Next Article in Journal
Evaluating the Test Characteristics of a Prototype for AI-Assisted Radiographic Detection
Previous Article in Journal
Evaluation of Retention and Oral Health-Related Quality of Life for Completely Edentulous Subjects Wearing Heat-Cured, 3D-Printed, and Injection-Molded Polyamide Complete Dentures: Randomized Crossover Clinical Trial
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Dentistry Journal
Volume 14
Issue 2
10.3390/dj14020094
Due to scheduled maintenance work on our servers, there may be short service disruptions on this website between 11:00 and 12:00 CEST on March 28th.
dentistry-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Comparative Analysis of Amelogenin-Derived Peptides LRAP and SP on Osteogenic Differentiation of Human Dental Pulp and Bone Marrow-Derived Stem Cells

by
Carmela Del Giudice
1,†,
Giuliana La Rosa
2,3,†,
Carmen Vito
1,
Roberto Tiribuzi
4,
Gianrico Spagnuolo
1,
Ciro Menale
2,*,
Carlo Rengo
5,‡ and
Antonino Fiorino
1,‡
1
Department of Neuroscience, Reproductive Sciences and Dentistry, Federico II University of Naples, 80131 Naples, Italy
2
Department of Clinical Medicine and Surgery, Federico II University of Naples, 80131 Naples, Italy
3
Department of Medical and Surgical Sciences, Magna Graecia University, 88100 Catanzaro, Italy
4
Translational Research Institute for the Locomotor System Nicola Cerulli-LPMRI, 06128 Perugia, Italy
5
Department of Medicine, Surgery and Dentistry, University of Salerno, 84081 Baronissi, Italy
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work as co-first authors.
‡
These authors contributed equally to this work as co-last authors.
Dent. J. 2026, 14(2), 94; https://doi.org/10.3390/dj14020094
Submission received: 17 December 2025 / Revised: 21 January 2026 / Accepted: 27 January 2026 / Published: 6 February 2026
Browse Figures
Versions Notes

Abstract

Background/Objectives: This study aimed to compare the biological effects of two amelogenin-derived peptides—the leucine-rich amelogenin peptide (LRAP) and a synthetic peptide (SP)—on human dental pulp stem cells (hDPSCs) and human bone marrow–derived mesenchymal stem cells (hBMSCs). The investigation focused on cell viability, osteogenic differentiation, mineralization, gene expression, and β-catenin expression. Methods: hDPSCs and hBMSCs were cultured in osteogenic medium and treated with LRAP and SP at 1, 5, 10, 50, and 100 ng/mL. Cytotoxicity was assessed by MTT assay, while osteogenic differentiation was evaluated by alkaline phosphatase (ALP) activity and Alizarin Red S staining. Gene expression of RUNX2, COL1A1, OCN, MEPE, and DMP1 was quantified by qPCR. β-catenin localization was analyzed by immunofluorescence. Statistical analysis was performed using one-way ANOVA with Tukey’s post hoc test (p < 0.05). Results: Both peptides exhibited good biocompatibility with hBMSCs, while high concentrations (≥50 ng/mL) reduced hDPSC viability. In both cell types, LRAP and SP increased ALP activity and mineral deposition in a concentration-dependent manner, with the greatest effects at 10 ng/mL. LRAP significantly upregulated osteogenic (RUNX2, COL1A1, OCN) and odontogenic (MEPE, DMP1) gene expression in hDPSCs. Immunofluorescence revealed nuclear β-catenin translocation in hDPSCs and membrane-associated accumulation in hBMSCs, indicating activation of canonical and non-canonical pathways, respectively. Conclusions: LRAP and SP promote osteogenic differentiation through distinct cell-type-specific signaling mechanisms, highlighting their potential as biomimetic agents for mineralized tissue regeneration.

Graphical Abstract

1. Introduction

Critical-size skeletal defects (CSDs) exceeding the regenerative capacity of bone represent a major challenge in reconstructive medicine [1,2,3]. Although autologous bone grafting remains the clinical gold standard, providing osteogenic, osteoinductive and osteoconductive properties essential for regeneration [1,2,3], its application is limited by donor-site morbidity, postoperative pain, limited graft availability, and unpredictable resorption, prompting the search for biologically inspired strategies to modulate cellular recruitment, proliferation, differentiation, and matrix formation [2,3].
Bone regeneration is regulated by diverse signaling molecules as growth factors and cytokines, including the transforming growth factor-β (TGF-β) and bone morphogenetic protein (BMP) superfamily members [4,5,6] that play a central role in driving osteoblast differentiation and matrix production, often involving the activation of the Wnt/β-catenin pathway [5,7] to orchestrate bone repair. Additional mediators, including platelet-derived growth factor (PDGF), fibroblast growth factors (FGFs), and vascular endothelial growth factor (VEGF), contribute to angiogenesis, cell migration, and extracellular matrix remodeling during bone repair [8,9,10]. Although their biological efficacy is well documented, the translational clinical use of these factors remains challenging; since they display a short half-life, their activity might be exerted using supraphysiologic dosages with limitation in controlling bioavailability, distribution and side effects [11], emphasizing the need for safer and more biomimetic bioactive agents.
Among biologically derived materials, the enamel matrix derivative (EMD, Emdogain®Straumann, Basel, Switzerland) has been extensively investigated for its regenerative potential of bone, specifically for periodontal application [12,13,14]. EMD is a porcine-derived extract rich in amelogenins (AMGs), representing about 90% of the enamel organic matrix and modulate mineral deposition during enamel formation [15,16]. In preclinical models, EMD enhances osteoblast proliferation, osteogenesis and matrix mineralization, with potential applications beyond periodontal therapy [13,14]. However, its heterogeneous composition renders difficult to identify specific bioactive components, and its animal origin might lead to immunogenicity, batch variability, and inconsistent bone-forming outcomes in vivo [14,17].
To overcome these limitations, amelogenin-derived peptides attracted attention for their regenerative potential. They replicate functional domains of the native protein while maintaining defined structural and biological profiles [15,16,18]. Among them, the leucine-rich amelogenin peptide (LRAP) and the synthetic peptide (SP) have shown promising osteogenic potential and mineralized matrix formation [18,19,20,21].
A recent review by Fiorino et al. (2021) summarized current evidence on amelogenin-derived peptides for bone regeneration highlighting their osteogenic ability while emphasizing the heterogeneity of experimental models and the lack of direct comparative studies evaluating cell-type-specific effects across different stem cell sources [22].
Bone marrow–derived mesenchymal stem cells (hBMSCs) remain the reference model for osteogenic studies and bone tissue engineering due to their well-characterized differentiation potential [23,24]. However, human dental pulp stem cells (hDPSCs) have recently emerged as a valuable alternative due to their neural crest origin, high proliferative capacity, and ability to differentiate toward both odontogenic and osteogenic lineages [25,26]. Despite this potential, the response of hDPSCs to amelogenin-derived peptides has not been systematically characterized.
Importantly, studies evaluating the effects of SP or LRAP on hDPSCs, and of SP on hBMSCs’ osteogenic ability are scarce, leaving a critical gap in the understanding of their cell-specific bioactivity.
Therefore, the present in vitro study aims to comparatively investigate the biological effects of LRAP and a SP on hDPSCs’ and hBMSCs’ osteogenesis, providing new insights into the amelogenin-peptides bioactivity and supporting the development of targeted biomimetic agents for bone and dentin regeneration. The null hypothesis of this study could be stated as LRAP and SP would not induce significant differences in osteogenic responses between hDPSCs and hBMSCs, nor activate distinct cellular pathways in the two cell types.

