The Acute Toxicity and Cardiotoxic Effects of Levofloxacin on Zebrafish (Danio rerio)
Abstract
1. Introduction
2. Materials and Methods
2.1. Reagents and Instruments
2.2. Zebrafish Rearing and Embryo Collection
2.3. Levofloxacin Exposure
2.4. Observation and Measurement of Zebrafish Developmental Parameters
2.4.1. Morphological Observation
2.4.2. Heart Rate Measurement
2.4.3. Assessment of Locomotor Behavior
2.5. RNA Extraction and Quantitative Real-Time PCR Analysis
2.6. Statistical Analysis
3. Results
3.1. Developmental Toxicity of Levofloxacin Exposure in Zebrafish Embryos
3.2. Effects of Levofloxacin Exposure on Zebrafish Larval Morphology
3.2.1. Body Length
3.2.2. Yolk Sac
3.2.3. Swim Bladder
3.3. Levofloxacin Exposure Induces Cardiotoxicity in Zebrafish Larvae
3.4. Effects of Levofloxacin Exposure on Zebrafish Larval Locomotor Behavior
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Puri, M.; Gandhi, K.; Kumar, M.S. Emerging Environmental Contaminants: A Global Perspective on Policies and Regulations. J. Environ. Manag. 2023, 332, 117344. [Google Scholar] [CrossRef] [PubMed]
- Wang, F.; Xiang, L.; Sze-Yin Leung, K.; Elsner, M.; Zhang, Y.; Guo, Y.; Pan, B.; Sun, H.; An, T.; Ying, G.; et al. Emerging Contaminants: A One Health Perspective. Innovation 2024, 5, 100612. [Google Scholar] [CrossRef] [PubMed]
- Sanganyado, E.; Lu, Z.; Liu, W. Application of Enantiomeric Fractions in Environmental Forensics: Uncertainties and Inconsistencies. Environ. Res. 2020, 184, 109354. [Google Scholar] [CrossRef] [PubMed]
- Klein, E.Y.; Van Boeckel, T.P.; Martinez, E.M.; Pant, S.; Gandra, S.; Levin, S.A.; Goossens, H.; Laxminarayan, R. Global Increase and Geographic Convergence in Antibiotic Consumption between 2000 and 2015. Proc. Natl. Acad. Sci. USA 2018, 115, E3463–E3470. [Google Scholar] [CrossRef]
- El Najjar, N.H.; Deborde, M.; Journel, R.; Vel Leitner, N.K. Aqueous Chlorination of Levofloxacin: Kinetic and Mechanistic Study, Transformation Product Identification and Toxicity. Water Res. 2013, 47, 121–129. [Google Scholar] [CrossRef]
- Hvistendahl, M. China Takes Aim at Rampant Antibiotic Resistance. Science 2012, 336, 795. [Google Scholar] [CrossRef]
- Al-Ahmad, A.; Daschner, F.D.; Kummerer, K. Biodegradability of Cefotiam, Ciprofloxacin, Meropenem, Penicillin G, and Sulfamethoxazole and Inhibition of Waste Water Bacteria. Arch. Environ. Contam. Toxicol. 1999, 37, 158–163. [Google Scholar] [CrossRef]
- Wu, H.-Y.; Shi, D.-Y.; Yang, D.; Yin, J.; Yang, Z.-W.; Li, J.-W.; Yang, W.; Jin, M. Putative Environmental Levels of Levofloxacin Facilitate the Dissemination of Antibiotic-Resistant Escherichia Coli via Plasmid-Mediated Transformability. Ecotoxicol. Environ. Saf. 2020, 195, 110461. [Google Scholar] [CrossRef]
- Ghosh, G.; Hanamoto, S.; Yamashita, N.; Huang, X.; Tanaka, H. Antibiotics Removal in Biological Sewage Treatment Plants. Pollution 2016, 2, 131–139. [Google Scholar] [CrossRef]
- Van Boeckel, T.P.; Gandra, S.; Ashok, A.; Caudron, Q.; Grenfell, B.T.; Levin, S.A.; Laxminarayan, R. Global Antibiotic Consumption 2000 to 2010: An Analysis of National Pharmaceutical Sales Data. Lancet Infect. Dis. 2014, 14, 742–750. [Google Scholar] [CrossRef]
