The Brettanomyces bruxellensis Contamination of Wines: A Case Study of Moldovan Micro-Winery
Abstract
1. Introduction
2. Materials and Methods
2.1. Collection of Samples
2.2. Wine Production
2.3. Primer Design for Brettanomyces Detection
2.4. Isolation of Brettanomyces from Wine Samples and Wine Inoculation
2.5. Isolation of DNA
2.6. Quantification of Brettanomyces
2.7. Sequencing and Sequence Analysis
2.8. Statistical Analysis
3. Results and Discussion
3.1. Primer Testing and Validation
3.2. Efficiency of DNA Extraction from Wine and Must
3.3. Wine Monitoring for B. bruxellensis Infection and Quantification
3.4. Genetic Sequencing
4. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Cantafio, G.; Luana Parisi, L. Micro-Wineries as drivers for local economic development and innovation in lagging areas. Wine Econ. Policy 2021, 10, 23–32. [Google Scholar] [CrossRef]
- Wine Sector in the Republic of Moldova. WINET BSB-638 Project: Trade and Innovation in Wine Industry. Available online: https://blacksea-cbc.net/wp-content/uploads/2020/02/BSB638_WINET_Study-on-the-wine-sector-in-the-Republic-of-Moldova_EN.pdf (accessed on 10 September 2024).
- Vine and Wine Law No. 57-XVI from 10 March 2006. Available online: https://wineofmoldova.com/en/wine-industry-legislation/ (accessed on 10 September 2024). (In Romanian).
- Wedral, D.; Robert Shewfelt, R.; Frank, J. The challenge of Brettanomyces in wine. LWT Food Sci. Technol. 2010, 43, 1474–1479. [Google Scholar] [CrossRef]
- Di Toro, M.R.; Capozzi, V.; Beneduce, L.; Alexandre, H.; Tristezza, M.; Durante, M.; Tufariello, M.; Grieco, F.; Spano, G. Intraspecific biodiversity and ‘spoilage potential’ of Brettanomyces bruxellensis in Apulian wines. LWT Food Sci. Technol 2015, 60, 102–108. [Google Scholar] [CrossRef]
- Agnolucci, M.; Tirelli, A.; Cocolin, L.; Toffanin, A. Brettanomyces bruxellensis yeasts: Impact on wine and winemaking. World J. Microbiol. Biotechnol. 2017, 33, 180. [Google Scholar] [CrossRef]
- Cocolin, L.; Rantsiou, K.; Iacumin, L.; Zironi, R.; Comi, G. Molecular detection and identification of Brettanomyces/Dekkera bruxellensis and Brettanomyces/Dekkera anomalus in spoiled wines. Appl. Environ. Microbiol. 2004, 70, 1347–1355. [Google Scholar] [CrossRef] [PubMed]
- Agnolucci, M.; Vigentini, I.; Capurso, G.; Merico, A.; Tirelli, A.; Compagno, C.; Foschino, R.; Nuti, M. Genetic diversity and physiological traits of Brettanomyces bruxellensis strains isolated from Tuscan Sangiovese wines. Int. J. Food Microbiol. 2009, 130, 238–244. [Google Scholar] [CrossRef] [PubMed]
- Steensels, J.; Daenen, L.; Malcorps, P.; Derdelinckx, G.; Verachtert, H.; Verstrepen, K.J. Brettanomyces yeasts—From spoilage organisms to valuable contributors to industrial fermentations. Int. J. Food Microbiol. 2015, 206, 24–38. [Google Scholar] [CrossRef]
- Capozzi, V.; Di Toro, M.R.; Grieco, F.; Michelotti, V.; Salma, M.; Lamontanara, A.; Russo, P.; Orrù, L.; Alexandre, H.; Spano, G. Viable But Not Culturable (VBNC) state of Brettanomyces bruxellensis in wine: New insights on molecular basis of VBNC behaviour using a transcriptomic approach. Food Microbiol. 2016, 59, 196–204. [Google Scholar] [CrossRef] [PubMed]
- Joseph, C.M.L.; Kumar, G.; Su, E.; Bisson, L.F. Adhesion and Biofilm Production by Wine Isolates of Brettanomyces bruxellensis. Am. J. Enol. Vitic. 2007, 58, 373–378. [Google Scholar] [CrossRef]
- Dimopoulou, M.; Renault, M.; Dols-Lafargue, M.; Albertin, W.; Herry, J.M.; Bellon-Fontaine, M.N.; Masneuf-Pomarede, I. Microbiological, biochemical, physicochemical surface properties and biofilm forming ability of Brettanomyces bruxellensis. Ann. Microbiol. 2019, 69, 1217–1225. [Google Scholar] [CrossRef]
- Curtin, C.D.; Varela, C.; Borneman, A. Harnessing improved understanding of Brettanomyces bruxellensis biology to mitigate the risk of wine spoilage. Aust. J. Grape Wine Res. 2015, 21, 680–692. [Google Scholar] [CrossRef]
