J. Physiol. Lung Cell. Mol. Physiol. 2017, 312, L297–L308. [Google Scholar] [CrossRef]
- Augsburger, F.; Filippova, A.; Rasti, D.; Seredenina, T.; Lam, M.; Maghzal, G.; Mahiout, Z.; Jansen-Dürr, P.; Knaus, U.G.; Doroshow, J.; et al. Pharmacological characterization of the seven human NOX isoforms and their inhibitors. Redox Biol. 2019, 26, 101272. [Google Scholar] [CrossRef] [PubMed]
- Huang, W.Y.; Lin, S.; Chen, H.Y.; Chen, Y.P.; Chen, T.Y.; Hsu, K.S.; Wu, H.M. NADPH oxidases as potential pharmacological targets against increased seizure susceptibility after systemic inflammation. J. Neuroinflamm. 2018, 15, 140. [Google Scholar] [CrossRef] [PubMed]
- Kim, T.W.; Lee, H.G. Anti-inflammatory 8-shogaol mediates apoptosis by inducing oxidative stress and sensitizes radioresistance in gastric cancer. Int. J. Mol. Sci. 2024, 26, 173. [Google Scholar] [CrossRef] [PubMed]
- Masamune, A.; Watanabe, T.; Kikuta, K.; Satoh, K.; Shimosegawa, T. NADPH oxidase plays a crucial role in the activation of pancreatic stellate cells. Am. J. Physiol. Gastrointest. Liver Physiol. 2008, 294, G99–G108. [Google Scholar] [CrossRef]
- Tan, P.; Yang, J.; Yi, F.; Mei, L.; Wang, Y.; Zhao, C.; Zhao, B.; Wang, J. Strontium attenuates LPS-induced inflammation via TLR4/MyD88/NF-κB pathway in bovine ruminal epithelial cells. Biol. Trace Elem. Res. 2024, 202, 3988–3998. [Google Scholar] [CrossRef]
- Pereira, B.P.; do Valle, G.T.; Salles, B.C.C.; Costa, K.C.M.; Ângelo, M.L.; Torres, L.H.L.; Novaes, R.D.; Ruginsk, S.G.; Tirapelli, C.R.; de Araújo Paula, F.B.; et al. Pyrrolidine dithiocarbamate reduces alloxan-induced kidney damage by decreasing nox4, inducible nitric oxide synthase, and metalloproteinase-2. Naunyn-Schmiedeberg’s Arch. Pharmacol. 2020, 393, 1899–1910. [Google Scholar] [CrossRef]
- Wang, L.; Li, L.; Zhao, D.; Yuan, H.; Zhang, H.; Chen, J.; Pang, D.; Lu, Y.; Ouyang, H. MYH7 R453C induced cardiac remodelling via activating TGF-β/Smad2/3, ERK1/2 and Nox4/ROS/NF-κB signalling pathways. Open Biol. 2024, 14, 230427. [Google Scholar] [CrossRef]
- Huang, S.H.; Liu, Z.M.; Chen, S.J.; Tu, P.Y.; Tien, Y.C.; Lu, C.C.; Wang, C.C.; Chen, L.M.; Shen, P.C. MiR-708-5p attenuates osteoarthritis progression via multi-target modulation of the NOX4/NF-κB axis and cartilage homeostasis. Cartilage 2025, 19476035251361679. [Google Scholar] [CrossRef]
- Zhu, Z.; Zhao, X.; OuYang, Q.; Wang, Y.; Xiong, Y.; Cong, S.; Zhou, M.; Zhang, M.; Luo, X.; Cheng, M. Waterfall forest environment regulates chronic stress via the NOX4/ROS/NF-κB signaling pathway. Front. Neurol. 2021, 12, 619728. [Google Scholar] [CrossRef] [PubMed]
- Salman, S.; Khol-Parisini, A.; Schafft, H.; Lahrssen-Wiederholt, M.; Hulan, H.W.; Dinse, D.; Zentek, J. The role of dietary selenium in bovine mammary gland health and immune function. Anim. Health Res. Rev. 2009, 10, 21–34. [Google Scholar] [CrossRef] [PubMed]
- Zhang, F.; Li, X.; Wei, Y. Selenium and selenoproteins in health. Biomolecules 2023, 13, 799. [Google Scholar] [CrossRef]
- Adeniran, S.O.; Zheng, P.; Feng, R.; Adegoke, E.O.; Huang, F.; Ma, M.; Wang, Z.; Ifarajimi, O.O.; Li, X.; Zhang, G. The antioxidant role of selenium via GPx1 and GPx4 in LPS-induced oxidative stress in bovine endometrial cells. Biol. Trace Elem. Res. 2022, 200, 1140–1155. [Google Scholar] [CrossRef]
- Campo-Sabariz, J.; García-Vara, A.; Moral-Anter, D.; Briens, M.; Hachemi, M.A.; Pinloche, E.; Ferrer, R.; Martín-Venegas, R. Hydroxy-selenomethionine, an organic selenium source, increases selenoprotein expression and positively modulates the inflammatory response of LPS-stimulated macrophages. Antioxidants 2022, 11, 1876. [Google Scholar] [CrossRef]
- Yang, J.; Hamid, S.; Cai, J.; Liu, Q.; Xu, S.; Zhang, Z. Selenium deficiency-induced thioredoxin suppression and thioredoxin knock down disbalanced insulin responsiveness in chicken cardiomyocytes through PI3K/Akt pathway inhibition. Cell. Signal. 2017, 38, 192–200. [Google Scholar] [CrossRef]
- Cui, L.; Zhang, J.; Guo, J.; Zhang, M.; Li, W.J.; Dong, J.; Liu, K.J.; Guo, L.; Li, J.; Wang, H.; et al. Selenium suppressed the LPS-induced inflammation of bovine endometrial epithelial cells through NF-κB and MAPK pathways under high cortisol background. J. Cell. Mol. Med. 2023, 27, 1373–1383. [Google Scholar] [CrossRef]
- Xu, S.; Miao, Y.; Dong, J.; Cui, L.; Liu, K.; Li, J.; Meng, X.; Zhu, G.; Wang, H. Selenomethionine inhibits NF-κB-mediated inflammatory responses of bovine mammary epithelial cells caused by Klebsiella pneumoniae by increasing autophagic flux. Biol. Trace Elem. Res. 2024, 202, 1568–1581. [Google Scholar] [CrossRef] [PubMed]




| Gene Name | Primer Sequence (5′-3′) | Product Size (bp) | NCBI Number |
|---|---|---|---|
| CYBB | F: CTCAGCTACAACATCTGCCTCACT R: CTGTGATTACATCTTTCTCCTCGTCAT | 91 | NM_174035.4 |
| NOX4 | F: GAGCAACAAGCCAGTCACCAT R: TTCTTTGACCATTCGGATTTCC | 76 | NM_001304775.1 |
| TNF | F: CCACGTTGTAGCCGACATC R: CCCTGAAGAGGACCTGTGAG | 134 | NM_173966.3 |
| IL1B | F: AGGTCCATACCTGACGGCTA R: TTGGGTGTCTCAGGCATCTC | 132 | NM_174092.1 |
| ACTB | F: CATCACCATCGGCAATGAGC R: AGCACCGTGTTGGCGTAGAG | 156 | NM_173979.3 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cui, L.; Li, W.; He, S.; Guo, L.; Liu, K.; Dong, J.; Li, J.; Wang, H. Inhibition of NOX4-Mediated ROS Production Contributes to Selenomethionine’s Anti-Inflammatory Effect in LPS-Stimulated Bovine Endometrial Epithelial Cells. Vet. Sci. 2025, 12, 789. https://doi.org/10.3390/vetsci12090789
Cui L, Li W, He S, Guo L, Liu K, Dong J, Li J, Wang H. Inhibition of NOX4-Mediated ROS Production Contributes to Selenomethionine’s Anti-Inflammatory Effect in LPS-Stimulated Bovine Endometrial Epithelial Cells. Veterinary Sciences. 2025; 12(9):789. https://doi.org/10.3390/vetsci12090789
Chicago/Turabian StyleCui, Luying, Wanting Li, Sasa He, Long Guo, Kangjun Liu, Junsheng Dong, Jianji Li, and Heng Wang. 2025. "Inhibition of NOX4-Mediated ROS Production Contributes to Selenomethionine’s Anti-Inflammatory Effect in LPS-Stimulated Bovine Endometrial Epithelial Cells" Veterinary Sciences 12, no. 9: 789. https://doi.org/10.3390/vetsci12090789
APA StyleCui, L., Li, W., He, S., Guo, L., Liu, K., Dong, J., Li, J., & Wang, H. (2025). Inhibition of NOX4-Mediated ROS Production Contributes to Selenomethionine’s Anti-Inflammatory Effect in LPS-Stimulated Bovine Endometrial Epithelial Cells. Veterinary Sciences, 12(9), 789. https://doi.org/10.3390/vetsci12090789