- Jendrzejewska, N.; Karwowska, E. The Influence of Antibiotics on Wastewater Treatment Processes and the Development of Antibiotic-Resistant Bacteria. Water Sci. Technol. 2018, 77, 2320–2326. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.; Jia, A.; Wan, Y.; Liu, H.; Wang, K.; Peng, H.; Dong, Z.; Hu, J. Occurrences of Three Classes of Antibiotics in a Natural River Basin: Association with Antibiotic-Resistant Escherichia Coli. Environ. Sci. Technol. 2014, 48, 14317–14325. [Google Scholar] [CrossRef] [PubMed]
- Bambino, K.; Chu, J. Zebrafish in Toxicology and Environmental Health. Curr. Top. Dev. Biol. 2017, 124, 331–367. [Google Scholar] [CrossRef] [PubMed]
- He, J.-H.; Gao, J.-M.; Huang, C.-J.; Li, C.-Q. Zebrafish Models for Assessing Developmental and Reproductive Toxicity. Neurotoxicol. Teratol. 2014, 42, 35–42. [Google Scholar] [CrossRef] [PubMed]
- Shi, G.; Cui, Q.; Pan, Y.; Sheng, N.; Guo, Y.; Dai, J. 6:2 Fluorotelomer Carboxylic Acid (6:2 FTCA) Exposure Induces Developmental Toxicity and Inhibits the Formation of Erythrocytes during Zebrafish Embryogenesis. Aquat. Toxicol. 2017, 190, 53–61. [Google Scholar] [CrossRef]
- Howe, K.; Clark, M.D.; Torroja, C.F.; Torrance, J.; Berthelot, C.; Muffato, M.; Collins, J.E.; Humphray, S.; McLaren, K.; Matthews, L.; et al. The Zebrafish Reference Genome Sequence and Its Relationship to the Human Genome. Nature 2013, 496, 498–503. [Google Scholar] [CrossRef]
- Lieschke, G.J.; Currie, P.D. Animal Models of Human Disease: Zebrafish Swim into View. Nat. Rev. Genet. 2007, 8, 353–367. [Google Scholar] [CrossRef]
- Zon, L.I.; Peterson, R.T. In Vivo Drug Discovery in the Zebrafish. Nat. Rev. Drug Discov. 2005, 4, 35–44. [Google Scholar] [CrossRef]
- Xiao, C.; Han, Y.; Liu, Y.; Zhang, J.; Hu, C. Relationship Between Fluoroquinolone Structure and Neurotoxicity Revealed by Zebrafish Neurobehavior. Chem. Res. Toxicol. 2018, 31, 238–250. [Google Scholar] [CrossRef]
- Han, Y.; Ma, Y.; Yao, S.; Zhang, J.; Hu, C. In Vivo and in Silico Evaluations of Survival and Cardiac Developmental Toxicity of Quinolone Antibiotics in Zebrafish Embryos (Danio rerio). Environ. Pollut. 2021, 277, 116779. [Google Scholar] [CrossRef]
- Sehonova, P.; Tokanova, N.; Hodkovicova, N.; Kocour Kroupova, H.; Tumova, J.; Blahova, J.; Marsalek, P.; Plhalova, L.; Doubkova, V.; Dobsikova, R.; et al. Oxidative Stress Induced by Fluoroquinolone Enrofloxacin in Zebrafish (Danio rerio) Can Be Ameliorated after a Prolonged Exposure. Environ. Toxicol. Pharmacol. 2019, 67, 87–93. [Google Scholar] [CrossRef] [PubMed]
- Yuan, L.; Qian, L.; Qian, Y.; Liu, J.; Yang, K.; Huang, Y.; Wang, C.; Li, Y.; Mu, X. Bisphenol F-Induced Neurotoxicity toward Zebrafish Embryos. Environ. Sci. Technol. 2019, 53, 14638–14648. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Han, L.; Zhao, Y.; Chang, C.; Li, F. A Novel Electrochemical Sensor Based on Poly(p-Aminobenzene Sulfonic Acid)-Reduced Graphene Oxide Composite Film for the Sensitive and Selective Detection of Levofloxacin in Human Urine. J. Electroanal. Chem. 2018, 817, 141–148. [Google Scholar] [CrossRef]
- Yi, W.; Han, C.; Li, Z.; Guo, Y.; Liu, M.; Dong, C. A Strategy of Electrochemical Simultaneous Detection of Acetaminophen and Levofloxacin in Water Based on G-C3N4 Nanosheet-Doped Graphene Oxide. Environ. Sci. Nano 2021, 8, 258–268. [Google Scholar] [CrossRef]
- Ismail, A.; Yusof, S. Effect of Mercury and Cadmium on Early Life Stages of Java Medaka (Oryzias javanicus): A Potential Tropical Test Fish. Mar. Pollut. Bull. 2011, 63, 347–349. [Google Scholar] [CrossRef]
- Vogt, A.; Cholewinski, A.; Shen, X.; Nelson, S.G.; Lazo, J.S.; Tsang, M.; Hukriede, N.A. Automated Image-Based Phenotypic Analysis in Zebrafish Embryos. Dev. Dyn. 2009, 238, 656–663. [Google Scholar] [CrossRef]
- Fraher, D.; Sanigorski, A.; Mellett, N.A.; Meikle, P.J.; Sinclair, A.J.; Gibert, Y. Zebrafish Embryonic Lipidomic Analysis Reveals That the Yolk Cell Is Metabolically Active in Processing Lipid. Cell Rep. 2016, 14, 1317–1329. [Google Scholar] [CrossRef]
- Lindsey, B.W.; Smith, F.M.; Croll, R.P. From Inflation to Flotation: Contribution of the Swimbladder to Whole-Body Density and Swimming Depth during Development of the Zebrafish (Danio rerio). Zebrafish 2010, 7, 85–96. [Google Scholar] [CrossRef]
- Fänge, R. Gas Exchange in Fish Swim Bladder. Rev. Physiol. Biochem. Pharmacol. 1983, 97, 111–158. [Google Scholar] [CrossRef]
- Winata, C.L.; Korzh, S.; Kondrychyn, I.; Zheng, W.; Korzh, V.; Gong, Z. Development of Zebrafish Swimbladder: The Requirement of Hedgehog Signaling in Specification and Organization of the Three Tissue Layers. Dev. Biol. 2009, 331, 222–236. [Google Scholar] [CrossRef] [PubMed]
- Gao, Y.; Yang, P.; Zhu, J. Particle Size-Dependent Effects of Silver Nanoparticles on Swim Bladder Damage in Zebrafish Larvae. Ecotoxicol. Environ. Saf. 2023, 249, 114363. [Google Scholar] [CrossRef] [PubMed]
- Tao, Y.; Du, C.; Duan, B.; Wang, W.; Guo, H.; Feng, J.; Xu, H.; Li, Y. Eugenol Exposure Inhibits Embryonic Development and Swim Bladder Formation in Zebrafish. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2023, 268, 109602. [Google Scholar] [CrossRef] [PubMed]
- Li, R.; Zhang, C.; Xu, W.; Tao, L.; Cheng, J.; Li, Z.; Zhang, Y. Natural Pyrethrins Induced Developmental Toxicity of Zebrafish Swim Bladder in Vivo and Genotoxicity of Lung Cells in Vitro. Toxicol. In Vitro 2024, 100, 105896. [Google Scholar] [CrossRef]
- Stainier, D.Y. Zebrafish Genetics and Vertebrate Heart Formation. Nat. Rev. Genet. 2001, 2, 39–48. [Google Scholar] [CrossRef]
- Stainier, D.Y.; Lee, R.K.; Fishman, M.C. Cardiovascular Development in the Zebrafish. I. Myocardial Fate Map and Heart Tube Formation. Development 1993, 119, 31–40. [Google Scholar] [CrossRef]
- Chen, C.; Guo, L.; Shen, Y.; Hu, J.; Gu, J.; Ji, G. Oxidative Damage and Cardiotoxicity Induced by 2-Aminobenzothiazole in Zebrafish (Danio rerio). J. Hazard. Mater. 2024, 476, 135032. [Google Scholar] [CrossRef]
- Man, J.; Barnett, P.; Christoffels, V.M. Structure and Function of the Nppa-Nppb Cluster Locus during Heart Development and Disease. Cell Mol. Life Sci. 2018, 75, 1435–1444. [Google Scholar] [CrossRef]
- Kim, Y.-C.; Lee, S.-R.; Jeon, H.-J.; Kim, K.; Kim, M.-J.; Choi, S.-D.; Lee, S.-E. Acute Toxicities of Fluorene, Fluorene-1-Carboxylic Acid, and Fluorene-9-Carboxylic Acid on Zebrafish Embryos (Danio rerio): Molecular Mechanisms of Developmental Toxicities of Fluorene-1-Carboxylic Acid. Chemosphere 2020, 260, 127622. [Google Scholar] [CrossRef]
- Granados-Riveron, J.T.; Ghosh, T.K.; Pope, M.; Bu’Lock, F.; Thornborough, C.; Eason, J.; Kirk, E.P.; Fatkin, D.; Feneley, M.P.; Harvey, R.P.; et al. Alpha-Cardiac Myosin Heavy Chain (MYH6) Mutations Affecting Myofibril Formation Are Associated with Congenital Heart Defects. Hum. Mol. Genet. 2010, 19, 4007–4016. [Google Scholar] [CrossRef]
- Sarantis, P.; Gaitanaki, C.; Beis, D. Ventricular Remodeling of Single-Chambered Myh6−/− Adult Zebrafish Hearts Occurs via a Hyperplastic Response and Is Accompanied by Elastin Deposition in the Atrium. Cell Tissue Res. 2019, 378, 279–288. [Google Scholar] [CrossRef] [PubMed]
- Gong, G.; Kam, H.; Tse, Y.; Lee, S.M. Cardiotoxicity of Forchlorfenuron (CPPU) in Zebrafish (Danio rerio) and H9c2 Cardiomyocytes. Chemosphere 2019, 235, 153–162. [Google Scholar] [CrossRef] [PubMed]
- Ebert, A.M.; Hume, G.L.; Warren, K.S.; Cook, N.P.; Burns, C.G.; Mohideen, M.A.; Siegal, G.; Yelon, D.; Fishman, M.C.; Garrity, D.M. Calcium Extrusion Is Critical for Cardiac Morphogenesis and Rhythm in Embryonic Zebrafish Hearts. Proc. Natl. Acad. Sci. USA 2005, 102, 17705–17710. [Google Scholar] [CrossRef] [PubMed]
- Kuo, C.T.; Morrisey, E.E.; Anandappa, R.; Sigrist, K.; Lu, M.M.; Parmacek, M.S.; Soudais, C.; Leiden, J.M. GATA4 Transcription Factor Is Required for Ventral Morphogenesis and Heart Tube Formation. Genes. Dev. 1997, 11, 1048–1060. [Google Scholar] [CrossRef] [PubMed]
- Targoff, K.L.; Schell, T.; Yelon, D. Nkx Genes Regulate Heart Tube Extension and Exert Differential Effects on Ventricular and Atrial Cell Number. Dev. Biol. 2008, 322, 314–321. [Google Scholar] [CrossRef]
- Huang, Y.; Wang, Z.; Peng, Y.; Xu, R.; Yan, J.; Xiong, C.; Ma, J.; Zhong, K.; Lu, H. Carboxin Can Induce Cardiotoxicity in Zebrafish Embryos. Ecotoxicol. Environ. Saf. 2022, 233, 113318. [Google Scholar] [CrossRef]
- Chi, N.C.; Shaw, R.M.; De Val, S.; Kang, G.; Jan, L.Y.; Black, B.L.; Stainier, D.Y.R. Foxn4 Directly Regulates Tbx2b Expression and Atrioventricular Canal Formation. Genes. Dev. 2008, 22, 734–739. [Google Scholar] [CrossRef]
- Mu, X.; Chen, X.; Liu, J.; Yuan, L.; Wang, D.; Qian, L.; Qian, Y.; Shen, G.; Huang, Y.; Li, X.; et al. A Multi-Omics Approach Reveals Molecular Mechanisms by Which Phthalates Induce Cardiac Defects in Zebrafish (Danio rerio). Environ. Pollut. 2020, 265, 113876. [Google Scholar] [CrossRef]
- McKeown, K.A.; Downes, G.B.; Hutson, L.D. Modular Laboratory Exercises to Analyze the Development of Zebrafish Motor Behavior. Zebrafish 2009, 6, 179–185. [Google Scholar] [CrossRef]
- Yeh, T.-H.; Liu, H.-F.; Li, Y.-W.; Lu, C.-S.; Shih, H.-Y.; Chiu, C.-C.; Lin, S.-J.; Huang, Y.-C.; Cheng, Y.-C. C9orf72 Is Essential for Neurodevelopment and Motility Mediated by Cyclin G1. Exp. Neurol. 2018, 304, 114–124. [Google Scholar] [CrossRef]
- Suriyampola, P.S.; Shelton, D.S.; Shukla, R.; Roy, T.; Bhat, A.; Martins, E.P. Zebrafish Social Behavior in the Wild. Zebrafish 2016, 13, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Kalueff, A.V.; Gebhardt, M.; Stewart, A.M.; Cachat, J.M.; Brimmer, M.; Chawla, J.S.; Craddock, C.; Kyzar, E.J.; Roth, A.; Landsman, S.; et al. Towards a Comprehensive Catalog of Zebrafish Behavior 1.0 and Beyond. Zebrafish 2013, 10, 70–86. [Google Scholar] [CrossRef] [PubMed]
- Petersen, B.D.; Pereira, T.C.B.; Altenhofen, S.; Nabinger, D.D.; de Abreu Ferreira, P.M.; Bogo, M.R.; Bonan, C.D. Antibiotic Drugs Alter Zebrafish Behavior. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2021, 242, 108936. [Google Scholar] [CrossRef] [PubMed]
- Price, E.R.; Mager, E.M. The Effects of Exposure to Crude Oil or PAHs on Fish Swim Bladder Development and Function. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2020, 238, 108853. [Google Scholar] [CrossRef]
- Sehnert, A.J.; Huq, A.; Weinstein, B.M.; Walker, C.; Fishman, M.; Stainier, D.Y.R. Cardiac Troponin T Is Essential in Sarcomere Assembly and Cardiac Contractility. Nat. Genet. 2002, 31, 106–110. [Google Scholar] [CrossRef]
- Burggren, W.W.; Pinder, A.W. Ontogeny of Cardiovascular and Respiratory Physiology in Lower Vertebrates. Annu. Rev. Physiol. 1991, 53, 107–135. [Google Scholar] [CrossRef]
Primer | Forward Primer (5′→3′) | Reverse Primer (3′→5′) | Length/bp |
---|---|---|---|
β-actin | TGGCATCACACCTTCTACAATG | TGGCATCACACCTTCTACAATG | 214 |
nppa | GCTTCCTCTCGGTCTCTGTC | TTGGCAGCAGACGGATGTA | 207 |
myh6 | TCTACCTTAGCCAGTGTCAGTT | ACGCAGAGGAACGATGTGA | 196 |
cacna1ab | GAGCCGTGGTGGTGATGAT | GCGTGCGATTGGATGATTACT | 280 |
myl7 | TAGCAGCCTCTTGAACTCATCT | TGTCTTCCTCACCCTCTTTGG | 130 |
gata4 | AAGTGCGAAGCCGTCCAA | TCTCCACCAGTCCTCCGTTA | 154 |
nkx2.5 | GAACATTGGCTAGGTGGTCTC | AAGCAGAGGAAGAGGAGGAAG | 124 |
tbx2b | TGGCTCTCACAATATGGAACCT | TTCACAATTCTCGCTGGATGG | 219 |
tbx5b | TTGGTAAGTTGTGCTGTCTGAA | TCTCGGTCTGAATACACTGTGA | 255 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, Y.; Yu, W.; Song, Z.; He, J.; Li, Z.; Chen, Q.; Wang, S.; Li, P.; Cheng, S. The Acute Toxicity and Cardiotoxic Effects of Levofloxacin on Zebrafish (Danio rerio). Toxics 2025, 13, 122. https://doi.org/10.3390/toxics13020122
Wu Y, Yu W, Song Z, He J, Li Z, Chen Q, Wang S, Li P, Cheng S. The Acute Toxicity and Cardiotoxic Effects of Levofloxacin on Zebrafish (Danio rerio). Toxics. 2025; 13(2):122. https://doi.org/10.3390/toxics13020122
Chicago/Turabian StyleWu, Yixiao, Wenjing Yu, Zhenyan Song, Jiawei He, Ze Li, Qi Chen, Shiwei Wang, Ping Li, and Shaowu Cheng. 2025. "The Acute Toxicity and Cardiotoxic Effects of Levofloxacin on Zebrafish (Danio rerio)" Toxics 13, no. 2: 122. https://doi.org/10.3390/toxics13020122
APA StyleWu, Y., Yu, W., Song, Z., He, J., Li, Z., Chen, Q., Wang, S., Li, P., & Cheng, S. (2025). The Acute Toxicity and Cardiotoxic Effects of Levofloxacin on Zebrafish (Danio rerio). Toxics, 13(2), 122. https://doi.org/10.3390/toxics13020122