Rolling Circle Amplification-Enabled Ultrasensitive Point-of-Care Test Method for Aflatoxin B1 in the Environment and Food
Abstract
1. Introduction
2. Materials and Methods
2.1. Regents and Instruments
2.2. Preparation of Biotinylated Anti-AFB1 mAbs
2.3. Synthesis of Circular DNA
2.4. Procedure of the RCA−POCT
2.5. Evaluation of the RCA−POCT
2.6. Validation of the RCA−POCT with HPLC in Real Samples
2.7. Sample Preparation
3. Results and Discussion
3.1. Principle of the RCA−POCT
3.2. The Feasibility of the RCA−POCT
3.3. Optimization of the RCA−POCT
3.4. Analytical Performance of the RCA−POCT
3.5. Validation of the RCA−POCT with HPLC in Real Sample
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Zhao, Y.X.; Chen, F.; Li, Q.; Wang, L.H.; Fan, C.H. Isothermal Amplification of Nucleic Acids. Chem. Rev. 2015, 115, 12491–12545. [Google Scholar] [CrossRef] [PubMed]
- Soroka, M.; Wasowicz, B.; Rymaszewska, A. Loop-Mediated Isothermal Amplification (LAMP): The Better Sibling of PCR? Cells 2021, 10, 1931. [Google Scholar] [CrossRef] [PubMed]
- Bialy, R.M.; Mainguy, A.; Li, Y.F.; Brennan, J.D. Functional nucleic acid biosensors utilizing rolling circle amplification. Chem. Soc. Rev. 2022, 51, 9009–9067. [Google Scholar] [CrossRef]
- Zou, L.Y.; Liu, X.F.; Zhou, Y.; Mei, W.J.; Wang, Q.; Yang, X.H.; Wang, K.M. Optical fiber amplifier and thermometer assisted point-of-care biosensor for detection of cancerous exosomes. Sens. Actuators B-Chem. 2022, 351, 130893. [Google Scholar] [CrossRef]
- Gao, M.; Lian, H.; Yu, L.J.; Gong, M.F.; Ma, L.; Zhou, Y.X.; Yu, M.X.; Yan, X.M. Rolling circle amplification integrated with suspension bead array for ultrasensitive multiplex immunodetection of tumor markers. Anal. Chim. Acta 2019, 1048, 75–84. [Google Scholar] [CrossRef]
- Liu, Y.Q.; Li, R.Y.; Liang, F.Y.; Deng, C.; Seidi, F.; Xiao, H.N. Fluorescent paper-based analytical devices for ultra-sensitive dual-type RNA detections and accurate gastric cancer screening. Biosens. Bioelectron. 2022, 197, 113781. [Google Scholar] [CrossRef]
- Zhang, W.L.; He, Z.Y.; Yi, L.L.; Mao, S.F.; Li, H.F.; Lin, J.M. A dual-functional microfluidic chip for On-Line detection of interleukin-8 based on rolling circle amplification. Biosens. Bioelectron. 2018, 102, 652–660. [Google Scholar] [CrossRef] [PubMed]
- He, F.L.; Lv, X.F.; Li, X.Q.; Yao, M.D.; Li, K.J.; Deng, Y.L. Fluorescent microspheres lateral flow assay integrated with Smartphone-based reader for multiple microRNAs detection. Microchem. J. 2022, 179, 107551. [Google Scholar] [CrossRef]
- Ma, Y.L.; Mao, Y.; Huang, D.; He, Z.; Yan, J.M.; Tian, T.; Shi, Y.Z.; Song, Y.L.; Li, X.R.; Zhu, Z.; et al. Portable visual quantitative detection of aflatoxin B-1 using a target-responsive hydrogel and a distance-readout microfluidic chip. Lab Chip 2016, 16, 3097–3104. [Google Scholar] [CrossRef]
- Wu, W.; Xia, S.; Zhao, M.; Ping, J.; Lin, J.-M.; Hu, Q. Colorimetric liquid crystal-based assay for the ultrasensitive detection of AFB1 assisted with rolling circle amplification. Anal. Chim. Acta 2022, 1220, 340065. [Google Scholar] [CrossRef]
- Zhao, Y.; Wu, W.Q.; Tang, X.Q.; Zhang, Q.; Mao, J.; Yu, L.; Li, P.W.; Zhang, Z.W. A universal CRISPR/Cas12a-powered intelligent point-of-care testing platform for multiple small molecules in the healthcare, environment, and food. Biosens. Bioelectron. 2023, 225, 7. [Google Scholar] [CrossRef] [PubMed]
- Weber, P.C.; Ohlendorf, D.H.; Wendoloski, J.J.; Salemme, F.R. Structural Origins of High-Affinity Biotin Binding to Streptavidin. Science 1989, 243, 85–88. [Google Scholar] [CrossRef]
- Ostry, V.; Malir, F.; Toman, J.; Grosse, Y. Mycotoxins as human carcinogens-the IARC Monographs classification. Mycotoxin Res. 2017, 33, 65–73. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.S.; Selvaraj, J.N.; Yang, Q.L.; Liu, Y. A Survey of Aflatoxin-Producing Aspergillus sp. from Peanut Field Soils in Four Agroecological Zones of China. Toxins 2017, 9, 14. [Google Scholar] [CrossRef]
- Zuo, J.; Yan, T.; Tang, X.; Zhang, Q.; Li, P. Dual-Modal Immunosensor Made with the Multifunction Nanobody for Fluorescent/Colorimetric Sensitive Detection of Aflatoxin B1 in Maize. ACS Appl. Mater. Interfaces 2023, 15, 2771–2780. [Google Scholar] [CrossRef] [PubMed]
- Yue, Q.; Li, X.; Fang, J.; Li, M.; Zhang, J.; Zhao, G.; Cao, W.; Wei, Q. Oxygen Free Radical Scavenger PtPd@PDA as a Dual-Mode Quencher of Electrochemiluminescence Immunosensor for the Detection of AFB1. Anal. Chem. 2022, 94, 11476–11482. [Google Scholar] [CrossRef]
- Damphathik, C.; Songsiriritthigul, C.; Lerdsri, J.; Jakmunee, J.; Wongnongwa, Y.; Jungsuttiwong, S.; Ortner, A.; Kalcher, K.; Samphao, A. A novel immunosensor based on cobalt oxide nanocomposite modified single walled carbon nanohorns for the selective detection of aflatoxin B1. Talanta 2023, 258, 124472. [Google Scholar] [CrossRef]
- Jia, B.; Liao, X.; Sun, C.; Fang, L.; Zhou, L.; Kong, W. Development of a quantum dot nanobead-based fluorescent strip immunosensor for on-site detection of aflatoxin B1 in lotus seeds. Food Chem. 2021, 356, 129614. [Google Scholar] [CrossRef]
- Xu, Z.; Li, Q.-X.; Zhang, L.-W.; Chen, M.-L.; Tu, J.; Chen, W.; Zhu, Y.-Y.; Cheng, Y.-H. Target-modulated UCNPs-AChE assembly equipped with microenvironment-responsive immunosensor. Sens. Actuators B Chem. 2022, 352, 131050. [Google Scholar] [CrossRef]
- Pei, F.; Feng, S.; Zhang, Y.; Wu, Y.; Chen, C.; Sun, Y.; Xie, Z.; Hao, Q.; Cao, Y.; Tong, Z.; et al. A photoelectrochemical immunosensor based on Z-scheme CdS composite heterojunction for aflatoxin B1. Biosens. Bioelectron. 2022, 214, 114500. [Google Scholar] [CrossRef]
- Huang, L.; Wu, J.J.; Zheng, L.; Qian, H.S.; Xue, F.; Wu, Y.C.; Pan, D.D.; Adeloju, S.B.; Chen, W. Rolling Chain Amplification Based Signal-Enhanced Electrochemical Aptasensor for Ultrasensitive Detection of Ochratoxin A. Anal. Chem. 2013, 85, 10842–10849. [Google Scholar] [CrossRef] [PubMed]
- Hu, X.F.; Zhang, P.F.; Wang, D.; Jiang, J.; Chen, X.M.; Liu, Y.; Zhang, Z.W.; Tang, B.Z.; Li, P.W. AIEgens enabled ultrasensitive point-of-care test for multiple targets of food safety: Aflatoxin B-1 and cyclopiazonic acid as an example. Biosens. Bioelectron. 2021, 182, 113188. [Google Scholar] [CrossRef] [PubMed]
- Hu, X.; Huang, L.; Wang, S.; Ahmed, R.; Li, P.; Demirci, U.; Zhang, Z. Color-selective labyrinth-like quantum dot nanobeads enable point-of-care dual assay of Mycotoxins. Sens. Actuators B Chem. 2023, 376, 132956. [Google Scholar] [CrossRef]
- Xiong, Z.W.; Wang, Q.; Xie, Y.J.; Li, N.; Yun, W.; Yang, L.Z. Simultaneous detection of aflatoxin B1 and ochratoxin A in food samples by dual DNA tweezers nanomachine. Food Chem. 2021, 338, 128122. [Google Scholar] [CrossRef]
- Ren, W.J.; Pang, J.R.; Ma, R.R.; Liang, X.J.; Wei, M.; Suo, Z.G.; He, B.S.; Liu, Y. A signal On-Off fluorescence sensor based on the self-assembly DNA tetrahedron for simultaneous detection of ochratoxin A and aflatoxin B1. Anal. Chim. Acta 2022, 1198, 339566. [Google Scholar] [CrossRef]
- Guo, X.; Wen, F.; Zheng, N.; Luo, Q.; Wang, H.; Wang, H.; Li, S.; Wang, J. Development of an ultrasensitive aptasensor for the detection of aflatoxin B1. Biosens. Bioelectron. 2014, 56, 340–344. [Google Scholar] [CrossRef]
- Guo, X.; Wang, M.; Ma, L.; Cui, Z.; Liu, Z.; Yang, H.; Liu, Y. Carboxyl porphyrin as signal molecule for sensitive fluorescent detection of aflatoxin B1 via ARGET-ATRP. Spectrochim. Acta Part A Mol. Biomol. Spectrosc. 2022, 280, 121535. [Google Scholar] [CrossRef] [PubMed]
- Li, B.; Zhang, Y.; Ren, X.; Ma, H.; Wu, D.; Wei, Q. No-wash point-of-care biosensing assay for rapid and sensitive detection of aflatoxin B1. Talanta 2021, 235, 122772. [Google Scholar] [CrossRef]
- Kuang, J.; Ju, J.; Lu, Y.; Chen, Y.; Liu, C.; Kong, D.; Shen, W.; Shi, H.-W.; Li, L.; Ye, J.; et al. Magnetic three-phase single-drop microextraction for highly sensitive detection of aflatoxin B1 in agricultural product samples based on peroxidase-like spatial network structure. Food Chem. 2023, 416, 135856. [Google Scholar] [CrossRef]
- Lu, D.; Jiang, H.; Zhang, G.; Luo, Q.; Zhao, Q.; Shi, X. An In Situ Generated Prussian Blue Nanoparticle-Mediated Multimode Nanozyme-Linked Immunosorbent Assay for the Detection of Aflatoxin B1. ACS Appl. Mater. Interfaces 2021, 13, 25738–25747. [Google Scholar] [CrossRef]
- Li, M.; Yue, Q.; Fang, J.; Wang, C.; Cao, W.; Wei, Q. Au modified spindle-shaped cerium phosphate as an efficient co-reaction accelerator to amplify electrochemiluminescence signal of carbon quantum dots for ultrasensitive analysis of aflatoxin B1. Electrochim. Acta 2022, 407, 139912. [Google Scholar] [CrossRef]
- Zhang, D.H.; Li, P.W.; Zhang, Q.; Zhang, W.; Huang, Y.L.; Ding, X.X.; Jiang, J. Production of ultrasensitive generic monoclonal antibodies against major aflatoxins using a modified two-step screening procedure. Anal. Chim. Acta 2009, 636, 63–69. [Google Scholar] [CrossRef] [PubMed]
Name | Sequence (5′-3′) |
---|---|
Biotinylated primer | Biotin-GATCGGGTGTGGGTGGCGTAAAGGGAGCA TCGGACAGGCGAAGACAGGTGCTTAGT |
Padlock | Phosphate-TGTCTTCGCCTGTCCGATGCTCTTCCTT GAAACTTCTTCCTTTCTTTCGACTAAGCACC |
Double labeled primer | Biotin-GATCGGGTGTGGGTGGCGTAAAGGGAGCA TCGGACAGGCGAAGACAGGTGCTTAGT-FAM |
Signal probe | AACTTCTTCCTTTCTTTCGACTAAGCACC-FAM |
Method | Recognition Element | Signal Detection | LOD (fg/mL) | Linear Range (ng/mL) | References |
---|---|---|---|---|---|
Dual-DNA tweezers | Aptamer | Fluorescence | 35,000 | 0.08–10 | [24] |
Self-assembly DNA tetrahedron | Aptamer | Fluorescence | 10,000 | 0.05–100 | [25] |
RT-qPCR | Aptamer | Fluorescence | 25 | 5 × 10−5–5 | [26] |
Fluorescent biosensor | Antibody and aptamer | Fluorescence | 8.38 | 0.1–100 | [27] |
AIEgens nanosphere-POCT | Antibody | Fluorescence | 3000 | 0.05–1.2 | [22] |
Colorimetric-POCT | Antibody | Colorimetry | 33 | 0.1–50 | [28] |
Histidine-modified Fe3O4 nanozyme colorimetry | Antibody | Colorimetry | 34 | 1 × 10−4–1 | [29] |
Multimode nanozyme-linked immunosorbent assay | Antibody and aptamer | Photothermal Colorimetry Fluorescence | 0.54 | 10−5–100 | [30] |
Carbon quantum dot immunosensor | Antibody | Electrochemiluminescence | 9.55 | 1 × 10−4–100 | [31] |
RCA−POCT | Antibody | Fluorescence | 1.94 | 5 × 10−6–5 | The current study |
Sample | Spiked (ng/g) | Intra-Assay (n = 3) | Inter-Assay (n = 3) | ||||
---|---|---|---|---|---|---|---|
Found (ng/g) | Recovery (%) | CV (%) | Found (ng/g) | Recovery (%) | CV (%) | ||
Peanut | 2 | 2.03 | 101.5 | 3.5 | 2.07 | 103.3 | 5.5 |
5 | 5.18 | 103.6 | 3.5 | 4.56 | 91.3 | 5.8 | |
10 | 9.90 | 99.0 | 4.0 | 9.73 | 97.3 | 7.0 | |
Field soil | 2 | 1.85 | 92.5 | 4.2 | 1.94 | 96.8 | 6.6 |
5 | 4.97 | 99.4 | 5.6 | 5.13 | 102.6 | 7.2 | |
10 | 9.59 | 95.9 | 4.4 | 10.23 | 102.3 | 6.1 | |
Irrigation water | 2 | 2.05 | 102.5 | 4.4 | 2.05 | 102.7 | 8.2 |
5 | 5.09 | 101.8 | 4.3 | 4.83 | 96.6 | 6.9 | |
10 | 9.67 | 96.7 | 4.7 | 9.75 | 97.5 | 6.6 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Duan, H.; Zhao, Y.; Hu, X.; Liang, M.; Yang, X.; Yu, L.; Oranj, B.T.; Romanovski, V.; Li, P.; Zhang, Z. Rolling Circle Amplification-Enabled Ultrasensitive Point-of-Care Test Method for Aflatoxin B1 in the Environment and Food. Foods 2024, 13, 3188. https://doi.org/10.3390/foods13193188
Duan H, Zhao Y, Hu X, Liang M, Yang X, Yu L, Oranj BT, Romanovski V, Li P, Zhang Z. Rolling Circle Amplification-Enabled Ultrasensitive Point-of-Care Test Method for Aflatoxin B1 in the Environment and Food. Foods. 2024; 13(19):3188. https://doi.org/10.3390/foods13193188
Chicago/Turabian StyleDuan, Hongyu, Yuan Zhao, Xiaofeng Hu, Meijuan Liang, Xianglong Yang, Li Yu, Behrouz Tajdar Oranj, Valentin Romanovski, Peiwu Li, and Zhaowei Zhang. 2024. "Rolling Circle Amplification-Enabled Ultrasensitive Point-of-Care Test Method for Aflatoxin B1 in the Environment and Food" Foods 13, no. 19: 3188. https://doi.org/10.3390/foods13193188
APA StyleDuan, H., Zhao, Y., Hu, X., Liang, M., Yang, X., Yu, L., Oranj, B. T., Romanovski, V., Li, P., & Zhang, Z. (2024). Rolling Circle Amplification-Enabled Ultrasensitive Point-of-Care Test Method for Aflatoxin B1 in the Environment and Food. Foods, 13(19), 3188. https://doi.org/10.3390/foods13193188