- Longin, C.; Julliat, F.; Serpaggi, V.; Maupeu, J.; Bourbon, J.; Rousseaux, S.; Guilloux-Benatier, M.; Alexandre, H. Evaluation of three Brettanomyces qPCR commercial kits: Results from an interlaboratory study. OENO One 2016, 50, 4. [Google Scholar] [CrossRef]
- Pinto, L.; Baruzzi, F.; Cocolin, L.; Malfeito-Ferreira, M. Emerging technologies to control Brettanomyces spp. in wine: Recent advances and future trends. Trends Food Sci. Technol. 2020, 99, 88–100. [Google Scholar] [CrossRef]
- Šućur, S.; Čadež, N.; Košmerl, T. Volatile phenols in wine: Control measures of Brettanomyces/Dekkera yeasts. Acta Agric. Slov. 2016, 107, 453–472. [Google Scholar] [CrossRef]
- Malfeito-Ferreira, M. Two Decades of “Horse Sweat” Taint and Brettanomyces Yeasts in Wine: Where do We Stand Now? Beverages 2018, 4, 32. [Google Scholar] [CrossRef]
- Renouf, V.; Lonvaud-Funel, A.; Coulon, J. The origin of Brettanomyces bruxellensis in wines: A review. OENO One 2007, 41, 161–173. [Google Scholar] [CrossRef]
- Tubia, I.; Prasad, K.; Pérez-Lorenzo, E.; Abadín, C.; Zumárraga, M.; Oyanguren, I.; Barbero, F.; Paredes, J.; Arana, S. Beverage spoilage yeast detection methods and control technologies: A review of Brettanomyces. Int. J. Food Microbiol. 2018, 283, 65–76. [Google Scholar] [CrossRef]
- Alston, J.M.; Arvik, T.; Hart, J.; Lapsley, J.T. Brettanomics I: The Cost of Brettanomyces in California Wine Production. J. Wine Econ. 2021, 16, 4–31. [Google Scholar] [CrossRef]
- Romano, A.; Perello, M.C.; de Revel, G.; Lonvaud-Funel, A. Growth and volatile compound production by Brettanomyces/Dekkera bruxellensis in red wine. J. Appl. Microbiol. 2008, 104, 1577–1585. [Google Scholar] [CrossRef]
- Romano, A.; Perello, M.C.; Lonvaud-Funel, A.; Sicard, G.; de Revel, G. Sensory and analytical re-evaluation of “Brett character”. Food Chem. 2009, 114, 15–19. [Google Scholar] [CrossRef]
- Chatonnet, P.; Dubourdieu, D.; Boidron, J.-N.; Pons, M. The origin of ethylphenols in wines. J. Sci. Food Agric. 1992, 60, 165–178. [Google Scholar] [CrossRef]
- Milheiro, J.; Filipe-Ribeiro, L.; Vilela, A.; Cosme, F.; Nunes, F.M. 4-Ethylphenol, 4-ethylguaiacol and 4-ethylcatechol in red wines: Microbial formation, prevention, remediation and overview of analytical approaches. Crit. Rev. Food Sci. Nutr. 2019, 59, 1367–1391. [Google Scholar] [CrossRef]
- Lopez, R.; Wen, Y.; Ferreira, V. The remarkable effects of the non-volatile matrix of wine on the release of volatile compounds evaluated by analysing their release to the headspaces. OENO One 2024, 58, 1–14. [Google Scholar] [CrossRef]
- Chatonnet, P.; Masneuf, I.; Gubbiotti, M.C.; Dubourdieu, D. Prévention et détection des contaminations par Brettanomyces au cours de la vinification et de l’élevage des vins. Rev. Fr. Oenol. 1999, 179, 20–24. [Google Scholar]
- Renouf, V.; Lonvaud-Funel, A. Development of an enrichment medium to detect Dekkera/Brettanomyces bruxellensis, a spoilage wine yeast, on the surface of grape berries. Microbiol. Res. 2007, 162, 154–167. [Google Scholar] [CrossRef] [PubMed]
- Boulton, R.B.; Singleton, V.L.; Bisson, L.F.; Kunkee, R.E. Principles and Practices of Winemaking; Springer Science & Business Media: Berlin/Heidelberg, Germany, 2013. [Google Scholar]
- Albertin, W.; Panfili, A.; Miot-Sertier, C.; Goulielmakis, A.; Delcamp, A.; Salin, F.; Lonvaud-Funel, A.; Curtin, C.; Masneuf-Pomarede, I. Development of microsatellite markers for the rapid and reliable genotyping of Brettanomyces bruxellensis at strain level. Food Microbiol. 2014, 42, 188–195. [Google Scholar] [CrossRef] [PubMed]
- Oro, L.; Canonico, L.; Marinelli, V.; Ciani, M.; Comitini, F. Occurrence of Brettanomyces bruxellensis on Grape Berries and in Related Winemaking Cellar. Front. Microbiol. 2019, 10, 415. [Google Scholar] [CrossRef]
- Cibrario, A.; Avramova, M.; Dimopoulou, M.; Magani, M.; Miot-Sertier, C.; Mas, A. Brettanomyces bruxellensis wine isolates show high geographical dispersal and long per-sistence in cellars. PLoS ONE 2019, 14, 12. [Google Scholar] [CrossRef] [PubMed]
- Cartwright, Z.M.; Bondada, B.R.; Edwards, C.G. Survival of Brettanomyces bruxellensis in grape pomace and reduction of populations by application of heat and sulfites. Aust. J. Grape Wine Res. 2019, 25, 109–115. [Google Scholar] [CrossRef]
- Cordingley, B. Ask the AWRI: Techniques to detect Brettanomyces before it’s too late. Aust. N. Z. Grapegrow. Winemak. 2022, 702, 70–71. [Google Scholar] [CrossRef]
- Hayashi, N.; Arai, R.; Tada, S.; Taguchi, H.; Ogawa, Y. Detection and identification of Brettanomyces/Dekkera sp. yeasts with a loop-mediated isothermal amplification method. Food Microbiol. 2007, 24, 778–785. [Google Scholar] [CrossRef] [PubMed]
- Röder, C.; König, H.; Fröhlich, J. Species-specific identification of Dekkera/Brettanomyces yeasts by fluorescently labeled DNA probes targeting the 26S rRNA. FEMS Yeast Res. 2007, 7, 1013–1026. [Google Scholar] [CrossRef]
- Delaherche, A.; Claisse, O.; Lonvaud-Funel, A. Detection and quantification of Brettanomyces bruxellensis and “ropy”Pediococcus damnosus strains in wine by real-time polymerase chain reaction. J. Appl. Microbiol. 2004, 97, 910–915. [Google Scholar] [CrossRef] [PubMed]
- Oelofse, A.; Lonvaud-Funel, A.; du Toit, M. Molecular identification of Brettanomyces bruxellensis strains isolated from red wines and volatile phenol production. Food Microbiol. 2009, 26, 377–385. [Google Scholar] [CrossRef] [PubMed]
- Agnolucci, M.; Scarano, S.; Rea, F.; Toffanin, A.; Nuti, M. Detection of Dekkera/Brettanomyces bruxellensis in pressed Sangiovese grapes by real time PCR. Ital. J. Food Sci. 2007, 19, 153–164. [Google Scholar]
- Mitrakul, C.M.; Henick-Kling, T.; Egli, C.M. Discrimination of Brettanomyces/Dekkera yeast isolates from wine by using various DNA finger-printing methods. Food Microbiol. 1999, 16, 3–14. [Google Scholar] [CrossRef]
- Martorell, P.; Barata, A.; Malfeito-Ferreira, M.; Fernández-Espinar, M.T.; Loureiro, V.; Querol, A. Molecular typing of the yeast species Dekkera bruxellensis and Pichia guilliermondii recovered from wine related sources. Int. J. Food Microbiol. 2006, 106, 79–84. [Google Scholar] [CrossRef]
- Miot-Sertier, C.; Lonvaud-Funel, A. Development of a molecular method for the typing of Brettanomyces bruxellensis (Dekkera bruxellensis) at the strain level. J. Appl. Microbiol. 2007, 102, 555–562. [Google Scholar] [CrossRef]
- Curtin, C.D.; Bellon, J.; Henschke, P.; Godden, P.; de Barros Lopes, M. Genetic diversity of Dekkera bruxellensis yeasts isolated from Australian wineries. FEMS Yeast Res. 2007, 7, 471–481. [Google Scholar] [CrossRef] [PubMed]
- Baselga, I.; Zafra, O.; Pérez Lago, E.; Francisco-Álvarez, R.; Rodriguez-Tarduchy, G.; Santos, C. An AFLP based method for the detection and identification of indigenous yeast in complex must samples without a microbiological culture. Int. J. Food. Microbiol. 2017, 241, 89–97. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Esteve-Zarzoso, B.; Hierro, N.; Mas, A.; Guillamon, J. A new simplified AFLP method for wine yeast strain typing. LWT Food Sci. Technol. 2010, 43, 1480–1484. [Google Scholar] [CrossRef]
- Varela, C.; Borneman, A.R. Molecular approaches improving our understanding of Brettanomyces physiology. FEMS Yeast Res. 2022, 22, foac028. [Google Scholar] [CrossRef] [PubMed]
- Benito-Vazquez, I.; Belda, I.; Ruiz, J.; Vicente, J.; Navascués, E.; Marquina, D.; Santos, A. Direct detection of Brettanomyces bruxellensis in wine by PCR targeting the vinylphenol reductase gene. LWT Food Sci. Technol. 2021, 136, 2021. [Google Scholar] [CrossRef]
- Jackson, R.S. Wine Science, 2nd ed.; Academic Press: San Diego, CA, USA, 2000; p. 648. [Google Scholar]
- Density and Specific Gravity at 20 °C Method OIV-MA-AS2-01B: R2009. Compendium of International Methods of Analysis—OIV. Available online: https://www.oiv.int/public/medias/2468/oiv-ma-as2-01b.pdf (accessed on 10 September 2024).
- Reducing Substances. Method OIV-MA-AS311-01A: R2009. Compendium of International Methods of Analysis—OIV. Available online: https://www.oiv.int/public/medias/2481/oiv-ma-as311-01a.pdf (accessed on 10 September 2024).
- pH Method OIV-MA-AS313-15: R2011. Compendium of International Methods of Analysis—OIV. Available online: https://www.oiv.int/public/medias/2514/oiv-ma-as313-15.pdf (accessed on 10 September 2024).
- Total Acidity. Method OIV-MA-AS313-01: R2015. Compendium of International Methods of Analysis—OIV. Available online: https://www.oiv.int/public/medias/3731/oiv-ma-as313-01.pdf (accessed on 10 September 2024).
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef] [PubMed]
- de Souza, A.C.; Simões, L.A.; Schwan, R.F.; Dias, D.R. Enumerating Yeast in Foods and Water Using the Spread Plating Technique. In Detection and Enumeration of Bacteria, Yeast, Viruses, and Protozoan in Foods and Freshwater. Methods and Protocols in Food Science; Magnani, M., Ed.; Humana: New York, NY, USA, 2021; pp. 93–110. [Google Scholar] [CrossRef]
- Zgardan, D.; Mitina, I.; Mitin, V.; Behta, E.; Rubtov, S.; Boistean, A.; Sturza, R.; Munteanu, M. Acetic acid bacteria detection in wines by Real-Time PCR. Sci. Study Res. Chem. Eng. Biotechnol. Food Ind. 2022, 23, 179–188. Available online: https://pubs.ub.ro/?pg=revues&rev=cscc6&num=202202&vol=2&aid=5430 (accessed on 28 July 2024).
- Nutz, S.; Döll, K.; Karlovsky, P. Determination of the LOQ in Real-Time PCR by Receiver Operating Characteristic Curve Analysis: Application to qPCR Assays for Fusarium verticillioides and Fusarium proliferatum. Anal. Bioanal. Chem. 2011, 401, 717–726. [Google Scholar] [CrossRef] [PubMed]
- ISO 16140-2:2016; Microbiology of Food and Animal Feeding Stuffs—Protocol for the Validation of Alternative Methods. ISO (International Organization for Standardization): Geneva, Switzerland, 2003. Available online: https://www.iso.org/standard/54870.html (accessed on 20 December 2024).
- Işçi, B.; Yildirim, H.K.; Altindisli, A. Evaluation of methods for DNA extraction from must and wine. J. Inst. Brew. 2014, 120, 238–243. [Google Scholar] [CrossRef]
- Berbegal, C.; Spano, G.; Fragasso, M.; Grieco, F.; Russo, P.; Capozzi, V. Starter cultures as biocontrol strategy to prevent Brettanomyces bruxellensis proliferation in wine. Appl. Microbiol. Biotechnol. 2018, 102, 569–576. [Google Scholar] [CrossRef]
- Le Montagner, P.; Etourneau, L.; Ballestra, P.; Dols-Lafargue, M.; Albertin, W.; Maupeu, J.; Moine, V.; Renouf, V.; Masneuf-Pomarède, I. Critical areas for Brettanomyces bruxellensis contamination and biofilm formation in the cellar: On the origin of wine spoilage. OENO One 2024, 58, 3. [Google Scholar] [CrossRef]
- Mehlomakulu, N.N.; Setati, M.E.; Divol, B. Non-Saccharomyces killer toxins: Possible biocontrol agents against Brettanomyces in wine? S. Afr. J. Enol. Vitic. 2015, 36, 94–104. [Google Scholar] [CrossRef]
- Harrouard, J.; Eberlein, C.; Ballestra, P.; Dols-Lafargue, M.; Masneuf-Pomarede, I.; Miot-Sertier, C.; Schacherer, J.; Albertin, W. Brettanomyces bruxellensis: Overview of the genetic and phenotypic diversity of an anthropized yeast. Mol. Ecol. 2023, 32, 2374–2395. [Google Scholar] [CrossRef] [PubMed]
- Vigentini, I.; Romano, A.; Compagno, C.; Merico, A.; Molinari, F.; Tirelli, A.; Foschino, R.; Volonterio, G. Physiological and oenological traits of different Dekkera/Brettanomyces bruxellensis strains under wine-model conditions. FEMS Yeast Res. 2008, 8, 1087–1096. [Google Scholar] [CrossRef] [PubMed]
- Garijo, P.; Gutiérrez, A.; Lopez, R.; Santamaría, P.; González-Arenzana, L.; López-Alfaro, I.; Garde-Cerdan, T.; Olarte, C.; Sanz, S. Comparison of Brettanomyces yeast presence in young red wines in two consecutive vintages. Eur. Food Res. Technol. 2017, 243, 5. [Google Scholar] [CrossRef]
- Shinohara, T.; Kubodera, S.; Yanagida, F. Distribution of phenolic yeasts and production of phenolic off-flavors in wine fermentation. J. Biosci. Bioeng. 2000, 90, 90–97. [Google Scholar] [CrossRef]
- Kheir, J.; Dominique, S.; Pierre, S.; Brandam, C.; Lteif, R. Impact of volatile phenols and their precursors on wine quality and control measures of Brettanomyces/Dekkera yeasts. Eur. Food Res. Technol. 2013, 237, 655–671. [Google Scholar] [CrossRef]
- Nucleotide [Internet]. Bethesda (MD): National Library of Medicine (US), National Center for Biotechnology Information; [1988]. PQ219467.1, Brettanomyces bruxellensis Isolate BrettS2 Internal Transcribed Spacer 1, Partial Sequence; 5.8S Ribosomal RNA Gene, Complete Sequence; and Internal Transcribed Spacer 2, Partial Sequence; [cited 26 August 2024]. Available online: https://www.ncbi.nlm.nih.gov/nuccore/PQ219467 (accessed on 10 September 2024).
- Nucleotide [Internet]. Bethesda (MD): National Library of Medicine (US), National Center for Biotechnology Information; [1988]. PQ219468.1, Brettanomyces bruxellensis Isolate BrettS4 Internal Transcribed Spacer 1, Partial Sequence; 5.8S Ribosomal RNA Gene, Complete Sequence; and Internal Transcribed Spacer 2, Partial Sequence; [cited 26 August 2024]. Available online: https://www.ncbi.nlm.nih.gov/nuccore/PQ219468 (accessed on 10 September 2024).
- Nucleotide [Internet]. Bethesda (MD): National Library of Medicine (US), National Center for Biotechnology Information; [1988]. PQ219469.1, Brettanomyces bruxellensis Isolate BrettS10 Internal Transcribed Spacer 1, Partial Sequence; 5.8S Ribosomal RNA Gene, Complete Sequence; and Internal Transcribed Spacer 2, Partial Sequence; [cited 26 August 2024]. Available online: https://www.ncbi.nlm.nih.gov/nuccore/PQ219469 (accessed on 10 September 2024).
- Nucleotide [Internet]. Bethesda (MD): National Library of Medicine (US), National Center for Biotechnology Information; [1988]. PQ219470.1, Brettanomyces bruxellensis Isolate BrettS12 Internal Transcribed Spacer 1, Partial Sequence; 5.8S Ribosomal RNA Gene, Complete Sequence; and Internal Transcribed Spacer 2, Partial Sequence; [cited 26 August 2024]. Available online: https://www.ncbi.nlm.nih.gov/nuccore/PQ219470 (accessed on 10 September 2024).
- Nucleotide [Internet]. Bethesda (MD): National Library of Medicine (US), National Center for Biotechnology Information; [1988]. PQ219471.1, Brettanomyces bruxellensis Isolate BrettS13 Internal Transcribed Spacer 1, Partial Sequence; 5.8S Ribosomal RNA Gene, Complete Sequence; and Internal Transcribed Spacer 2, Partial Sequence; [cited 26 August 2024]. Critical Areas for Brettanomyces bruxellensis Contamination and Biofilm Formation in the Cellar: On the Origin of Wine Spoilage. Available online: https://www.ncbi.nlm.nih.gov/nuccore/PQ219471 (accessed on 10 September 2024).
Nr. | Grape Variety | PGI | Variety Origin |
---|---|---|---|
1 | Feteasca Neagra | Codru | Local Moldavian–Romanian variety |
2 | Feteasca Alba | Codru | Local Moldavian–Romanian variety |
3 | Feteasca Regala | Codru | Local Moldavian–Romanian variety |
4 | Rkatsiteli | Codru | Georgian variety |
5 | Merlot | Codru | International variety |
6 | Feteasca Neagra | Valul lui Traian | Local Moldavian–Romanian variety |
7 | Ametist | Codru | Local Moldavian variety of new selection |
8 | Augustina | Codru | Local Moldavian variety of new selection |
9 | Malena | Codru | Local Moldavian variety of new selection |
10 | Rara Neagra | Stefan Voda | Local Moldavian–Romanian variety |
11 | Cabernet Sauvignon | Codru | International variety |
12 | Alexandrina | Codru | Local Moldavian variety of new selection |
13 | Feteasca Alba/ FeteascaRegala | Codru | Mixed local white Moldavian–Romanian varieties |
14 | Feteasca Neagra/ Rara Neagra | Codru | Mixed local red Moldavian–Romanian varieties |
Technological Process | Oenological Material/ Equipment | Dose | t °C | Time, Days |
---|---|---|---|---|
Crushing and destemming grapes | Roller crusher/destemmer (Zambelli Enotech) | 1 | ||
Sulfitation of grape must | Potassium metabisulfite, K2S2O5 | 150 mg/dm3 | ||
Pressing grape must | Pneumatic press (Zambelli Enotech) | |||
Clarification of must | Bentonite | 0.5–1 g/dm3 | 10–14 °C | 1 |
Fermentation of grape must | Selected yeast EnartisFerm SC/ stainless steel tanks (TM INOX) | 20 g/100 dm3 | 16 °C ± 1 | 8 |
Feteasca Alba | 8 | |||
Feteasca Regala | 8 | |||
Rkatsiteli | 7 | |||
Augustina | 8 | |||
Malena | 8 | |||
Alexandrina | 8 | |||
Post-fermentation and wine formation | 10–12 °C | 30 | ||
Removal of wine from the yeast lees with wine equalization and sulfitation | H2SO3/centrifugal pump (Zambelli Enotech) | 10–20 mg/dm3 | 12 °C | 1 |
Integrated wine treatment | Bentonite | 0.5 g/dm3 | 12 | |
Fish glue | 0.7 g/100 dm3 | |||
H2SO3 | 20 mg/dm3 | |||
Decanting wine from the sediment | Depth filter sheets | 1 | ||
Cold treatment | −3–5 °C | 5–7 | ||
Wine filtering | Cartridge membrane filter with pore size 0.65 µm (HOBRAFILT S20 N) | −3–5 °C | 1 | |
Wine resting and storage | 10–12 °C | 10 | ||
Sulfitation | H2SO3 | 30 mg/dm3 | 10–12 °C | 1 |
Wine bottling and corking | Semi-automatic bottling and topping machine (Zambelli Enotech) | 1 |
Technological Process | Oenological Material/Equipment | Dose | t °C | Time, Days |
---|---|---|---|---|
Crushing and destemming grapes | Roller crusher/destemmer (Zambelli Enotech) | 1 | ||
Sulfitation of grape must |
Potassium metabisulfite
, K2S2O5 | 150 mg/dm3 | ||
Maceration and fermentation of must | Selected yeast EnartisFerm SC/stainless steel tanks (TM INOX) | 20 g/100 dm3 | 26–28 °C | 4–6 |
Feteasca neagra | 6 | |||
Merlot | 6 | |||
Ametist | 4 | |||
Rara Neagra | 6 | |||
Cabernet Sauvignon | 6 | |||
Pressing fermented grape must | Pneumatic press (Zambelli Enotech) | 1 | ||
Malolactic fermentation with sugar content of no more 7g/dm3 | Viniflora CH16 (Oenococcus oeni) | 20 g/100 dm3 | 20 °C ± 1 | 6–8, depending on content of malic acid |
The wine aging on yeast lees |
Potassium metabisulfite
, K2S2O5 | 60 mg/dm3 | 10–12 °C | 30 |
Remove wine from yeast lees with equalization and sulfitation |
H2SO3/centrifugal pump (Zambelli Enotech) | 20 mg/dm3 | 10–12 °C | 1 |
Integrated wine treatment | Bentonite | 0.5 g/dm3 | 12 | |
Fish glue | 0.7 g/100 dm3 | |||
H2SO3 | 20 mg/dm3 | |||
Decanting wine from the sediment | Depth filter sheets | 1 | ||
Cold treatment | −3–5 °C | 5–7 | ||
Wine filtering | Cartridge membrane filter with pore size 0.65 µm (HOBRAFILT S20 N) | −3–5 °C | 1 | |
Wine resting and storage | 10–12 °C | |||
Sulfitation | H2SO3 | 20 mg/dm3 | 10–12 °C | 1 |
Wine bottling and corking | Semi-automatic bottling and topping machine, (Zambelli Enotech) | 1 |
Nr. | Grape Variety | Vintage | Density, kg/m3 | Sugar, g/dm3 | Alcohol, % | pH | Titrable Acidity, * g/dm3 |
---|---|---|---|---|---|---|---|
1 | Feteasca Neagra | 2021 | 1.094 | 223 | 13.4 | 3.35 | 6.20 |
2022 | 1.095 | 228 | 13.6 | 3.35 | 6.00 | ||
2023 | 1.093 | 220 | 13.2 | 3.45 | 5.90 | ||
2 | Feteasca Alba | 2021 | 1.090 | 212 | 12.3 | 3.30 | 7.00 |
2022 | 1.089 | 210 | 12.2 | 3.25 | 7.10 | ||
2023 | 1.091 | 215 | 12.5 | 3.30 | 6.60 | ||
3 | Feteasca Regala | 2021 | 1.091 | 215 | 12.5 | 3.30 | 6.80 |
2022 | 1.090 | 212 | 12.3 | 3.29 | 6.90 | ||
2023 | 1.092 | 218 | 12.6 | 3.30 | 6.50 | ||
4 | Rkatsiteli | 2021 | 1.080 | 186 | 10.8 | 3.20 | 7.90 |
2022 | 1.076 | 175 | 10.1 | 3.20 | 8.00 | ||
2023 | 1.078 | 180 | 10.0 | 3.20 | 8.00 | ||
5 | Merlot | 2021 | 1.096 | 228 | 13.3 | 3.50 | 6.10 |
2022 | 1.094 | 223 | 13.4 | 3.50 | 6.10 | ||
2023 | 1.094 | 233 | 13.4 | 3.40 | 6.20 | ||
6 | Feteasca Neagra | 2021 | 1.097 | 231 | 13.4 | 3.50 | 5.70 |
2022 | 1.094 | 223 | 13.3 | 3.50 | 5.80 | ||
2023 | 1.094 | 222 | 13.2 | 3.50 | 5.60 | ||
7 | Ametist | 2021 | 1.089 | 210 | 12.2 | 3.25 | 6.50 |
2022 | 1.091 | 215 | 12.5 | 3.25 | 6.50 | ||
2023 | 1.090 | 212 | 12.3 | 3.30 | 6.40 | ||
8 | Augustina | 2021 | 1.085 | 199 | 11.5 | 3.30 | 6.90 |
2022 | 1.087 | 204 | 11.9 | 3.20 | 6.70 | ||
2023 | 1.086 | 202 | 11.7 | 3.25 | 6.80 | ||
9 | Malena | 2021 | 1.079 | 183 | 10.6 | 3.2 | 7.10 |
2022 | 1.082 | 191 | 11.0 | 3.25 | 7.00 | ||
2023 | 1.080 | 186 | 10.8 | 3.20 | 7.00 | ||
10 | Rara Neagra | 2021 | 1.093 | 220 | 12.8 | 3.35 | 6.00 |
2022 | 1.095 | 226 | 13.1 | 3.30 | 6.10 | ||
2023 | 1.094 | 220 | 13.1 | 3.30 | 6.50 | ||
11 | Cabernet Sauvignon | 2021 | 1.097 | 231 | 13.4 | 3.40 | 6.10 |
2022 | 1.097 | 231 | 13.4 | 3.45 | 5.90 | ||
2023 | 1.094 | 223 | 13.4 | 3.50 | 6.00 | ||
12 | Alexandrina | 2021 | 1.085 | 199 | 11.5 | 3.25 | 6.90 |
2022 | 1.085 | 199 | 11.5 | 3.35 | 6.80 | ||
2023 | 1.087 | 204 | 11.9 | 3.25 | 6.80 | ||
13 | Feteasca Alba/Feteasca Regala | 2021 | 1.090 | 212 | 12.3 | 3.30 | 6.90 |
2022 | 1.091 | 215 | 12.5 | 3.30 | 6.70 | ||
2023 | 1.091 | 215 | 12.5 | 3.30 | 6.60 | ||
14 | Feteasca Neagra/Rara Neagra | 2021 | 1.094 | 223 | 13.4 | 3.30 | 6.00 |
2022 | 1.095 | 228 | 13.5 | 3.35 | 6.00 | ||
2023 | 1.094 | 223 | 13.4 | 3.40 | 6.50 |
Name | Primer Orientation | Primer Sequence 5′→3′ | Length | Tm | GC% | Self-Complementation | |
---|---|---|---|---|---|---|---|
5′ | 3′ | ||||||
p33 | Forward primer | AAGCGGCAAGAGCCCAAAT | 19 | 60.61 | 52.63 | 3.00 | 2.00 |
p34 | Reverse primer | ACTCTTCGGCGGGCACTA | 18 | 60.68 | 61.11 | 3.00 | 2.00 |
p35 | Forward primer | TTGATCCGACATGGTGTTTAGCA | 23 | 60.56 | 43.48 | 4.00 | 3.00 |
p36 | Reverse primer | ACACCCTCCGACAGAATCGAA | 21 | 61.16 | 52.38 | 4.00 | 2.00 |
Name | Brettanomyces | Brettanomyces bruxellensis | Brettanomyces anomalus | Uncultured Dekkera |
---|---|---|---|---|
p33 | 250 | 183 | 64 | - |
p34 | 267 | 208 | 56 | - |
p35 | 267 | 209 | 55 | 42 |
p36 | 267 | 208 | 56 | 19 |
Year | Variety | Region PGI | Stage | Concentration, cfu/cm3 |
---|---|---|---|---|
2021 | Feteasca Neagra | Codru, Milestii Mici | Must | 974 ± 141 |
2022 | Feteasca Alba | Codru, Straseni | Wine | 29,805 ± 642 |
2022 | Feteasca Regala | Codru | Wine | 3611 ± 225 |
2023 | Rkatsiteli | Codru | Must | 253 ± 286 |
2023 | Merlot | Codru | Must | 3708 ± 294 |
2023 | Feteasca Neagra | Codru, Stauceni | Wine | 53,328 ± 911 |
2023 | Feteasca Neagra | Valul lui Traian, Cantemir | Wine | 1692 ± 579 |
2023 | Ametist | Codru | Wine | 7696 ± 824 |
2023 | Feteasca Alba | Codru, Cricova | Wine | 37,119 ± 3863 |
2023 | Augustina | Codru | Wine | 971 ± 225 |
2023 | Malena | Codru | Wine | 266 ± 220 |
2023 | Rara Neagra | Stefan Voda | Wine | 803 ± 204 |
2023 | Merlot | Codru | Wine | 41,479 ± 2628 |
2023 | Cabernet | Codru | Wine | 1,980,379 ± 227,165 |
ID | Variety | Species | Similarity, % | Gene Bank Accession | Country of Origin | Source |
---|---|---|---|---|---|---|
BrettS2 | Artisanal, red wine | B. bruxellensis | 100 | KY103313.1 | France | Wine |
BrettS4 | Artisanal, white wine | B. bruxellensis | 99.32 | NR165974.1 | Belgium | Beer |
99.32 | MH393498.1 | New Zealand | Combucha | |||
99.32 | MH252564.1 | France | Wine | |||
BrettS10 | Ametist | B. bruxellensis | 100 | KY103314.1 | South Africa | Wine |
100 | JQ327831.1 | Lebanon | Wine tank | |||
BrettS12 | Alexandrina | B. bruxellensis | 100 | MT734879.1 | Portugal | Wine |
100 | MH252564.1 | France | Wine | |||
BrettS13 | Feteasca Alba, Cricova | B. bruxellensis | 100 | MT734879.1 | Portugal | Wine |
100 | MH252564.1 | France | Wine |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mitina, I.; Grajdieru, C.; Sturza, R.; Mitin, V.; Rubtov, S.; Balanuta, A.; Behta, E.; Inci, F.; Hacıosmanoğlu, N.; Zgardan, D. The Brettanomyces bruxellensis Contamination of Wines: A Case Study of Moldovan Micro-Winery. Beverages 2025, 11, 3. https://doi.org/10.3390/beverages11010003
Mitina I, Grajdieru C, Sturza R, Mitin V, Rubtov S, Balanuta A, Behta E, Inci F, Hacıosmanoğlu N, Zgardan D. The Brettanomyces bruxellensis Contamination of Wines: A Case Study of Moldovan Micro-Winery. Beverages. 2025; 11(1):3. https://doi.org/10.3390/beverages11010003
Chicago/Turabian StyleMitina, Irina, Cristina Grajdieru, Rodica Sturza, Valentin Mitin, Silvia Rubtov, Anatol Balanuta, Emilia Behta, Fatih Inci, Nedim Hacıosmanoğlu, and Dan Zgardan. 2025. "The Brettanomyces bruxellensis Contamination of Wines: A Case Study of Moldovan Micro-Winery" Beverages 11, no. 1: 3. https://doi.org/10.3390/beverages11010003
APA StyleMitina, I., Grajdieru, C., Sturza, R., Mitin, V., Rubtov, S., Balanuta, A., Behta, E., Inci, F., Hacıosmanoğlu, N., & Zgardan, D. (2025). The Brettanomyces bruxellensis Contamination of Wines: A Case Study of Moldovan Micro-Winery. Beverages, 11(1), 3. https://doi.org/10.3390/beverages11010003