2. Materials and Methods

2.1. Preparation of Samples

The leucine-rich amelogenin peptide (LRAP; Bio-Fab, code 154475) and the synthetic peptide (SP; Bio-Fab, code 597895) were supplied by Bio-Fab (Rome, Italy).
Peptides were dissolved in phosphate-buffered saline (PBS; Gibco, Grand Island, NY, USA, 14190-144) at a concentration of 100,000 ng/mL and diluted to working concentrations of 1, 5, 10, 50, and 100 ng/mL. The experimental media consisted of either Alpha Minimum Essential Medium (α-MEM; Sigma-Aldrich, St. Louis, MI, USA, M4526) or in osteogenic medium made of low-glucose Dulbecco’s Modified Eagle Medium (DMEM; HiMedia, Mumbai, India, AL006), supplemented with 10 mM β-glycerophosphate (Sigma-Aldrich, G9422-50G), 100 nM dexamethasone (Sigma-Aldrich, D4902), and 50 µM ascorbic acid (Sigma-Aldrich, MKCV5491).

2.2. Cell Culture

Human dental pulp stem cells (hDPSCs; Lonza, PT-5025, Basel, Switzerland) and human bone marrow-derived mesenchymal stem cells (hBMSCs; ATCC®, PCS-500-012™), both derived from a single donor, were cultured following the manufacturers’ instructions. For hBMSCs, the Mesenchymal Stem Cell Growth Kit for Bone Marrow-derived MSCs (ATCC®, PCS-500-041™) was used.
Osteogenic differentiation was induced when cultures reached 80% confluence by replacing the growth medium with osteogenic medium, as above described. Both cell lines were incubated at 37 °C in a humidified atmosphere containing 5% CO2. Cells from passages 2–4 were used for all experiments.

2.3. Cell Viability

Cell viability was assessed using the MTT assay [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; Sigma-Aldrich, M5655], according to standard procedures. Briefly, cells were seeded in 96-well plates at an initial density of 5 × 104 cells/well and allowed to adhere for 24 h (t0). Cells were then treated with SP or LRAP at concentrations of 1, 5, 10, 50, or 100 ng/mL for 48 h, and MTT was added to the culture at a concentration of 5 mg/mL for 4 h. Formazan crystals were dissolved in isopropanol/DMSO solution (1:1 v:v ratio), and absorbance was measured at 570 nm using a microplate reader (Tecan, Grödig, Austria). Cells maintained in growth medium without peptide exposure served as untreated controls (CTLs).

2.4. ALP—Alkaline Phosphatase Evaluation

For ALP activity quantitative evaluation, hDPSCs and hBMSCs were seeded in 24-well plates at a density of 8 × 104 cells/well and treated with SP or LRAP at 1, 5, and 10 ng/mL in osteogenic medium for 10 days. ALP enzymatic activity was measured using the Alkaline Phosphatase Activity Assay Kit (Elabscience, Houston, TX, USA, E-BC-K091) according to the manufacturer’s instructions, and results were expressed as enzymatic units per milligram of protein.
For qualitative assessment, ALP staining was performed on parallel cultures using the Leukocyte Alkaline Phosphatase Kit (Sigma-Aldrich, 85L2-1KT) after 7 days of treatment. Stained cells were examined under an optical microscope (Leica DMi6000, Wetzlar, Germany) at 5× magnification to evaluate the distribution and intensity of ALP activity.

2.5. Alizarin Red Staining

Mineralized matrix deposition was evaluated using Alizarin Red S staining as previously described [27]. hDPSCs and hBMSCs were seeded in 12-well plates at a density of 1.2 × 105 cells/well and cultured in osteogenic medium containing SP or LRAP at concentrations of 1, 5, and 10 ng/mL for 21 days.
At the end of the differentiation period, cells were fixed with 4% paraformaldehyde (Microtech, Vero Beach, FL, USA, TA1-B03) for 15 min at room temperature, rinsed twice with distilled water, and stained with Alizarin Red S solution (Millipore, Bedford, MA, USA, ECM815) for 30 min. Stained cultures were photographed using an optical microscope (Leica DMi6000) at 5× magnification.
For quantitative analysis, ARS dye was extracted by adding 10% acetic acid (AnalaR, Radnor, PA, USA, MFCD00036152) under continuous shaking for 30 min, and absorbance was measured at 405 nm using a microplate reader (Tecan, Grödig, Austria).

2.6. Gene Expression Analysis

Gene expression analysis of osteogenic and odontogenic markers was performed in hDPSCs and hBMSCs cultured in 24-well plates at a density of 1.2 × 105 cells/well in the presence of SP or LRAP, after 21 days of osteogenic induction.
Total RNA was extracted using TRIzol™ Reagent (Invitrogen, Carlsbad, CA, USA, 15596-018) following the manufacturer’s protocol. RNA was reverse-transcribed into cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Waltham, MA, USA, 4387406).
Quantitative real-time PCR (qPCR) was conducted with Power SYBR™ Green PCR Master Mix (Applied Biosystems, 4367659) using the primer sequences listed in Table 1 [27]. Amplifications were performed on a StepOne™ Real-Time PCR System (Applied Biosystems, 4376357) with the following thermal cycling conditions: initial denaturation and polymerase activation at 95 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 15 s and annealing/extension at 60 °C for 1 min.
GAPDH served as the endogenous control gene, and the relative target gene expression was obtained using the comparative 2−ΔCt method. Data are represented as fold change relative to untreated control cells.

2.7. Immunofluorescence

Immunofluorescence analysis was performed to evaluate β-catenin localization in hDPSCs and hBMSCs. Cells were seeded on sterile glass coverslips placed in 24-well plates at a density of 1 × 104 cells/well and treated with SP or LRAP at concentrations of 5 and 10 ng/mL in osteogenic medium for 4 days. Cells were then fixed with 4% paraformaldehyde (PFA; Sigma-Aldrich, 1.00496.0700) for 15 min at 22 °C, washed twice with phosphate-buffered saline (PBS), and permeabilized for 10 min at room temperature with 0.1% Triton™ X-100 (Sigma-Aldrich, T8787) in PBS. Blocking nonspecific binding was conducted by incubating cells with 20% fetal bovine serum (FBS) in PBS for 1 h at 4 °C.
Samples were then incubated with a primary human anti–β-catenin monoclonal antibody (1:200; Elabscience, E-AB-22111) for 2 h at room temperature, followed by washing and incubation with a secondary anti-mouse antibody conjugated to Alexa Fluor™ 488 (1:300; Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA, 2180679) for 1 h at room temperature. Negative controls were processed in parallel and incubated with the secondary antibody only (Ab II).
Nuclei were counterstained with DAPI (1 µg/mL; Sigma-Aldrich, D9542) for 5 min, and coverslips were mounted on glass slides using aqueous mounting medium. Fluorescence images were acquired using a Leica DMi8 fluorescence microscope and analyzed with ImageJ software (v. 2.3.0/1.53f51, National Institutes of Health, Bethesda, MD, USA) following the workflow described by McCloy et al. [28]. For the nuclear and cytoplasmic localization analysis of β-catenin, the total cell area was outlined, and the nuclear area was identified based on DAPI staining. The cytoplasmic area was defined by subtracting the nuclear area from the total cell area, and fluorescent signal was acquired and analysed in the specific cellular fraction by ImageJ Software. Background fluorescence was subtracted prior to quantification.

2.8. Statistical Analysis

All quantitative data were expressed as mean ± standard error of the mean (SEM) from at least three independent experimental replicates (n = 3), each performed in technical triplicate unless otherwise specified (sample size was determined according to our previous in vitro studies using similar experimental cell models and endpoints). Cell treatments were randomly assigned to culture wells to minimize positional effects. Quantitative analyses and image measurements were performed blindly by an independent operator. Data acquisition and analysis were conducted using standardized protocols and software tools to reduce operator-related bias.
Statistical analysis was conducted using one-way analysis of variance (ANOVA) followed by Tukey’s post hoc test for multiple comparisons. Analyses were performed using GraphPad Prism version 9.0 (GraphPad Software, Inc., La Jolla, CA, USA). A two-tailed p-value < 0.05 was considered statistically significant (p < 0.05; p < 0.01; p < 0.001; p < 0.0001).

3. Results

3.1. Cell Viability Assessment

Figure 1 shows the effects of LRAP and SP on hDPSC viability after 48 h. Both peptides reduced hDPSC viability in a dose-dependent manner, with SP decreasing cell viability at 50 ng/mL and at 100 ng/mL compared to control (1.4-fold, p = 0.0099; 1.9-fold, p < 0.0001, respectively). SP 50 ng/mL and 100 ng/mL significantly reduced cell viability also as compared to the other treatment conditions. Similarly, LRAP at 50 ng/mL and 100 ng/mL significantly reduced cell viability compared with the control (p = 0.0147, p < 0.0001, respectively), and with other lower concentrations tested (p < 0.0001). In contrast, no reduction in cell viability was observed in hBMSCs following exposure to either peptide at any tested concentration (Supplementary Tables S1–S4).

3.2. Alkaline Phosphatase (ALP) Activity

After excluding the cytotoxic concentrations that significantly reduced hDPSC viability, peptides were tested at 1, 5, and 10 ng/mL (hereafter SP1, SP5, SP10, LRAP1, LRAP5, and LRAP10) for osteogenic differentiation analyses (Figure 2a–d). In hDPSCs, SP5 and SP10 significantly enhanced ALP activity compared with the control (p = 0.0007) and with SP1 (p = 0.0286; p = 0.0211, respectively). Similarly, LRAP10 increased ALP activity versus the control (p = 0.0026) and versus LRAP1 (p = 0.0009). In hBMSCs, SP5 and SP10 increased ALP activity compared with the control (p = 0.0055; p = 0.0004, respectively) and with SP1 (p = 0.0397; p = 0.0036, respectively). LRAP5 and LRAP10 elicited the highest responses. Colorimetric ALP staining (Figure 2b,d) corroborated the quantitative findings, showing more intense staining in SP5, SP10, and LRAP10 groups for hDPSCs, and in SP5, SP10, LRAP5, and LRAP10 groups for hBMSCs (Supplementary Tables S5 and S6).

3.3. Mineralized Deposits Through Alizarin Red Staining

Mineralized nodule formation following peptide treatment is presented in Figure 3. In hDPSCs, treatment with SP10 and LRAP10 significantly enhanced calcium deposition by 2.6- and 3.2-fold, respectively, compared with the control group (p < 0.0001). SP10 also induced an increased mineralization compared to SP1 (p < 0.0001) and SP5 (p = 0.0004). Similarly, LRAP10 promoted an increase in staining intensity versus LRAP1 and LRAP5 (p < 0.0001). In hBMSCs, SP10 caused a 2.8-fold increase relative to the control (p = 0.0013), while LRAP5 and LRAP10 further enhanced mineral deposition by 4.5- and 3.7-fold, respectively, compared with the control (p < 0.0001) (Supplementary Tables S7 and S8).

3.4. Gene Expression of Osteogenic and Odontogenic Markers

Quantitative PCR analysis demonstrated a significant upregulation of osteogenic and odontogenic markers in hDPSCs treated with LRAP (Figure 4). LRAP10 increased RUNX2 mRNA expression by 3-fold compared with the control (p = 0.0001), with an elevation trend also compared to LRAP1 (p = 0.0018) and LRAP5 (p = 0.0011). COL1A1 expression was also upregulated in LRAP1 (p = 0.0047), LRAP5 (p = 0.0005), and LRAP10 (p = 0.0002) compared with the control. Furthermore, OCN levels markedly increased following LRAP treatment: LRAP5 and LRAP10 induced a 5.7-fold (p = 0.0102) and 10-fold rise (p < 0.0001), respectively, compared to the control, and a significant increase also compared to the lower concentrations tested.
In hBMSCs, a trend toward increased RUNX2 expression was observed with LRAP, although it was not statistically significant. Conversely, LRAP5 and LRAP10 significantly elevated COL1A1 mRNA levels by 2.2-fold and 3.0-fold, respectively, compared with the control (p = 0.0052; p < 0.0001, respectively) and an elevation also compared with LRAP1. In addition, SP5 increased OCN expression by 3.0-fold versus the control (p = 0.0025), while LRAP5 induced a 2.9-fold increase (p = 0.0048). SP5 and LRAP5 also yielded higher OCN expression compared with SP1 and LRAP1.
Analysis of odontogenic markers revealed a strong induction of MEPE and DMP1 expression in hDPSCs following LRAP10 treatment (Figure 4). MEPE mRNA levels increased 23-fold compared with the control (p < 0.0001), 38.5-fold relative to LRAP1 (p < 0.0001), and 12-fold relative to LRAP5 (p < 0.0001). Similarly, DMP1 expression showed a dose-dependent response, rising 3.7-fold compared with the control (p < 0.0001), 14.5-fold relative to LRAP1 (p < 0.0001), and 22.5-fold relative to LRAP5 (p < 0.0001). No modulation of MEPE or DMP1 expression was detected in hBMSCs following SP or LRAP treatment (Supplementary Tables S9–S18).

3.5. β-Catenin Expression Evaluation

To investigate the molecular mechanisms underlying peptide-induced mineralization, β-catenin expression and localization were evaluated to assess activation of the Wnt/β-catenin pathway. Treatments with SP5, SP10, LRAP5, and LRAP10 were selected as the most effective concentrations for inducing osteogenic and odontogenic differentiation.
In hDPSCs, immunofluorescence analysis revealed enhanced nuclear translocation of β-catenin following SP10 and LRAP10 treatment (Figure 5a,b). SP10 increased nuclear β-catenin localization by 4.5-fold compared with the control (p < 0.0001) and by 3.5-fold relative to SP5 (p = 0.0002). Similarly, LRAP10 induced a 3.8-fold increase compared with the control (p = 0.0008) and a 2.2-fold increase relative to LRAP5 (p = 0.0174). In both cases, the strong co-localization of β-catenin (green) with nuclear DAPI staining (blue) indicated activation of the canonical Wnt/β-catenin signalling pathway.
In contrast, hBMSCs showed no evidence of nuclear β-catenin translocation after peptide treatment (Figure 5c,d). Instead, a dose-dependent accumulation of β-catenin was observed at cell–cell junctions for both SP and LRAP. Specifically, β-catenin fluorescence intensity increased 4.0-fold in SP10-treated cells (p = 0.0148), and 7.8-fold and 10.7-fold in LRAP5 and LRAP10, respectively (p < 0.0001), compared with the control (Supplementary Tables S19 and S20).

4. Discussion

The pro-osteogenic potential of amelogenin-derived peptides has been previously reported in vitro and in vivo [22,29]; however, direct comparisons across different stem cell types remains limited. Notably, to the best of our knowledge, only one study has investigated the effects of LRAP on hDPSCs [30], while information on SP treatment in both hDPSCs and hBMSCs is still missing. Therefore, this study provides a novel contribution by offering a direct comparison of LRAP and SP osteogenic ability in both hDPSCs and hBMSCs evaluating both peptide-specific and cell-type-specific responses. Our findings indicate that SP and LRAP exerted cytotoxic effects on hDPSCs at 100 ng/mL after 48 h, with moderate toxicity at 50 ng/mL. Previous studies reported enhanced hDPSC proliferation after LRAP treatment at higher concentrations (100–300 ng/mL) and shorter exposure times (24 h) [30,31]. The discrepancy with our results may therefore reflect differences in experimental duration and culture conditions. No previous data were available regarding the cytotoxicity of SP. Peng et al. reported that the amelogenin-derived peptide QP5 did not affect hDPSC viability over 200 μg/mL after five days [32], suggesting that different amelogenin peptides may elicit distinct cell-specific responses. In support of this hypothesis, Yu et al. demonstrated recently that another amelogenin-derived peptide, with the amino acid sequence KWYQNMIR, significantly enhanced hDPSCs’ proliferation [33].
Conversely, both peptides showed biocompatibility in hBMSCs at all tested concentrations, consistent with previous findings [34,35,36].
For what pertains the osteogenic capacity, we showed that in hDPSCs, SP10 and LRAP10 significantly enhanced ALP activity, confirming early osteogenic activation, while other studies reported no significant ALP changes when using LRAP at 10 nM in hDPSCs [37], highlighting the concentration-dependent effect of the peptide. To date, there are no available data on SP-induced ALP expression, supporting the novelty of our findings. Similar to our results, the QP5 peptide increased ALP expression at 10 and 50 μg/mL [32], confirming the capacity of amelogenin-derived peptides to promote early osteogenesis in dental stem cells. Furthermore, treatment with 1 μM amelogenin peptide KWYQNMIR enhanced ALP activity in hDPSCs at 7 and 14 days of differentiation [33].
Consistently, LRAP and SP treatment also elevated ALP activity in hBMSCs, supporting a role for these peptides in enhancing osteogenic differentiation across multiple mesenchymal stem cell types, as previously described [35,36]. These observations were corroborated by the increased formation of mineralized nodules in hDPSCs following SP10 and LRAP10 treatment, consistent with previous reports of LRAP-, QP5- and KWYQNMIR-induced mineralization [30,32,33]. Furthermore, full-length amelogenin alone was shown to be insufficient to induce mineralization in hDPSCs in the absence of osteogenic medium [38]. No prior data were available regarding the osteogenic effects of SP in hDPSCs, whereas the present findings revealed that both peptides also increased mineral deposition in hBMSCs, in line with observation in bone marrow-derived stem cells, alveolar bone cells, and ST2 and MC3T3 cell lines, where full-length amelogenin has also been shown to exert osteoinductive properties [34,35,36,39,40].
The enhanced differentiation observed in hDPSCs was further supported by the upregulation of osteogenic and odontogenic markers. LRAP significantly increased COL1A1, OCN, DSPP, and DMP1 expression, consistent with previous reports of LRAP-, QP5- and KWYQNMIR-induced marker expression [30,32]. In hBMSCs, LRAP and SP increased osteogenic gene expression, according to previous studies [34,35,36,39], whereas odontogenic markers remained unaffected, as expected for this cell type.
The differential response between hDPSCs and hBMSCs in osteogenic and odontogenic gene activation might reflect a possible cell-type-specific receptor interactions. For full-length amelogenin, proposed receptors include LAMP1, CD63, and Grp78 [41,42,43]. On the other hand, potential LRAP-binding proteins have been suggested to include Eef2, Fez1, Lsm10, LAMP-1, CD63, and Flot-1 [39,44,45]. However, the specific receptors and downstream signaling pathways engaged by LRAP and SP remain unclear [22].
Despite these uncertainties, it has been shown that amelogenin and amelogenin-derived peptides can activate the Wnt/β-catenin pathway in mesenchymal cells, which is crucial for osteogenic differentiation [18,34,46]. In line with these findings, we revealed that both SP10 and LRAP10 increased nuclear β-catenin translocation in hDPSCs, indicating a possible activation of canonical Wnt/β-catenin signaling, consistent with the induction of osteogenic gene transcription [47,48]. In hBMSCs we observed a dose-dependent accumulation of β-catenin, according to reports describing increased β-catenin levels after amelogenin or LRAP exposure in MSCs [18,34,39,41]; however, this accumulation was directed at the cell–cell junctions without nuclear translocation. This junctional localization points to a shift in β-catenin function from transcriptional regulation toward a structural role in cell adhesion. This would support tissue organization and osteoblastic integrity [49], possibly involving non-canonical mechanisms, such as activation of the ERK/MAPK pathway [33,35,36].
Alternative pathways, including PI3K/Akt signaling or integrin- and cadherin-mediated mechanotransduction, may also stabilize β-catenin at the plasma membrane, reinforcing adherens junctions and promoting osteogenic cell communication [50,51,52]. The observations suggest that the two cell types might activate separate yet convergent signaling mechanisms leading to osteogenic differentiation.
Of note, it has been reported that some of the putative receptor proteins for LRAP (namely CD63 and Flot-1) might induce directly or indirectly β-catenin activation, supporting our findings [53,54].
These differences reveal, to our knowledge, that LRAP and SP act through distinct cell-type-specific mechanisms possibly modulated by distinct receptor interactions, to achieve similar pro-osteogenic outcomes.
The strengths of this study include the direct comparison between a naturally derived amelogenin peptide (LRAP) and a synthetic peptide, the use of two biologically distinct human mesenchymal stem cell populations relevant to bone and dentin regeneration, and the integration of complementary functional readouts. The analysis of β-catenin expression and localization provides mechanistic insight into peptide-induced osteogenic responses.
Although informative data are presented, we acknowledge several limitations of our study. Only one hDPSC and hBMSC primary lines were used, which does not account donor-to-donor biological variability and might affect the extent of the observed responses. Thus, the present findings cannot be directly generalized to all hDPSCs and hBMSCs populations. Nevertheless, the coherence of the observed effects in different readouts supports the consistency of the findings. To address this limitation, future studies will employ primary cells from multiple donors to validate and extend the present observations, and to better capture inter-individual variability strengthening the translational relevance of the results.
Also, the in vitro setting cannot fully replicate the complexity of the in vivo microenvironment, including vascular, mechanical, and immunological cues that influence osteogenic differentiation. Accordingly, future investigation will increasingly focus on incorporating angiogenic and inflammatory components to better mimic physiological and pathological conditions relevant to bone and dentin regeneration. Finally, although this work focused on β-catenin expression and localization as the main molecular response evoked by peptide treatments, additional signaling mechanisms—such as ERK/MAPK and BMP/Smad pathways—were not investigated here and should be explored in future studies to achieve a more comprehensive understanding of peptide-induced osteogenic responses. Further investigations are warranted to elucidate Wnt/β-catenin signalling modulation and the possible contribution of the non-canonical pathway in hBMSCs, and the receptor systems mediating peptide activity, to enable development of targeted amelogenin-derived biomimetics for bone and dentin regeneration.

5. Conclusions

Amelogenin-derived peptides have been explored as biomimetic modulators of mineralized tissue responses in vitro.
  • Both LRAP and SP enhanced osteogenic differentiation in hDPSCs and hBMSCs, with the most pronounced effects observed at 10 ng/mL.
  • β-catenin showed a cell-type-dependent subcellular distribution, with nuclear localization in hDPSCs and predominantly junctional/membrane-associated localization in hBMSCs.
Together, these findings support the biological relevance of amelogenin-derived peptides in cellular contexts pertinent to bone and periodontal tissue regeneration.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/dj14020094/s1, Tables S1–S4: Mean and Standard Deviation (SD) of MTT values relative to Figure 1; Tables S5 and S6: Mean and Standard Deviation (SD) of ALP activity values relative to Figure 2; Tables S7 and S8: Mean and Standard Deviation (SD) of absorbance (O.D.) values at 405 nm relative to Figure 3; Tables S9–S18: Mean and Standard Deviation (SD) of Quantitative PCR analysis values relative to Figure 4; Tables S19 and S20: Mean and Standard Deviation (SD) of β-Catenin fluorescence intensity relative to Figure 5.

Author Contributions

Conceptualization, C.D.G., G.L.R., G.S., C.M., C.R. and A.F.; methodology, C.D.G., G.L.R. and C.M.; validation, C.D.G., G.L.R., G.S., C.M., C.R. and A.F.; formal analysis, C.D.G., G.L.R., C.V. and C.M.; investigation, C.D.G., G.L.R., C.V. and R.T.; resources, A.F.; data curation, C.D.G., G.L.R., C.V., G.S., C.M. and A.F.; writing—original draft preparation, C.D.G., G.L.R., G.S., C.M., C.R. and A.F.; writing—review and editing, C.D.G., G.L.R., C.V., R.T., G.S., C.M., C.R. and A.F.; visualization, C.D.G., G.L.R. and C.M.; supervision, G.S. and C.M. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
LRAPthe leucine-rich amelogenin peptide
SPsynthetic peptide
hDPSCshuman dental pulp stem cells
hBMSCsbone marrow-derived mesenchymal stem cells
ALPAlkaline Phosphatase
RUNX2Runt-related transcription factor 2
COL1A1Collagen Type I Alpha 1
OCNOsteocalcin
MEPEMatrix Extracellular Phosphoglycoprotein
DMP1Dentin Matrix Phosphoprotein 1
EMDEmdogain
AMGAmelogenin
TGF-βTransforming growth factor-β
GAPDHGlyceraldehyde-3-Phosphate Dehydrogenase
Eef2Eukaryotic elongation factor 2
Fez1Fasciculation and Elongation Protein Zeta 1
LAMP-1Lysosomal-Associated Membrane Protein 1
Flot-1Flotillin 1

References

  1. Schliephake, H. Bone growth factors in maxillofacial skeletal reconstruction. Int. J. Oral Maxillofac. Surg. 2002, 31, 469–484. [Google Scholar] [CrossRef] [PubMed]
  2. Porter, J.R.; Ruckh, T.T.; Popat, K.C. Bone tissue engineering: A review in bone biomimetics and drug delivery strategies. Biotechnol. Prog. 2009, 25, 1539–1560. [Google Scholar] [CrossRef] [PubMed]
  3. Cowan, C.M.; Soo, C.; Ting, K.; Wu, B. Evolving concepts in bone tissue engineering. Curr. Top. Dev. Biol. 2005, 66, 239–285. [Google Scholar] [PubMed]
  4. Wu, M.; Chen, G.; Li, Y.P. TGF-β and BMP signaling in osteoblast, skeletal development, and bone formation, homeostasis and disease. Bone Res. 2016, 4, 16009. [Google Scholar] [CrossRef]
  5. Chen, G.; Deng, C.; Li, Y.P. TGF-β and BMP signaling in osteoblast differentiation and bone formation. Int. J. Biol. Sci. 2012, 8, 272–288. [Google Scholar]
  6. Katagiri, T.; Watabe, T. Bone morphogenetic proteins. Cold Spring Harb. Perspect. Biol. 2016, 8, a021899. [Google Scholar] [CrossRef]
  7. Dituri, F.; Cossu, C.; Mancarella, S.; Giannelli, G. The Interactivity between TGFβ and BMP Signaling in Organogenesis, Fibrosis, and Cancer. Cells 2019, 8, 1130. [Google Scholar] [CrossRef]
  8. Ferrara, N. VEGF and the quest for tumour angiogenesis factors. Nat. Rev. Cancer 2002, 2, 795–803. [Google Scholar] [CrossRef]
  9. Galarraga-Vinueza, M.E.; Barootchi, S.; Nevins, M.L.; Nevins, M.; Miron, R.J.; Tavelli, L. Twenty-five years of recombinant human growth factors rhPDGF-BB and rhBMP-2 in oral hard and soft tissue regeneration. Periodontol. 2000 2024, 94, 483–509. [Google Scholar] [CrossRef]
  10. Ornitz, D.M.; Itoh, N. The fibroblast growth factor signaling pathway. Wiley Interdiscip. Rev. Dev. Biol. 2015, 4, 215–266. [Google Scholar] [CrossRef]
  11. Carreira, A.C.; Lojudice, F.H.; Halcsik, E.; Navarro, R.D.; Sogayar, M.C.; Granjeiro, J.M. Bone morphogenetic proteins: Facts, challenges, and future perspectives. J. Dent. Res. 2014, 93, 335–345. [Google Scholar] [CrossRef]
  12. Hammarström, L. The role of enamel matrix proteins in the development of cementum and periodontal tissues. Ciba Found. Symp. 1997, 205, 246–255. [Google Scholar]
  13. Haze, A.; Taylor, A.L.; Blumenfeld, A.; Rosenfeld, E.; Leiser, Y.; Dafni, L.; Shay, B.; Gruenbaum-Cohen, Y.; Fermon, E.; Haegewald, S.; et al. Amelogenin expression in long bone and cartilage cells and in bone marrow progenitor cells. Anat. Rec. 2007, 290, 455–460. [Google Scholar] [CrossRef] [PubMed]
  14. Miron, R.J.; Sculean, A.; Cochran, D.L.; Froum, S.; Zucchelli, G.; Nemcovsky, C.; Donos, N.; Lyngstadaas, S.P.; Deschner, J.; Dard, M.; et al. Twenty years of enamel matrix derivative: The past, the present and the future. J. Clin. Periodontol. 2016, 43, 668–683. [Google Scholar]
  15. Moradian-Oldak, J. Amelogenins: Assembly, processing, and control of crystal morphology. Matrix Biol. 2001, 20, 293–306. [Google Scholar] [CrossRef] [PubMed]
  16. Veis, A.; Tompkins, K.; Alvares, K.; Wei, K.; Wang, L.; Wang, X.S.; Brownell, A.G.; Jengh, S.M.; Healy, K.E. Specific amelogenin gene splice products have signaling effects on cells in culture and in implants in vivo. J. Biol. Chem. 2000, 275, 41263–41272. [Google Scholar] [CrossRef][Green Version]
  17. Deutsch, D.; Haze-Filderman, A.; Blumenfeld, A.; Dafni, L.; Leiser, Y.; Shay, B.; Gruenbaum-Cohen, Y.; Rosenfeld, E.; Fermon, E.; Zimmermann, B.; et al. Amelogenin, a major structural protein in mineralizing enamel, is also expressed in soft tissues. Eur. J. Oral Sci. 2006, 114, 183–189. [Google Scholar] [CrossRef] [PubMed]
  18. Warotayanont, R.; Frenkel, B.; Snead, M.L.; Zhou, Y. Leucine-rich amelogenin peptide induces osteogenesis by activation of the Wnt pathway. Biochem. Biophys. Res. Commun. 2009, 387, 558–563. [Google Scholar] [CrossRef]
  19. Gestrelius, S.; Andersson, C.; Lidström, D.; Hammarström, L.; Somerman, M. In vitro studies on periodontal ligament cells and enamel matrix derivative. J. Clin. Periodontol. 1997, 24, 685–692. [Google Scholar] [CrossRef]
  20. Cardaropoli, G.; Leonhardt, Å.S. Enamel matrix proteins in the treatment of deep intrabony defects. J. Periodontol. 2002, 73, 501–514. [Google Scholar] [CrossRef]
  21. Zucchelli, G.; Amore, C.; Montebugnoli, L.; De Sanctis, M. Enamel matrix proteins and bovine porous bone mineral in the treatment of intrabony defects: A randomized controlled clinical trial. J. Periodontol. 2003, 74, 1725–1735. [Google Scholar] [PubMed]
  22. Fiorino, A.; Marturano, A.; Placella, G.; Staderini, E.; Igual Domingo, L.; Cerulli, G.G.; Tiribuzi, R.; Blasi, P. Amelogenin-Derived Peptides in Bone Regeneration: A Systematic Review. Int. J. Mol. Sci. 2021, 22, 9224. [Google Scholar] [CrossRef] [PubMed]
  23. Caplan, A.I. Mesenchymal stem cells: Time to change the name! Stem Cells Transl. Med. 2017, 6, 1445–1451. [Google Scholar] [CrossRef] [PubMed]
  24. Dominici, M.; Le Blanc, K.; Mueller, I.; Slaper-Cortenbach, I.; Marini, F.; Krause, D.; Deans, R.; Keating, A.; Prockop, D.; Horwitz, E. Minimal criteria for defining multipotent mesenchymal stromal cells. Cytotherapy 2006, 8, 315–317. [Google Scholar] [CrossRef]
  25. Gronthos, S.; Mankani, M.; Brahim, J.; Robey, P.G.; Shi, S. Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo. Proc. Natl. Acad. Sci. USA 2000, 97, 13625–13630. [Google Scholar] [CrossRef]
  26. Augustine, R.; Gezek, M.; Nikolopoulos, V.K.; Buck, P.L.; Bostanci, N.S.; Camci-Unal, G. Stem cells in bone tissue engineering: Progress, promises and challenges. Stem Cell Rev. Rep. 2024, 20, 1692–1731. [Google Scholar] [CrossRef]
  27. Del Giudice, C.; Rengo, C.; Menale, C.; Fu Chou, Y.; Jovani Sancho, M.D.M.; Spagnuolo, G.; Sauro, S. Assessment of fluoride-infused calcium phosphate resin composites as effective remineralisation agents for human dental pulp stem cells. J. Dent. 2025, 161, 105997. [Google Scholar] [CrossRef]
  28. McCloy, R.A.; Rogers, S.; Caldon, C.E.; Lorca, T.; Castro, A.; Burgess, A. Partial inhibition of Cdk1 in G 2 phase overrides the SAC and decouples mitotic events. Cell Cycle 2014, 13, 1400–1412. [Google Scholar] [CrossRef]
  29. Haruyama, N.; Yamaza, T.; Suzuki, S.; Hall, B.; Cho, A.; Gibson, C.W.; Kulkarni, A.B. Leucine rich amelogenin peptide prevents ovariectomy-induced bone loss in mice. PLoS ONE 2021, 16, e0259966. [Google Scholar]
  30. Huang, Y.; Goldberg, M.; Le, T.; Qiang, R.; Warner, D.; Witkowska, H.E.; Liu, H.; Zhu, L.; Denbesten, P.; Li, W. Amelogenin exons 8 and 9 encoded peptide enhances leucine rich amelogenin peptide mediated dental pulp repair. Cells Tissues Organs 2012, 196, 151–160. [Google Scholar] [CrossRef]
  31. Pandya, M.; Lyu, H.; Luan, X.; Diekwisch, T.G.H. Polarized, Amelogenin Expressing Ameloblast-Like Cells from Cervical Loop/Dental Pulp Cocultures in Bioreactors. Stem Cells Dev. 2021, 30, 797–805. [Google Scholar] [CrossRef]
  32. Peng, X.; Han, S.; Wang, K.; Ding, L.; Liu, Z.; Zhang, L. Evaluating the potential of an amelogenin-derived peptide in tertiary dentin formation. Regen. Biomater. 2021, 8, rbab004. [Google Scholar] [CrossRef]
  33. Yu, Z.; Jiang, S.; Li, X.; Li, X.; Wang, G.; Dai, X.; Lian, X.; Yan, Y.; Wang, Y.; Yang, Z.; et al. Amelogenin Peptide Promotes Human Dental Pulp Cell Proliferation and Odontogenic Differentiation via ERK1/2 Pathway. Int. Dent. J. 2026, 76, 109304. [Google Scholar] [CrossRef] [PubMed]
  34. Wen, X.; Cawthorn, W.P.; MacDougald, O.A.; Stupp, S.I.; Snead, M.L.; Zhou, Y. The influence of Leucine-rich amelogenin peptide on MSC fate by inducing Wnt10b expression. Biomaterials 2011, 32, 6478–6486. [Google Scholar] [CrossRef] [PubMed]
  35. Katayama, N.; Kato, H.; Taguchi, Y.; Tanaka, A.; Umeda, M. The effects of synthetic oligopeptide derived from enamel matrix derivative on cell proliferation and osteoblastic differentiation of human mesenchymal stem cells. Int. J. Mol. Sci. 2014, 15, 14026–14043. [Google Scholar] [CrossRef] [PubMed]
  36. Yasui, N.; Taguchi, Y.; Tanaka, A.; Ueda, M.; Umeda, M. Biological Effects of Emdogain®-derived Oligopeptides on Rat Bone Marrow Cells in Vitro. J. Oral Tissue Eng. 2012, 9, 126–135. Available online: https://www.jstage.jst.go.jp/article/jarde/9/3/9_126/_article/-char/en (accessed on 26 January 2026).
  37. Ye, L.; Le, T.Q.; Zhu, L.; Butcher, K.; Schneider, R.A.; Li, W.; Besten, P.K. Amelogenins in human developing and mature dental pulp. J. Dent. Res. 2006, 85, 814–818. [Google Scholar] [CrossRef]
  38. Frasheri, I.; Ern, C.; Diegritz, C.; Hickel, R.; Hristov, M.; Folwaczny, M. Full-length amelogenin influences the differentiation of human dental pulp stem cells. Stem Cell Res. Ther. 2016, 7, 10. [Google Scholar] [CrossRef][Green Version]
  39. Matsuda, Y.; Hatakeyama, Y.; Nakashima, K.; Kamogashira, N.; Hatakeyama, J.; Tamaoki, S.; Sawa, Y.; Ishikawa, H. Effects of a Chemically Synthesized Leucine-Rich Amelogenin Peptide (csLRAP) on Chondrogenic and Osteogenic Cells. J. Hard Tissue Biol. 2017, 26, 51–60. [Google Scholar] [CrossRef][Green Version]
  40. Amin, H.D.; Olsen, I.; Knowles, J.C.; Donos, N. Differential effect of amelogenin peptides on osteogenic differentiation in vitro: Identification of possible new drugs for bone repair and regeneration. Tissue Eng. Part A 2012, 18, 1193–1202. [Google Scholar] [CrossRef]
  41. Zhang, H.; Tompkins, K.; Garrigues, J.; Snead, M.L.; Gibson, C.W.; Somerman, M.J. Full length amelogenin binds to cell surface LAMP-1 on tooth root/periodontium associated cells. Arch. Oral Biol. 2010, 55, 417–425. [Google Scholar] [CrossRef] [PubMed]
  42. Fukuda, T.; Sanui, T.; Toyoda, K.; Tanaka, U.; Taketomi, T.; Uchiumi, T.; Nishimura, F. Identification of novel amelogenin-binding proteins by proteomics analysis. PLoS ONE 2013, 8, e78129. [Google Scholar] [CrossRef] [PubMed]
  43. Toyoda, K.; Fukuda, T.; Sanui, T.; Tanaka, U.; Yamamichi, K.; Atomura, R.; Maeda, H.; Tomokiyo, A.; Taketomi, T.; Uchiumi, T.; et al. Grp78 Is Critical for Amelogenin-Induced Cell Migration in a Multipotent Clonal Human Periodontal Ligament Cell Line. J. Cell Physiol. 2016, 231, 414–427. [Google Scholar] [CrossRef] [PubMed]
  44. Wang, H.J.; Tannukit, S.; Wen, X.; Shapiro, J.L.; Snead, M.L.; Paine, M.L. Using the yeast two-hybrid assay to discover protein partners for the leucine-rich amelogenin peptide and for tuftelin-interacting protein 11. Eur. J. Oral Sci. 2006, 114, 276–279; discussion 285-286, 382. [Google Scholar] [CrossRef]
  45. Martins, L.; Leme, A.F.P.; Kantovitz, K.R.; de Luciane Martins, E.N.; Sallum, E.A.; Casati, M.Z.; Nociti, F.H., Jr. Leucine-Rich Amelogenin Peptide (LRAP) Uptake by Cementoblast Requires Flotillin-1 Mediated Endocytosis. J. Cell Physiol. 2016, 232, 556–565. [Google Scholar] [CrossRef]
  46. Zhang, H.; Yang, Y.; Han, Y.; Hu, Z.; Guan, L.; Wang, S. Amelogenin Promotes Periodontal Bone Regeneration by Inducing Bone Marrow Mesenchymal Stem Cell Homing. Stem Cells Dev. 2025, 34, 395–404. [Google Scholar] [CrossRef]
  47. Baron, R.; Kneissel, M. WNT signaling in bone homeostasis and disease: From human mutations to treatments. Nat. Med. 2013, 19, 179–192. [Google Scholar] [CrossRef]
  48. Zhu, S.; Chen, W.; Masson, A.; Li, Y.P. Cell signaling and transcriptional regulation of osteoblast lineage commitment, differentiation, bone formation, and homeostasis. Cell Discov. 2024, 10, 71. [Google Scholar] [CrossRef]
  49. Wróbel, E.; Wojdasiewicz, P.; Mikulska, A.; Szukiewicz, D. β-Catenin: A Key Molecule in Osteoblast Differentiation. Biomolecules 2025, 15, 1043. [Google Scholar] [CrossRef]
  50. Dong, J.; Xu, X.; Zhang, Q.; Yuan, Z.; Tan, B. The PI3K/AKT pathway promotes fracture healing through its crosstalk with Wnt/β-catenin. Exp. Cell Res. 2020, 394, 112137. [Google Scholar] [CrossRef]
  51. Guntur, A.R.; Rosen, C.J.; Naski, M.C. N-cadherin adherens junctions mediate osteogenesis through PI3K signaling. Bone 2012, 50, 54–62. [Google Scholar] [CrossRef]
  52. Dejaeger, M.; Böhm, A.M.; Dirckx, N.; Devriese, J.; Nefyodova, E.; Cardoen, R.; St-Arnaud, R.; Tournoy, J.; Luyten, F.P.; Maes, C. Integrin-Linked Kinase Regulates Bone Formation by Controlling Cytoskeletal Organization and Modulating BMP and Wnt Signaling in Osteoprogenitors. J. Bone Miner. Res. 2017, 32, 2087–2102. [Google Scholar] [CrossRef]
  53. Seubert, B.; Cui, H.; Simonavicius, N.; Honert, K.; Schäfer, S.; Reuning, U.; Heikenwalder, M.; Mari, B.; Krüger, A. Tetraspanin CD63 acts as a pro-metastatic factor via β-catenin stabilization. Int. J. Cancer 2015, 136, 2304–2315. [Google Scholar] [CrossRef]
  54. Kurrle, N.; Völlner, F.; Eming, R.; Hertl, M.; Banning, A.; Tikkanen, R. Flotillins directly interact with γ-catenin and regulate epithelial cell-cell adhesion. PLoS ONE 2013, 8, e84393. [Google Scholar] [CrossRef]
Dentistry 14 00094 g001
Figure 1. Cytotoxicity of SP (a,c) and LRAP (b,d) peptides (1, 5, 10, 50, and 100 ng/mL) evaluated on hDPSCs and hBMSCs with MTT assay after 48 h (n = 3). * p < 0.05, ** p < 0.01, **** p < 0.0001.
Figure 1. Cytotoxicity of SP (a,c) and LRAP (b,d) peptides (1, 5, 10, 50, and 100 ng/mL) evaluated on hDPSCs and hBMSCs with MTT assay after 48 h (n = 3). * p < 0.05, ** p < 0.01, **** p < 0.0001.
Dentistry 14 00094 g001
Dentistry 14 00094 g002
Figure 2. Quantitative analysis of alkaline phosphatase (ALP) activity of hDPSCs (a) and hBMSCs (c) cultured in osteogenic medium and treated with SP and LRAP peptides (1, 5, and 10 ng/mL) for 10 days. Representative ALP staining images (b,d) after 7 days of treatment. Scale bar = 400 µm. (n = 3). * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
Figure 2. Quantitative analysis of alkaline phosphatase (ALP) activity of hDPSCs (a) and hBMSCs (c) cultured in osteogenic medium and treated with SP and LRAP peptides (1, 5, and 10 ng/mL) for 10 days. Representative ALP staining images (b,d) after 7 days of treatment. Scale bar = 400 µm. (n = 3). * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
Dentistry 14 00094 g002
Dentistry 14 00094 g003
Figure 3. Alizarin Red staining of hDPSCs (a) and hBMSCs (c) cultured in osteogenic medium and treated with SP and LRAP peptides (1, 5, and 10 ng/mL) for 21 days. Scale bar = 400 µm. Quantitative analysis of mineral deposition in hDPSCs (b) and hBMSCs (d) (n = 3). ** p < 0.01, *** p < 0.001, **** p < 0.0001.
Figure 3. Alizarin Red staining of hDPSCs (a) and hBMSCs (c) cultured in osteogenic medium and treated with SP and LRAP peptides (1, 5, and 10 ng/mL) for 21 days. Scale bar = 400 µm. Quantitative analysis of mineral deposition in hDPSCs (b) and hBMSCs (d) (n = 3). ** p < 0.01, *** p < 0.001, **** p < 0.0001.
Dentistry 14 00094 g003
Dentistry 14 00094 g004
Figure 4. Gene expression analysis of osteogenic (RUNX2, Col1α1 and OCN) and odontogenic (MEPE and DMP-1) markers in hDPSCs (a) and hBMSCs (b) treated with SP and LRAP peptides (1, 5, and 10 ng/mL). (n = 3). * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
Figure 4. Gene expression analysis of osteogenic (RUNX2, Col1α1 and OCN) and odontogenic (MEPE and DMP-1) markers in hDPSCs (a) and hBMSCs (b) treated with SP and LRAP peptides (1, 5, and 10 ng/mL). (n = 3). * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
Dentistry 14 00094 g004
Dentistry 14 00094 g005
Figure 5. Representative immunofluorescence images showing β-Catenin expression in hDPSCs (a) and hBMSCs (c) treated with SP or LRAP (5 and 10 ng/mL) for 4 days. Quantitative analysis of β-Catenin fluorescence intensity in nuclear/cytoplasmic compartments of hDPSCs (b) and of total cellular fluorescence intensity in hBMSCs (d). Scale bar = 100 µm. (n = 3). * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
Figure 5. Representative immunofluorescence images showing β-Catenin expression in hDPSCs (a) and hBMSCs (c) treated with SP or LRAP (5 and 10 ng/mL) for 4 days. Quantitative analysis of β-Catenin fluorescence intensity in nuclear/cytoplasmic compartments of hDPSCs (b) and of total cellular fluorescence intensity in hBMSCs (d). Scale bar = 100 µm. (n = 3). * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
Dentistry 14 00094 g005
Table 1. Primer sequences for qPCR analysis.
Table 1. Primer sequences for qPCR analysis.
PrimerForward SequenceReverse Sequence
GAPDHTCAGCAATGCCTCCTGCACTCTGGGTGGCAGTGATGGC
OCNTGAGAGCCCTCACACTCCTCACCTTTGCTGGACTCTGCAC
Runx2ATGTGTGTTTGTTTCAGCAGCATCCCTAAAGTCACTCGGTATGTGTA
Col1α1CCCGGGTTTCAGAGACAACTTCTCCACATGCTTTATTCCAGCAATC
MEPEGGTTATACAGATCTTCAAGAGAGAGGTTGGTACTTTCAGCTGCATCACT
DMP−1TGGGGATTATCCTGTGCTCTTACTTCTGGGGTCACTGTCG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Del Giudice, C.; La Rosa, G.; Vito, C.; Tiribuzi, R.; Spagnuolo, G.; Menale, C.; Rengo, C.; Fiorino, A. Comparative Analysis of Amelogenin-Derived Peptides LRAP and SP on Osteogenic Differentiation of Human Dental Pulp and Bone Marrow-Derived Stem Cells. Dent. J. 2026, 14, 94. https://doi.org/10.3390/dj14020094

AMA Style

Del Giudice C, La Rosa G, Vito C, Tiribuzi R, Spagnuolo G, Menale C, Rengo C, Fiorino A. Comparative Analysis of Amelogenin-Derived Peptides LRAP and SP on Osteogenic Differentiation of Human Dental Pulp and Bone Marrow-Derived Stem Cells. Dentistry Journal. 2026; 14(2):94. https://doi.org/10.3390/dj14020094

Chicago/Turabian Style

Del Giudice, Carmela, Giuliana La Rosa, Carmen Vito, Roberto Tiribuzi, Gianrico Spagnuolo, Ciro Menale, Carlo Rengo, and Antonino Fiorino. 2026. "Comparative Analysis of Amelogenin-Derived Peptides LRAP and SP on Osteogenic Differentiation of Human Dental Pulp and Bone Marrow-Derived Stem Cells" Dentistry Journal 14, no. 2: 94. https://doi.org/10.3390/dj14020094

APA Style

Del Giudice, C., La Rosa, G., Vito, C., Tiribuzi, R., Spagnuolo, G., Menale, C., Rengo, C., & Fiorino, A. (2026). Comparative Analysis of Amelogenin-Derived Peptides LRAP and SP on Osteogenic Differentiation of Human Dental Pulp and Bone Marrow-Derived Stem Cells. Dentistry Journal, 14(2), 94. https://doi.org/10.3390/dj14020094

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop