Next Article in Journal
Management Practices of Bovine Mastitis and Milk Quality on Egyptian Dairies
Next Article in Special Issue
Biological Control of Hyalomma Ticks in Cattle by Fungal Isolates
Previous Article in Journal
Euthanasia of Cats by Australian Veterinarians: A Survey of Current Practices
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Veterinary Sciences
Volume 10
Issue 10
10.3390/vetsci10100628
vetsci-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Argas persicus and Carios vespertilionis Ticks Infesting Ducks, Domestic Fowls and Bats in Pakistan: First Report on Molecular Survey and Phylogenetic Position of Borrelia anserina

by
Hafsa Zahid
1,
Abdulaziz Alouffi
2,
Mashal M. Almutairi
3,
Muhammad Ateeq
4,
Tetsuya Tanaka
5,
Shun-Chung Chang
6,*,
Chien-Chin Chen
7,8,9,10 and
Abid Ali
1,*
1
Department of Zoology, Abdul Wali Khan University Mardan, Mardan 23200, Pakistan
2
King Abdulaziz City for Science and Technology, Riyadh 12354, Saudi Arabia
3
Department of Pharmacology and Toxicology, College of Pharmacy, King Saud University, Riyadh 11451, Saudi Arabia
4
Department of Chemistry, Abdul Wali Khan University Mardan, Mardan 23200, Pakistan
5
Laboratory of Infectious Diseases, Joint Faculty of Veterinary Medicine, Kagoshima University, Kagoshima 890-0065, Japan
6
Department of Emergency Medicine, Ditmanson Medical Foundation Chia-Yi Christian Hospital, Chiayi 60002, Taiwan
7
Department of Pathology, Ditmanson Medical Foundation Chia-Yi Christian Hospital, Chiayi 60002, Taiwan
8
Department of Cosmetic Science, Chia Nan University of Pharmacy and Science, Tainan 717, Taiwan
9
Ph.D. Program in Translational Medicine, Rong Hsing Research Center for Translational Medicine, National Chung Hsing University, Taichung 402, Taiwan
10
Department of Biotechnology and Bioindustry Sciences, College of Bioscience and Biotechnology, National Cheng Kung University, Tainan 701, Taiwan
*
Authors to whom correspondence should be addressed.
Vet. Sci. 2023, 10(10), 628; https://doi.org/10.3390/vetsci10100628
Submission received: 11 September 2023 / Revised: 10 October 2023 / Accepted: 12 October 2023 / Published: 20 October 2023
(This article belongs to the Special Issue Epidemiology, Diagnosis and Treatment of Tick-Borne Diseases)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

Soft ticks are well-known for vectoring several disease-causing pathogens that are distributed throughout the world. Surveillance of disease-causing agents associated with these ticks is important to avoid any zoonotic consequences. This study reported the epidemiology and molecular characterization of Borrelia anserina in Argas persicus collected from domestic fowls, ducks and their shelters and Carios vespertilionis ticks infesting bats in Khyber Pakhtunkhwa (KP), Pakistan. In the phylogenetic tree, the obtained sequences of A. persicus and C. vespertilionis clustered with the sequences from Pakistan and neighboring countries, while the Borrelial flaB sequence revealed its relationship with the corresponding species belonging to the relapsing fever group. Further studies are encouraged to screen soft ticks for pathogens that affect public and veterinary health.

Abstract

Argasid ticks have the vectorial potential for transmitting disease-causing pathogens to avian hosts, resulting in economic losses that may not be fully estimated. Borrelia species are the responsible agents of borreliosis in poultry, animals and humans. Our previous studies have reported a high prevalence of Argas persicus infesting domestic fowls in Khyber Pakhtunkhwa (KP), Pakistan. However, molecular screening and genetic characterization of Borrelia spp. in A. persicus have been neglected in Pakistan. In this study, we focused on the molecular epidemiology and genetic characterization of Borrelia spp. associated with A. persicus ticks infesting domestic fowls and ducks, and Carios vespertilionis infesting bats in selected districts of KP. Overall, 1818 ticks, including females (415; 23%), males (345; 19%), nymphs (475; 26%) and larvae (583; 32%), were collected from 27 locations in nine districts (Peshawar, Mardan, Swabi, Charsadda, Chitral, Lakki Marwat, Bannu, Bajaur and Hangu) from domestic fowls, ducks and their shelters, and bats. A subset of 197 ticks was selected for DNA extraction and PCR to amplify fragments of the cytochrome c oxidase (cox) gene for ticks and flagellin B (flaB) for the detection and genetic characterization of associated Borrelia spp. Among these, only Borrelia anserina DNA was detected in 40 ticks (27.2%) of different life stages, where highest prevalence was found in female ticks (18; 45%), followed by nymphs (12; 30%), larvae (7; 17.5%) and males (3; 7.5%). Tick infestation in shelters (1081; 77%) was higher than on hosts (323; 23%). The resultant cox amplicons of A. persicus showed 100% identity with the same species reported from Pakistan, China, Iran, Kenya, Kazakhstan, Algeria and Egypt and C. vespertilionis show 100% identity with the species reported from Pakistan, China, Japan, Kenya, Vietnam, Spain, Netherlands, the United Kingdom and Hungry, and clustered with the aforementioned species in the phylogenetic tree. The obtained Borrelia sequences showed 100% identity with B. anserina and revealed a close resemblance to the relapsing fever group and clustered in a monophyletic clade with B. anserina from India, Iran and Brazil in a phylogenetic tree. These results establish the first molecular characterization of B. anserina in A. persicus infesting domestic fowls and ducks in the region, as well as their shelters. To effectively control zoonotic consequences, country-wide surveillance research should be encouraged to screen soft ticks infesting various birds for associated pathogens.

1. Introduction

Soft tick Argas persicus is the most common ectoparasite of birds that harbors disease-causing agents, including Borrelia spp. [1,2,3], causing diseases and un-estimated economic losses to the poultry industry. The occurrences and re-occurrences of infections triggered by bat-associated pathogens have considerably increased during the last decades and has attracted attention towards the screening of ectoparasites such as the bat tick Carios vespertilionis [4].
Argas persicus ticks infest birds such as domestic fowls (Gallus gallus domesticus), ducks (Anas platyrhynchos), turkeys (Meleagris gallopavo), geese (Anser anser domesticus), peacocks (Pavo cristatus), pigeons (Columba livia) and other wild birds [3,5,6,7]. The Gram-negative bacterium Borrelia anserina has been detected in A. persicus ticks that cause avian borreliosis in domestic fowls, doves, turkeys, geese, pheasants and canary birds in tropical and subtropical regions [3,7,8,9]. Borreliosis caused by B. anserina was reported for the first time in Russia in a widespread outbreak in geese [10]. After a few years, the role of Argas ticks as a natural vector for borreliosis was confirmed in other continents [11]. Subsequently, this pathogen attracted attention to its molecular epidemiology and the role of Argas ticks as vector. The role of C. vespertilionis as a carrier of pathogens such as viruses, bacteria and protozoans has been documented previously [12]. Among bacterial pathogens, this tick is a competent vector for Borrelia burgdorferi which causes Lyme disease in humans [12,13].
The members of Borrelia spp. complex are recognized as causative agents of numerous human and animal diseases, such as Lyme disease (LD) and relapsing fever group (RFG) [7]. The genus Borrelia is comprised of about ~52 species with worldwide distribution [14,15]. These species are transmitted to the host by tick species belonging to different genera, such as Argas, Ornithodoros, Ixodes, Amblyomma, Hyalomma, Rhipicephalus and Bothriocroton, while one species is known to be transmitted by Pediculus humanus corporis (human body lice) [16,17]. Borreliosis is categorized into different well-defined groups: LD, RFG borreliosis and reptile-associated group (REP) [18,19]. The accurate identification of Borrelia spp. at a species level is complicated by using microscopy. However, some reports differentiate the isolates of Borrelia spp. by using different techniques such as serological tests, immunological assays and molecular approaches [20,21,22].
Pakistan is one of the world’s largest poultry production industry, providing about 1163 million broilers. The poultry sector offers employment to more than 1.5 million people, and the investment is about Rs 750 billion to the country (Pakistan Economic Survey, Ministry of Finance, Government of Pakistan, 2022). The poultry sector faces severe issues due to vector-borne diseases, including borreliosis. Argas persicus ticks are reservoir hosts for disease-causing pathogens such as Borrelia spp. that cause borreliosis worldwide [23,24]. To reduce the economic losses of the poultry sector, regular surveillance and genetic characterization of ticks and tick-borne Borrelia spp. are of great importance.
To our knowledge, nine soft tick species have been reported from Pakistan. Among which five species (Argas sp. “rousetti”, Argas persicus, C. vespertilionis and Ornithodoros sp.) have been molecularly characterized, while four species (Argas abdussalami, Argas lahorensis, Ornnithodoros papillipies and Ornithodoros tholozani) were identified morphologically [2,25,26,27,28]. Several studies have shown a wide range of pathogens associated with A. persicus [3,9]. In a previous study [2], we reported the life cycle and molecular phylogeny of the fowl tick A. persicus. The hard ticks and associated pathogens have been investigated in Pakistan [29,30,31,32,33]. However, studies have neglected to characterize Borrelia spp. associated with the soft tick. This study was designed to investigate the molecular epidemiology and genetic characterization of A. persicus infesting domestic fowls and ducks, C. vespertilionis infesting bats and their associated Borrelia spp. in Pakistan.

2. Materials and Methods

2.1. Collection Sites

The current study was carried out in nine districts of Khyber Pakhtunkhwa (KP), Pakistan, including Peshawar (34°1′33.3012″ N, 71°33′36.4860″ E), Mardan (34°12′22.0428″ N, 72°1′47.2800″ E), Swabi (34°7′12.5580″ N, 72°28′12.5544″ E), Charsadda (34°10′00.1″ N 71°45′20.0″ E), Chitral (35°45′57.9″ N 71°47′09.2″ E), Lakki Marwat (32°36′43.1″ N 70°54′09.8″ E), Bannu (32°59′27.9″ N 70°38′48.3″ E), Bajaur (34°47′30.4″ N 71°30′13.9″ E) and Hangu (33°32′06.0″ N 71°04′03.1″ E). These regions were selected based on their different climatic and geographic conditions. Three regions were selected for collection in each district. Google maps were used to collect the geographic coordinates, and the collected data were arranged in a Microsoft Excel (Microsoft Corp., Redmond, WA, USA) worksheet to construct a distribution map for the study area using ArcGIS 10.3.1 (ESRI, Redlands, CA, USA) (Figure 1).

2.2. Ethical Approval

Prior approval for this research was received from the members of Advance Studies and Research Board, Abdul Wali Khan University, Mardan, under the approval no (Dir/A&R/AWKUM/2022/9395). Written/oral consent was taken from the holders of domestic fowls and ducks before tick collection from the shelters.

2.3. Tick Collection, Preservations and Identification

Ticks were collected from shelters of domestic fowls and ducks from different collection spots of the selected districts. Bats were captured by local farmers in their gardens using hand nets and kept in separate perforated bags. Ticks were removed carefully from the bat’s body by using fine sterile tweezers. Collected ticks were kept in sterile bottles and labeled with related information (host, collection date, coordinates, temperature and humidity). Before further analysis, ticks were washed with distilled water followed by 70% ethanol and preserved in 100% ethanol in 1.5 mL tubes. Morphological identification was carried out under the stereomicroscope (StereoBlue-euromex, Arnhem, The Netherlands) using available morphological keys [34,35].

2.4. Molecular Analyses

Among the collected ticks, 147 partially fed A. persicus ticks (16 ticks from each district; 4 ticks from each life stage, 2 from a host and 2 from a shelter) and 3 ticks from each (F/M/N) of the ducks were randomly selected for further molecular analysis. In case of the bat collected ticks, we selected ten C. vespertilionis ticks from each district for the extraction of genomic DNA via standard phenol-chloroform method [36]. Sterile needles were used to make holes in ticks before DNA extraction in the 1.5 mL tube and dried in the incubator to evaporate the ethanol. The quantification of extracted DNA was performed by a NanoDrop (Nano-Q, Optizen, Daejeon, Republic of Korea).
The extracted DNA was subjected to PCR for the molecular identification of ticks using the cox and 16S rRNA gene fragment. The PCR mixture (20 µL) was comprised of 1 µL each primer (10 µM), 4 µL PCR grade water, 2 µL template DNA (50–100 ng/µL) and 12 µL of DreamTaq PCR MasterMix (2×) (Thermo Scientific, Waltham, MA, USA). PCR for the cox and 16S rRNA gene was performed according to the previously described conditions [2,32]. The electrophoreses of PCR products was performed in 1.5% agarose gel stained with ethidium bromide and visualized under UV in the Gel Documentation System (UVP BioDoc-It Imaging System, Upland, CA, USA).
Each of the extracted DNA samples were screened for tick-associated Borrelia spp. by targeting the amplification of the flaB partial gene. In the initial PCR, the primer pair (Fla LL, and Fla RL) was followed by a nested PCR using 0.5 µL PCR product as the template and primer (Fla SS and Fla RS) to amplify 665 bp and 354 bp, respectively (Table 1). The PCR conditions for both reactions were set according to Stromdahl et al. [37]. In the PCR reactions, a Borrelia spp. of Amblyomma gervaisi, Rickettsia massiliae of Rhipicephalus microplus, Ehrlichia spp. and distilled water were taken as a positive and negative control, respectively.

2.5. Sequence and Phylogenetic Analysis

The amplified PCR products showing the expected size were purified using a commercial NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Duren, Germany) following the manufacturer’s directions. The purified PCR amplicons were sent to a commercial company for bidirectional sequencing (Macrogen, Inc., Seoul, Republic of Korea). The obtained sequences were subjected to trimming and assembled to remove the primer’s contamination and poor reading regions in SeqMan v. 5.0 (DNASTAR, Inc., Madison, WI, USA). Trimmed sequences were subjected to BLAST (Basic Local Alignment Search Tool) at NCBI (National Center for Biotechnology Information) [41] to download identical sequences. Identical sequences were downloaded and aligned by ClustalW Multiple alignments [42] in BioEdit alignment editor v. 7.0.5 (Raleigh, NC, USA) [43]. The phylogenetic tree, based on cox for ticks and flaB sequence for Borrelia spp., was constructed using the Maximum Likelihood method based on the Kimura 2-parameter in MEGA-X (Molecular evolutionary genetics analysis), aligned by MUSCLE [44] using 1000 bootstrap replicons [45].

2.6. Statistical Analyses

The data such as tick infestation on hosts and shelters in the different regions were assembled and arranged in spreadsheets on Microsoft Excel v. 2016. The tick infestation of each life stage on host and shelters, and prevalence of B. anserina between different regions, was analyzed in GraphPad Prism v. 5.00 (GraphPad Software Inc., San Diego, CA, USA).

3. Results

3.1. Tick Infestation

All the collected ticks were morphologically identified as A. persicus based on the presence of a lateral line and possessed less than 100 integumental cells around the body margin [30]. Among 1818 collected ticks, 415 (23.00%) were females, 345 (19.00%) were males, 475 (26.00%) were nymphs and 583 (32.00%) were larvae from nine districts (Peshawar, Mardan, Swabi, Charsadda, Chitral, Lakki Marwat, Bannu, Bajaur and Hangu) (Table 2). The larval stage were found the highest most, while the male ticks were found the least. Overall, the highest prevalence of ticks was found in the Mardan district (297; 16%) followed by Peshawar (292; 16.3%), Charsadda (283; 15.6%), Swabi (234; 13%), Hangu (173; 9.5%) Lakki Marwat (169; 9.3%), Bannu (159; 8.7%), while the lowest prevalence was found in the districts Bajaur (112; 6.2%) and Chitral (99; 5.4%).
Among the different districts, the highest tick prevalence of A. persicus was found in Peshawar (201; 14.31%), followed by Mardan (199; 14.17%), Charsadda (194; 13.81%), Swabi (173; 12.32%), Lakki Marwat (169; 12.03%), Bannu (159; 11.32%) and Bajaur (112; 7.97%), while the lowest infestation was found in the district Hangu (98; 6.98%) and Chitral (58; 4.13%), while tick prevalence on ducks was (41; 2.2%). Tick-infested ducks were only found in the Chitral district. The C. vespertilionis were collected from five districts, in which the highest prevalence was found in the Mardan district (98; 23.6%) followed by Peshawar (91; 22), Charsadda (89; 21.4%), Hangu (75; 18%) and Swabi (61; 15%). Tick infestation of each life stage between hosts and shelters is shown in Table 2.
In a total of 189 examined shelters, tick infestation was found in 79 (42%) shelters in different selected districts. Among the selected districts, the highest prevalence of infested shelters was found in the Charsadda district (20/12; 55%), followed by Peshawar (25/12; 48%), Mardan (23/11; 47.82%), Swabi (21/10; 47.61%), Bannu (20/9; 45%) and Hangu (12/5; 41.66%). While the lowest infestation was found in the Chitral district (21/5; 23.80%), Lakki Marwat (21/7; 33.33%) and Bajaur (18/7; 38.88%). Among the eight visited shelters of ducks in Chitral, only two (25%) were tick-infested.

3.2. Detection of Borrelia anserina

Among a subset of 197 screened ticks for Borrelia spp., 40 (27.2%) were found positive for B. anserina based on flaB fragment (long and short sequences). Among the 40 positive samples, only 5 showed faint bands in the initial PCR (long fragments), while 35 were positive in nested PCR (short fragments) and sequencing. In 40 (27.2%) Borrelia positive ticks, the highest prevalence was found in female ticks (18/40; 45%), followed by nymphs (12/40; 30%), larvae (7/40; 17.5%) and males (3/40; 7.5%). The prevalence of ticks, infested shelters, life stages and details of B. anserina detection on host or shelter-collected ticks from selected districts are shown in Table 2. In the case of C. vespertilionis, all the screened ticks were found to be negative for B. anserina. Both A. persicus and C. vespertilionis were found to be negative for the presence of Rickettsia and Ehrlichia DNA.

3.3. Molecular and Phylogenetic Analysis

The BLAST results of the obtained cox sequences of ticks showed 100% identity with A. persicus from Pakistan-OQ860245, China-OM368319, Kenya-KJ133581, Algeria-OP326580 Kazakhstan-MN900726, Iran-KX879770 and Egypt-OM177661, and C. vespertilionis showed 100% identity with same species from Pakistan-MK571553, China-OM368317, Japan-MT762370, Kenya-KX431956, Vietnam-KX431960, KX431958, Netherlands-MK140085, MK140087, China-KY657239, Spain-NC060373, MT680028, OR139906, the United Kingdom-MF510174 and Hungary-KX431955. In the phylogenatic tree, the obtained sequences were clustered with mentioned sequences (Figure 2). The consensus sequences of A. persicus and C. vespertilionis were uploaded to GenBank (OP692725, OR614351).
The amplified flaB fragments showed 100% identity to the sequences of B. anserina from India-MK989712, MK128989, MK128990, Iran-KY438930 and Brazil-DQ849626. Among the 40 B. anserina sequences (5 long and 35 short), both long and short sequences showed identity to each other. Thus, one consensus sequence from each long and short sequence of B. anserina was uploaded to GenBank (OP326592, ON148464). The obtained sequence of B. anserina was clustered with the RFG species in the phylogenetic tree (Figure 3).

4. Discussion

Soft ticks A. persicus and C. vespertilionis are the common ectoparasites of several birds and bats, respectively, that have been morphologically and genetically characterized in several countries, including Pakistan [2,25,28,46,47,48]. However, knowledge of the associated Borrelia spp. has not been molecularly explored in the region. To fill this knowledge gap, the collected ticks were morphologically and molecularly examined and confirmed as A. persicus and C. vespertilionis infesting domestic fowls, ducks and bats in nine districts of KP, Pakistan. To our knowledge, this is the first report on the molecular epidemiology, genetic characterization, and comparison of Borrelia spp. on host- (domestic fowls and ducks) and shelter-collected A. persicus ticks in Pakistan. Ticks were screened for spirochetes, and B. anserina DNA was detected in A. persicus ticks while C. vespertilionis ticks were found negative for Borrelia DNA. The phylogenetic analysis of tick cox sequences revealed their closest relationship with the same species reported from Pakistan [2,28]. The phylogenetic tree of Borrelia flaB revealed that the aforementioned species belongs to the RFG of Borrelia species. The collected ticks were also screened for the presence of Rickettsia and Ehrlichia; however, DNA of none of these agents was detected.
The climatic conditions are mostly intricate with the prevalence and diversity of ticks in a region [49,50]. The highest prevalence of A. persicus was reported in hot atmospheric and humid regions such as Peshawar and Mardan, while the lowest prevalence was in low temperature, high altitude and less humid regions like Bajaur and Chitral, as previously described [2], while C. vespertilionis was most prevalent in the Mardan district and least prevalent in the Swabi district. The variation in prevalence with environmental temperature, high altitude, and rainfall indicates that the ticks prefer high temperature and rich humid regions where they can survive and reproduce favorably [3,32,50]. The annual increase in the climatic temperature facilitates the tick’s survival in the least prevalent and tick-free regions [51].
Complexities in the morphological identification of Argasid ticks still exist for taxonomists [52]. Thus, molecular approaches are used for accurate identification and genetic characterization of different species, especially Argasid ticks [23,53,54,55,56]. The host- (domestic fowls) and shelter-collected ticks were molecularly confirmed as a species, A. persicus, with the bat-collected ticks as C. vespertilionis. The results revealed that the ticks inhabiting shelters may pose severe health threats to animals and humans due to accidental infestation and the capability of transmitting pathogens [57,58,59]. The molecular data showed a close identity of the collected ticks with the previously reported A. persicus and C. vespertilionis from the same region. In the phylogenetic tree, the obtained cox sequences of ticks clustered with the same species reported from Pakistan and neighboring countries which is in agreement with the previous studies [2,28,54].
Argas persicus ticks are commonly involved in the transmission of Borrelia spp. in various domestic and wild birds [3]. The DNA of flaB for B. anserina was detected in all life stages, like larvae, nymphs, males and females of A. persicus, indicating their transovarial transmission [17]. The host- and shelter-collected ticks were comparatively screened and found positive for B. anserina, while in a similar screening, C. vespertilionis was found negative for any Borrelia spp. In the phylogenetic tree, B. anserina based on flaB sequences grouped with Borrelia species belongs to RFG. The outcomes of our study are consistent with the findings of previous reports that demonstrated B. anserina falls within a monophyletic clade with the species of the RFG [16,55,56,60,61,62,63,64,65]. The presence of Borrelia spp. has also been reported in several birds such as domestic fowls, ducks, geese, king penguins, blackbirds and nightingales in different regions of the world [52,53]. Birds should be investigated for Borrelia spp. to restrict any Borrelia epidemics and zoonosis consequences. Since this study represents a limited number of analyzed specimens from selected regions, detailed large-scale molecular surveillance of soft tick-associated pathogens is regularly needed to avoid zoonotic threats to birds and humans.

5. Conclusions

This study for the first time reported the genetic characterization of B. anserina in A. persicus infesting domestic fowls and ducks in KP, Pakistan. Additionally, the molecular data of C. vespertilionis revealed its closed resemblance with a previously reported tick from Pakistan. B. anserina was detected and genetically characterized for the first time in both the host- and shelter-collected A. persicus ticks. These results suggest that the freely moving infected A. persicus ticks in the shelters may pose health threats to healthy birds and humans. In the phylogenetic tree, the flaB sequences of B. anserina clustered with the corresponding species belonging to the RFG. Further studies are highly encouraged to screen soft ticks for Borrelia and other pathogens that affect public and veterinary health.

Author Contributions

H.Z. and A.A. (Abid Ali) designed the study. H.Z., A.A. (Abdulaziz Alouffi), M.M.A., M.A., T.T. and A.A. (Abdulaziz Alouffi) carried out the experiments. H.Z., A.A. (Abdulaziz Alouffi), M.M.A., M.A, T.T. and A.A. (Abid Ali) analyzed the results. S.-C.C., H.Z., A.A. (Abdulaziz Alouffi), M.M.A., A.A. (Abid Ali) and C.-C.C. contributed part of manuscript writing, critical revision of the manuscript for important intellectual content, study supervision and funding support. All authors have read and agreed to the published version of the manuscript.

Funding

The researchers support project number (RSP2023R494), King Saud University, Riyadh, Saudi Arabia.

Institutional Review Board Statement

The approval for this research was taken from the Advance Studies and Research Board, member of Abdul Wali Khan University, Mardan (Dir/A&R/AWKUM/2022/9395). Written/oral consent was taken from the owner of domestic fowls and ducks before tick collection from shelters.

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

All data generated or analyzed during this study were included in this article. Further inquiries can be directed to the corresponding author.

Acknowledgments

This work was carried out under financial support provided by the Paki-stan Science Foundation and Higher Education Commission of Pakistan. The researchers support by project number (RSP2023R494), King Saud University, Riyadh, Saudi Arabia.

Conflicts of Interest

The authors declare that there are no conflict of interest.

References

  1. Turell, M.J.; Mores, C.N.; Lee, J.S.; Paragas, J.J.; Shermuhemedova, D.; Endy, T.P.; Khodjaev, S. Experimental transmission of Karshi and Langat (tick-borne encephalitis virus complex) viruses by Ornithodoros ticks (Acari: Argasidae). J. Med. Entomol. 2004, 41, 973–977. [Google Scholar] [CrossRef] [PubMed]
  2. Zahid, H.; Muñoz-Leal, S.; Khan, M.Q.; Alouffi, A.S.; Labruna, M.B.; Ali, A. Life Cycle and Genetic Identification of Argas persicus Infesting Domestic Fowl in Khyber Pakhtunkhwa, Pakistan. Front. Vet. Sci. 2021, 8, 302. [Google Scholar] [CrossRef] [PubMed]
  3. Ouchene, N.; Nebbak, A.; Ouchene-Khelifi, N.A.; Dahmani, A.; Zeroual, F.; Khelef, D.; Bitam, I.; Benakhla, A.; Parola, P. Molecular detection of avian spirochete Borrelia anserina in Argas persicus ticks in Algeria. Comp. Immunol. Microbiol. Infect. Dis. 2020, 68, 101408. [Google Scholar] [CrossRef] [PubMed]
  4. Brook, C.E.; Dobson, A.P. Bats as ‘special’ reservoirs for emerging zoonotic pathogens. Trends Microbiol. 2015, 23, 172–180. [Google Scholar] [CrossRef] [PubMed]
  5. Estrada-Peña, A.; Venzal, J.M.; González-Acuña, D.; Guglielmone, A.A. Argas (Persicargas) keiransi n. sp. (Acari: Argasidae), a parasite of the Chimango, Milvago c. chimango (Aves: Falconiformes) in Chile. J. Med. Entomol. 2003, 40, 766–769. [Google Scholar] [CrossRef]
  6. Khoury, C.; Maroli, M. The pigeon tick, Argas reflexus, and hazard for human health. Ann. Ist. Super. Sanita 2004, 40, 427–432. [Google Scholar]
  7. Elelu, N. Tick-borne relapsing fever as a potential veterinary medical problem. Vet. Med. Sci. 2018, 4, 271–279. [Google Scholar] [CrossRef]
  8. Lisbôa, R.S.; Teixeira, R.C.; Rangel, C.P.; Santos, H.A.; Massard, C.L.; Fonseca, A.H. Avian spirochetosis in chickens following experimental transmission of Borrelia anserina by Argas (Persicargas) miniatus. Avian Dis. 2009, 53, 166–168. [Google Scholar] [CrossRef]
  9. Cutler, S.; Abdissa, A.; Adamu, H.; Tolosa, T.; Gashaw, A. Borrelia in Ethiopian ticks. Ticks Tick Borne Dis. 2012, 3, 14–17. [Google Scholar] [CrossRef]
  10. Sakharoff, M.N. Spirochaeta anserina et la septicemie des oies. Ann. Inst. Pasteur 1891, 5, 564–566. [Google Scholar]
  11. Faccini-Martínez, Á.A.; Silva-Ramos, C.R.; Santodomingo, A.M.; Ramírez-Hernández, A.; Costa, F.B.; Labruna, M.B.; Muñoz-Leal, S. Historical overview and update on relapsing fever group Borrelia in Latin America. Parasit. Vectors 2022, 15, 196. [Google Scholar] [CrossRef] [PubMed]
  12. Jaenson, T.G.; Wilhelmsson, P. First Record of a Suspected Human-Pathogenic Borrelia Species in Populations of the Bat Tick Carios vespertilionis in Sweden. Microorganisms 2021, 9, 1100. [Google Scholar] [CrossRef] [PubMed]
  13. Piksa, K.; Stańczak, J.; Biernat, B.; Górz, A.; Nowak-Chmura, M.; Siuda, K. Detection of Borrelia burgdorferi sensu lato and spotted fever group rickettsiae in hard ticks (Acari, Ixodidae) parasitizing bats in Poland. Parasitol. Res. 2016, 115, 1727–1731. [Google Scholar] [CrossRef] [PubMed]
  14. Cutler, S.J.; Ruzic-Sabljic, E.; Potkonjak, A. Emerging borreliae–Expanding beyond Lyme borreliosis. Mol. Cell. Probes. 2016, 31, 22–27. [Google Scholar] [CrossRef] [PubMed]
  15. Colunga-Salas, P.; Sánchez-Montes, S.; Volkow, P.; Ruíz-Remigio, A.; Becker, I. Lyme disease and relapsing fever in Mexico: An overview of human and wildlife infections. PLoS ONE 2020, 15, e0238496. [Google Scholar] [CrossRef]
  16. Talagrand-Reboul, E.; Boyer, P.H.; Bergström, S.; Vial, L.; Boulanger, N. Relapsing fevers: Neglected tick-borne diseases. Front. Cell. Infect. Microbiol. 2018, 8, 98. [Google Scholar] [CrossRef]
  17. Barbour, A.G.; Schwan, T.G. Borrelia. In Bergey’s Manual of Systematics of Archea and Bacteria; John Wiley & Sons, Inc.: Hoboken, NJ, USA, 2018. [Google Scholar]
  18. Margos, G.; Fingerle, V.; Cutler, S.; Gofton, A.; Stevenson, B.; Estrada-Peña, A. Controversies in bacterial taxonomy: The example of the genus Borrelia. Ticks Tick Borne Dis. 2020, 11, 101335. [Google Scholar] [CrossRef]
  19. Binetruy, F.; Garnier, S.; Boulanger, N.; Talagrand-Reboul, E.; Loire, E.; Faivre, B.; Noël, V.; Buysse, M.; Duron, O. A novel Borrelia species, intermediate between Lyme disease and relapsing fever groups, in neotropical passerine-associated ticks. Sci. Rep. 2020, 10, 10596. [Google Scholar] [CrossRef]
  20. DaMassa, A.J.; Adler, H.E. Avian spirochetosis: Natural transmission by Argas (Persicargas) sanchezi (Ixodoidea: Argasidae) and existence of different serologic and immunologic types of Borrelia anserina in the United States. Am. J. Vet. Res. 1979, 40, 154–157. [Google Scholar]
  21. Ataliba, A.C.; Resende, J.S.; Yoshinari, N.; Labruna, M.B. Isolation and molecular characterization of a Brazilian strain of Borrelia anserina, the agent of fowl spirochaetosis. Res. Vet. Sci. 2007, 83, 145–149. [Google Scholar] [CrossRef]
  22. Muñoz-Leal, S.; Marcili, A.; Fuentes-Castillo, D.; Ayala, M.; Labruna, M.B. A relapsing fever Borrelia and spotted fever Rickettsia in ticks from an Andean valley, central Chile. Exp. Appl. Acarol. 2019, 78, 403–420. [Google Scholar] [CrossRef] [PubMed]
  23. Khan, M.; Islam, N.; Khan, A.; Islam, Z.U.; Muñoz-Leal, S.; Labruna, M.B.; Ali, A. New records of Amblyomma gervaisi from Pakistan, with detection of a reptile-associated Borrelia sp. Ticks Tick Borne Dis. 2022, 13, 102047. [Google Scholar] [CrossRef] [PubMed]
  24. Elbir, H.; Sitlani, P.; Bergström, S.; Barbour, A.G. Chromosome and megaplasmid sequences of Borrelia anserina (Sakharoff 1891), the agent of avian spirochetosis and type species of the genus. Genome Announc. 2017, 5, e00018-17. [Google Scholar] [CrossRef] [PubMed]
  25. Karim, S.; Budachetri, K.; Mukherjee, N.; Williams, J.; Kausar, A.; Hassan, M.J.; Adamson, S.; Dowd, S.E.; Apanskevich, D.; Arijo, A.; et al. A study of ticks and tick-borne livestock pathogens in Pakistan. PLoS Negl. Trop. Dis. 2017, 11, e0005681. [Google Scholar] [CrossRef] [PubMed]
  26. Hoogstraal, H.; Varma, M.G.R. Haemaphysalis cornupunctata sp. n. and H. kashmirensis sp. n. from Kashmir, with Notes on H. sundrai Sharif and H. sewelli Sharif of India and Pakistan (Ixodoidea, Ixodidae). J. Parasitol. 1962, 48, 185–194. [Google Scholar] [CrossRef]
  27. Hoogstraal, H. Ticks and spirochetes. Acta Trop. 1979, 36, 133–136. [Google Scholar]
  28. Ullah, H.; Kontschán, J.; Takács, N.; Wijnveld, M.; Schötta, A.M.; Boldogh, S.A.; Sándor, A.D.; Szekeres, S.; Görföl, T.; Rasheed, S.B.; et al. A new Rickettsia honei related genotype, two novel soft tick haplotypes and first records of three mite species associated with bats in Pakistan. Syst. Appl. Acarol. 2019, 24, 2106–2118. [Google Scholar]
  29. Ali, A.; Zahid, H.; Zeb, I.; Tufail, M.; Khan, S.; Haroon, M.; Bilal, M.; Hussain, M.; Alouffi, A.S.; Muñoz-Leal, S. Risk factors associated with tick infestations on equids in Khyber Pakhtunkhwa, Pakistan, with notes on Rickettsia massiliae detection. Parasit. Vectors 2021, 14, 363. [Google Scholar] [CrossRef]
  30. Ali, A.; Shehla, S.; Zahid, H.; Ullah, F.; Zeb, I.; Ahmed, H.; Vaz Jr, I.; Tanaka, T. Molecular survey and spatial distribution of Rickettsia spp. in ticks infesting free-ranging wild animals in Pakistan (2017–2021). Pathogens 2022, 11, 162. [Google Scholar] [CrossRef]
  31. Ali, A.; Numan, M.; Khan, M.; Aiman, O.; Muñoz-Leal, S.; Chitimia-Dobler, L.; Labruna, M.B.; Nijhof, A.M. Ornithodoros (Pavlovskyella) ticks associated with a Rickettsia sp. in Pakistan. Parasit. Vectors 2022, 15, 138. [Google Scholar] [CrossRef]
  32. Alam, S.; Khan, M.; Alouffi, A.; Almutairi, M.M.; Ullah, S.; Numan, M.; Islam, N.; Khan, Z.; Aiman, O.; Zaman Safi, S.; et al. Spatio-Temporal Patterns of Ticks and Molecular Survey of Anaplasma marginale, with Notes on Their Phylogeny. Microorganisms 2022, 10, 1663. [Google Scholar] [CrossRef] [PubMed]
  33. Ullah, K.; Numan, M.; Alouffi, A.; Almutairi, M.M.; Zahid, H.; Khan, M.; Islam, Z.U.; Kamil, A.; Safi, S.Z.; Ahmed, H.; et al. Molecular Characterization and Assessment of Risk Factors Associated with Theileria annulata Infection. Microorganisms 2022, 10, 1614. [Google Scholar] [CrossRef] [PubMed]
  34. Kohls, G.M.; Hoogstraal, H.; Clifford, C.M.; Kaiser, M.N. The subgenus Persicargas (Ixodoidea, Argasidae, Argas). 9. Redescription new world records of Argas (P.) persicus (Oken), resurrection, redescription, records of A. (P.) radiatus railliet A. (P.) sanchezi Dugès, A. (P.) miniatus Koch, New World ticks misidentified as A. (P.) persicus. Ann. Entomol. Soc. Am. 1970, 63, 590–606. [Google Scholar]
  35. Hoogstraal, H. African Ixodoidea; US Government Printing Office: Washington, DC, USA, 1956; Volume 1. [Google Scholar]
  36. Sambrook, J.; Fritsch, E.F.; Maniatis, T. Molecular Cloning: A Laboratory Manual, 2nd ed.; Cold Spring Harbor Laboratory Press: New York, NY, USA, 1989. [Google Scholar]
  37. Stromdahl, E.Y.; Williamson, P.C.; Kollars, T.M.J.; Evans, S.R.; Barry, R.K.; Vince, M.A.; Dobbs, N.A. Evidence of Borrelia lonestari DNA in Amblyomma americanum (Acari: Ixodidae) removed from humans. J. Clin. Microbiol. 2003, 41, 5557–5562. [Google Scholar] [CrossRef] [PubMed]
  38. Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar]
  39. Labruna, M.B.; Whitworth, T.; Horta, M.C.; Bouyer, D.H.; McBride, J.W.; Pinter, A.; Popov, V.; Gennari, S.M.; Walker, D.H. Rickettsia species infecting Amblyomma cooperi ticks from an area in the state of Sao Paulo, Brazil, where Brazilian spotted fever is endemic. J. Clin. Microbiol. 2004, 42, 90–98. [Google Scholar] [CrossRef]
  40. Inokuma, H.; Raoult, D.; Brouqui, P. Detection of Ehrlichia platys DNA in brown dog ticks (Rhipicephalus sanguineus) in Okinawa Island, Japan. J. Clin. Microbiol. 2000, 38, 4219–4221. [Google Scholar] [CrossRef]
  41. Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
  42. Thompson, J.D.; Higgins, D.G.; Gibson, T.J. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22, 4673–4680. [Google Scholar] [CrossRef]
  43. Hall, T.; Biosciences, I.; Carlsbad, C. BioEdit: An important software for molecular biology. GERF Bull. Biosci. 2011, 2, 60–61. [Google Scholar]
  44. Edgar, R.C. MUSCLE: A multiple sequence alignment method with reduced time and space complexity. BMC Bioinform. 2004, 5, 113. [Google Scholar] [CrossRef]
  45. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
  46. Ali, A.; Khan, M.A.; Zahid, H.; Yaseen, P.M.; Qayash Khan, M.; Nawab, J.; Ur Rehman, Z.; Ateeq, M.; Khan, S.; Ibrahim, M. Seasonal dynamics, record of ticks infesting humans, wild and domestic animals and molecular phylogeny of Rhipicephalus microplus in Khyber Pakhtunkhwa Pakistan. Front. Physiol. 2019, 10, 793. [Google Scholar] [CrossRef]
  47. MacDonald, A.J. Abiotic and habitat drivers of tick vector abundance, diversity, phenology and human encounter risk in southern California. PLoS ONE 2018, 13, e0201665. [Google Scholar] [CrossRef]
  48. Ahmad, I.; Ullah, S.; Alouffi, A.; Almutairi, M.M.; Khan, M.; Numan, M.; Safi, S.Z.; Chitimia-Dobler, L.; Tanaka, T.; Ali, A. Description of Male, Redescription of Female, Host Record, and Phylogenetic Position of Haemaphysalis danieli. Pathogens 2022, 11, 1495. [Google Scholar] [CrossRef]
  49. Gilbert, L.; Aungier, J.; Tomkins, J.L. Climate of origin affects tick (Ixodes ricinus) host-seeking behavior in response to temperature: Implications for resilience to climate change? Ecol. Evol. 2014, 4, 1186–1198. [Google Scholar] [CrossRef]
  50. Numan, M.; Islam, N.; Adnan, M.; Zaman Safi, S.; Chitimia-Dobler, L.; Labruna, M.B.; Ali, A. First genetic report of Ixodes kashmiricus and associated Rickettsia sp. Parasit. Vectors 2022, 15, 378. [Google Scholar] [CrossRef]
  51. Dantas-Torres, F. Climate change, biodiversity, ticks tick-borne diseases: The butterfly effect. Int. J. Parasitol. Parasites Wildl. 2015, 4, 452–461. [Google Scholar] [CrossRef]
  52. Estrada-Peña, A.; Mihalca, A.D.; Petney, T.N. Ticks of Europe and North Africa: A Guide to Species Identification; Springer: Cham, Switzerland, 2018; Volume 404. [Google Scholar]
  53. Black, W.C.; Piesman, J. Phylogeny of hard-and soft-tick taxa (Acari: Ixodida) based on mitochondrial 16S rDNA sequences. Proc. Natl. Acad. Sci. USA 1994, 91, 10034. [Google Scholar] [CrossRef]
  54. Mans, B.J.; Kelava, S.; Pienaar, R.; Featherston, J.; de Castro, M.H.; Quetglas, J.; Reeves, W.K.; Durden, L.A.; Miller, M.M.; Laverty, T.M.; et al. Nuclear (18S-28S rRNA) and mitochondrial genome markers of Carios (Carios) vespertilionis (Argasidae) support Carios Latreille, 1796 as a lineage embedded in the Ornithodorinae: Re-classification of the Carios sensu Klompen and Oliver (1993) clade into its respective subgenera. Ticks Tick-Borne Dis. 2021, 12, 101688. [Google Scholar]
  55. Barbour, A.G. Chapter 16. Relapsing fever. In Tick-Borne Diseases of Humans; Goodman, J.L., Dennis, D.T., Sonenshine, D.E., Eds.; ASM Press: Washington, DC, USA, 2005; pp. 268–291. [Google Scholar]
  56. Parola, P.; Ryelandt, J.; Mangold, A.J.; Mediannikov, O.; Guglielmone, A.A.; Raoult, D. Relapsing fever Borrelia in Ornithodoros ticks from Bolivia. Ann. Trop. Med. Parasitol. 2011, 105, 407–411. [Google Scholar] [CrossRef] [PubMed]
  57. Bermúdez, S.; Domínguez, L.; Troyo, A.; Venzal, J.M. Ticks infesting humans in Central America: A review of their relevance in public health. Curr. Res. Parasitol. Vector-Borne Dis. 2022, 2, 100065. [Google Scholar] [CrossRef]
  58. Rocha, S.C.; Velásquez, C.V.; Aquib, A.; Al-Nazal, A.; Parveen, N. Transmission Cycle of Tick-Borne Infections and Co-Infections, Animal Models and Diseases. Pathogens 2022, 11, 1309. [Google Scholar] [CrossRef] [PubMed]
  59. Socha, W.; Kwasnik, M.; Larska, M.; Rola, J.; Rozek, W. Vector-borne viral diseases as a current threat for human and animal health—One Health perspective. J. Clin. Med. 2022, 11, 3026. [Google Scholar] [CrossRef] [PubMed]
  60. Barbieri, A.M.; Venzal, J.M.; Marcili, A.; Almeida, A.P.; González, E.M.; Labruna, M.B. Borrelia burgdorferi sensu lato infecting ticks of the Ixodes ricinus complex in Uruguay: First report for the Southern Hemisphere. Vector Borne Zoonotic Dis. 2013, 13, 147–153. [Google Scholar] [CrossRef]
  61. Nava, S.; Barbieri, A.M.; Maya, L.; Colina, R.; Mangold, A.J.; Labruna, M.B.; Venzal, J.M. Borrelia infection in Ixodes pararicinus ticks (Acari: Ixodidae) from northwestern Argentina. Acta Trop. 2014, 139, 1–4. [Google Scholar] [CrossRef]
  62. Sebastian, P.S.; Bottero, M.N.S.; Carvalho, L.; Mackenstedt, U.; Lareschi, M.; Venzal, J.M.; Nava, S. Borrelia burgdorferi sensu lato in Ixodes cfneuquenensis and Ixodes sigelos ticks from the Patagonian region of Argentina. Acta Trop. 2016, 162, 218–221. [Google Scholar]
  63. Muñoz-Leal, S.; Faccini-Martínez, Á.A.; Costa, F.B.; Marcili, A.; Mesquita, E.T.K.C.; Marques, E.P.; Labruna, M.B. Isolation and molecular characterization of a relapsing fever Borrelia recovered from Ornithodoros rudis in Brazil. Ticks Tick-Borne Dis. 2018, 9, 864–871. [Google Scholar] [CrossRef]
  64. Muñoz-Leal, S.; Faccini-Martínez, Á.A.; Teixeira, B.M.; Martins, M.M.; Serpa, M.C.A.; Oliveira, G.M.; Jorge, F.R.; Pacheco, R.C.; Costa, F.B.; Luz, H.R.; et al. Relapsing fever group borreliae in human-biting soft ticks, Brazil. Emerg. Infect. Dis. 2021, 27, 321. [Google Scholar] [CrossRef]
  65. Kaiser, A.; Seitz, A.; Strub, O. Prevalence of Borrelia burgdorferi sensu lato in the nightingale (Luscinia megarhynchos) and other passerine birds. Int. J. Med. Microbiol. 2002, 291, 75–79. [Google Scholar] [CrossRef]
Vetsci 10 00628 g001
Figure 1. Map showing the collection sites of ticks in Khyber Pakhtunkhwa Pakistan.
Figure 1. Map showing the collection sites of ticks in Khyber Pakhtunkhwa Pakistan.
Vetsci 10 00628 g001
Vetsci 10 00628 g002
Figure 2. Maximum likelihood phylogenetic tree based on cox sequences of Argas persicus and Carios vespertilionis. Alveonasus lahorensis was taken as an outgroup. GenBank accession numbers are followed by species (italic) and country names. The obtained A. persicus and C. vespertilionis sequences are represented in bold and underlined.
Figure 2. Maximum likelihood phylogenetic tree based on cox sequences of Argas persicus and Carios vespertilionis. Alveonasus lahorensis was taken as an outgroup. GenBank accession numbers are followed by species (italic) and country names. The obtained A. persicus and C. vespertilionis sequences are represented in bold and underlined.
Vetsci 10 00628 g002
Vetsci 10 00628 g003
Figure 3. Maximum likelihood phylogenetic tree based on flaB sequence of Borrelia anserina. Borrelia turcica and “Candidatus Borrelia tachyglossi” were taken as outgroups. GenBank accession numbers are followed by species (italic) and country names (in the case of B. anserina). The obtained B. anserina sequence are represented in bold and underlined.
Figure 3. Maximum likelihood phylogenetic tree based on flaB sequence of Borrelia anserina. Borrelia turcica and “Candidatus Borrelia tachyglossi” were taken as outgroups. GenBank accession numbers are followed by species (italic) and country names (in the case of B. anserina). The obtained B. anserina sequence are represented in bold and underlined.
Vetsci 10 00628 g003
Table 1. List of primers used for the amplification of ticks and their associated pathogens.
Table 1. List of primers used for the amplification of ticks and their associated pathogens.
S#OrganismGenePrimers Sequence (5′-3′)Amplicons Size Reference
1TickcoxHC02198: TAAACTTCAGGGTGACCAAAAAATCA
LCO1490: GGTCAACAAATCATAAAGATATTG G		710 bp [38]
2Tick16STTTGGGACAAGAAGACCCTATGAATTT
ACATCGAGGTCGCAATCAATTTTATC		250 bp[2]
3BorreliaFla LL
Fla RL
Fla SS
Fla RS		ACATATTCAGATGCAGACAGAGGT
GCAATCATAGCCATTGCAGATTGT
AACAGCTGAAGAGCTTGGAATG
CTTTGATCACTTATCATTCTAATAGC		665 bp
354 bp		[37]
4RickettsiagltACS-78: GCAAGTATCGGTGAGGATGTAAT
CS-323: GCTTCCTTAAAATTCAATAAATCAGAT		401 bp[39]
5Ehrlichia16SEHR16SD: GGTACCYACAGAAGAAGTCC
EHR16SR: TGCACTCATCGTTTACAG		344 bp[40]
Table 2. Borrelia anserina detected in different life stages of the Argas persicus collected in nine districts, KP, Pakistan.
Table 2. Borrelia anserina detected in different life stages of the Argas persicus collected in nine districts, KP, Pakistan.
DistrictsTick SpeciesHost Observed/Infested (%)No. of Collected Ticks F, M, N, L (n; %)Detection of Borrelia anserina
F, M, N, L		Total (%)
PeshawarArgas persicusShelters25/12 (48)45, 40, 29, 17 (131; 7.2)2, 1, 1, 04 (10)
Domestic fowls167/99 (59)9, 7, 23, 31 (70; 3.9)1, 0, 0, 12 (5)
Carios vespertilionisBats5/1 (40)1, 2, 8, 80 (91; 5.0)00
MardanA. persicusShelters23/11 (47.82)47, 44, 41, 15 (147; 8)1, 0, 1, 02 (5)
Domestic fowls145/89 (61)7, 6, 17, 22 (52; 3)1, 0, 1, 13 (7.5)
C. vespertilionisBats6/1 (50)2, 3, 6, 87 (98; 5.4)00
SwabiA. persicusShelters21/10 (47.61)40, 33, 39, 12 (124; 6.8)1, 0, 1, 02 (5)
Domestic fowls134/99 (74)6, 5, 5, 33 (49; 2.7)1, 0, 0, 01 (2.5)
C. vespertilionisBats5/1 (40)0, 0, 3, 58 (61; 3.3)00
CharsaddaA. persicusShelters20/12 (55)51, 45, 53, 13 (162; 9)1, 0, 1, 02 (5)
Domestic fowls116/91 (78)4, 3, 14, 11 (32; 1.8)0, 0, 0, 11 (2.5)
C. vespertilionisBats7/2 (43)4, 3, 12, 70 (89; 5)00
ChitralA. persicusShelters21/5 (23.80)11, 9, 21, 3 (44; 2.4)1, 0, 0, 12 (5)
Domestic fowls142/45 (32)2, 3, 3, 6 (14; 1)1, 1, 1, 03 (7.5)
C. vespertilionisBats0000
A. persicusDucks54/19 (35)12, 16, 13, 0 (41; 2.2)1, 0, 0, 01 (2.5)
Lakki Marwat A. persicusShelters21/7 (33.33)45, 33, 53, 9 (140; 7.7)1, 0, 0, 02 (5)
Domestic fowls112/69 (61)6, 3, 6, 14 (29; 1.6)1, 0, 1, 12 (5)
C. vespertilionisBats0000
BannuA. persicusShelters20/9 (45)42, 32, 45, 11 (130; 7)0, 0, 1, 12 (5)
Domestic fowls121/66 (55)5, 4, 5, 15 (29; 1.6)1, 0, 1, 02 (5)
C. vespertilionisBats0000
BajaurA. persicusShelters18/7 (38.88)35, 24, 31, 3 (93; 5)1, 1, 0, 02 (5)
Domestic fowls103/59 (57)5, 2, 5, 7 (19; 1)1, 0, 1, 13 (7.5)
C. vespertilionisBats0000
HanguA. persicusShelters12/5 (41.66)30, 23, 27, 0 (80; 4.4)1, 0, 0, 12 (5)
Domestic fowls111/46 (41)4, 3, 7, 4 (18; 1)1, 0, 1, 02 (5)
C. vespertilionisBats4/2 (5)2, 2, 9, 62 (75; 4)00
TotalA. persicusShelters189/79 (42)358, 293, 347, 83 (1081; 59.4)10, 2, 5, 320 (13.6)
Domestic fowls1205/682 (57)48, 42, 90, 143 (323; 17.8)8, 1, 7, 420 (13.6)
C. vespertilionisBats27/7 (26)9, 10, 38, 357 (414; 22.8)00
Total 415, 345, 475, 583 (1818)18, 3, 12, 740
F: female, M: male, N: nymph, L: larvae.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zahid, H.; Alouffi, A.; Almutairi, M.M.; Ateeq, M.; Tanaka, T.; Chang, S.-C.; Chen, C.-C.; Ali, A. Argas persicus and Carios vespertilionis Ticks Infesting Ducks, Domestic Fowls and Bats in Pakistan: First Report on Molecular Survey and Phylogenetic Position of Borrelia anserina. Vet. Sci. 2023, 10, 628. https://doi.org/10.3390/vetsci10100628

AMA Style

Zahid H, Alouffi A, Almutairi MM, Ateeq M, Tanaka T, Chang S-C, Chen C-C, Ali A. Argas persicus and Carios vespertilionis Ticks Infesting Ducks, Domestic Fowls and Bats in Pakistan: First Report on Molecular Survey and Phylogenetic Position of Borrelia anserina. Veterinary Sciences. 2023; 10(10):628. https://doi.org/10.3390/vetsci10100628

Chicago/Turabian Style

Zahid, Hafsa, Abdulaziz Alouffi, Mashal M. Almutairi, Muhammad Ateeq, Tetsuya Tanaka, Shun-Chung Chang, Chien-Chin Chen, and Abid Ali. 2023. "Argas persicus and Carios vespertilionis Ticks Infesting Ducks, Domestic Fowls and Bats in Pakistan: First Report on Molecular Survey and Phylogenetic Position of Borrelia anserina" Veterinary Sciences 10, no. 10: 628. https://doi.org/10.3390/vetsci10100628

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop