Next Article in Journal
Analysis of Influencing Factors in Pilot Experiment for Synthesis of Natural Gas Hydrate by Spray Method
Next Article in Special Issue
Rapid Identification of Insecticide- and Herbicide-Tolerant Genetically Modified Maize Using Mid-Infrared Spectroscopy
Previous Article in Journal
Modeling Study on Melt Flow, Heat Transfer, and Inclusion Motion in the Funnel-shaped Molds for Two Thin-Slab Casters
Previous Article in Special Issue
Time-Series Monitoring of Transgenic Maize Seedlings Phenotyping Exhibiting Glyphosate Tolerance
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Bt and G10evo-EPSPS Protein Expressed in ZDAB3 Corn Has No Impact on Nutritional Composition and Toxicological Safety

1
Institute of Insect Sciences, College of Agriculture and Biotechnology, Zhejiang University, Hangzhou 310058, China
2
Key Laboratory of Safety Assessment of Genetically Modified Organism (Food Safety), Ministry of Agriculture and Rural Affairs, Beijing 100083, China
3
State Key Laboratory for Managing Biotic and Chemical Threats to the Quality and Safety of Agro-Products, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, China
4
Development Center for Science and Technology, Ministry of Agriculture and Rural Affairs, Beijing 100176, China
*
Authors to whom correspondence should be addressed.
Current address: Key Laboratory of Precision Nutrition and Food Quality, College of Food Science and Nutritional Engineering, China Agricultural University, Beijing 100083, China.
Processes 2022, 10(12), 2739; https://doi.org/10.3390/pr10122739
Submission received: 18 November 2022 / Revised: 6 December 2022 / Accepted: 8 December 2022 / Published: 19 December 2022

Abstract

Genetically modified (GM) crops expressing insecticidal and herbicide-tolerant traits provide a new approach to agriculture production, but concerns about food safety were often raised by the public. The present research shows the findings of the nutritional assessment of ZDAB3 expressing insecticidal Cry proteins (Cry1Ab and Cry2Ab) and EPSPS protein (G10evo-EPSPS). The key nutrients and anti-nutrients of ZDAB3 maize were examined and contrasted with those of its non-transgenic control maize grown at the same locations during three planting seasons. The values for proximates, amino acids, fatty acids, minerals, vitamins, phytic acid, and trypsin inhibitor assessed for ZDAB3 were comparable to those of its non-transgenic control maize or within the range of values reported for other commercial lines. In addition, no adverse effects related to the G10evo-EPSPS protein in mammals were observed. These data indicated that the expression of Cry1Ab, Cry2Ab, and G10evo-EPSPS proteins in ZDAB3 maize does not affect the nutritional compositions, and ZDAB3 maize is equivalent to non-transgenic maize regarding those important compositions.

1. Introduction

GM crops have been adopted more quickly than any other modern agricultural innovation. In 2019, 29 countries cultivated 190.4 million hectares of GM crops during the 24th year of GM crop commercialization [1]. Biotech crops are generated by integrating exogenous DNA into the host genome to impart characteristics like insect resistance, herbicide tolerance, and quality improvement [2,3,4,5]. Biotech crops have become a promising alternative to improve grain yield and reduce labor costs. Maize is the major global crop, and it is a staple food for humans and livestock, as well as an important source of raw materials for biofuels and a variety of other industrial goods [6]. However, the threat of weeds and insects during corn growing frequently results in poor yields, which is a major concern for corn planters [7,8]. In this situation, the corn that has been genetically modified to express insecticidal and herbicide-tolerant proteins could be a crucial tool for preventing farmers from suffering substantial losses.
ZDAB3 maize was created by the introduction of three gene cassettes that express Cry1Ab, Cry2Ab, and G10evo-EPSPS. The Cry1Ab coding sequence in ZDAB3 is under the regulation of the Zea mays polyubiquitin promoter and the Zea mays PEPC terminator. The polyubiquitin promoter is a constitutive promoter that directs transcription of the ubiquitin gene in Zea Mays [9]. The PEPC terminator sequence terminates the transcription of the maize PEPC gene [10]. The Cry2Ab coding sequence in ZDAB3 is regulated by the Actin1 promoter and the cauliflower mosaic virus 35S terminator. The G10evo-EPSPS coding sequence is controlled by the cauliflower mosaic virus 35S Actin fusion promoter, the Zea Mays AHAS chloroplast transit peptide, and the cauliflower mosaic virus 35S terminator. The cauliflower mosaic virus 35S Actin fusion promoter is a fusion of the promoter region from the cauliflower mosaic virus and the rice Actin gene promoter that directs the constitutive transcription of the g10evo-epsps gene in Zea Mays [11]. The Zea Mays AHAS chloroplast transit peptide sequence produces an N-terminal chloroplast transit peptide that directs the G10evo-EPSPS protein to the chloroplast. The cauliflower mosaic virus 35S terminator sequence is from the cauliflower mosaic virus and directs the polyadenylation of the mRNA [12]. The Bt proteins (Cry1Ab and Cry2Ab) produced in ZDAB3 have been shown to effectively control four major lepidopteran insect pests: Mythimna separata, Ostrinia furnacalis, Helicoverpa armigera, and Spodoptera frugiperda [13]. Due to the prevalence of Cry1Ab and Cry2Ab proteins in GM crops, such as maize, cotton, and soybeans, their safety has already been evaluated in the past, and safe dietary intake has a documented history. The g10evo-epsps gene was isolated from Deinococcus radiodurans. The G10evo-EPSPS protein is not a typical class I and class II EPSPS protein, and is functionally similar to plant EPSPS proteins, but has a lower affinity for glyphosate. If ZDAB3 corn could be commercially accessible, growers would be able to use fewer conventional chemical pesticides. The reduced usage of traditional chemical pesticides means a lower risk of harm to the environment and human health. Additionally, ZDAB3 offers a wider range of defenses against corn pests, which should be able to reduce mycotoxin contamination, increase yields, and eventually provide beneficial effects to human health.
Even though GM technology has grown in popularity, there have been questions concerning the use of GM crops as food and feed, in addition to questions regarding their release into the environment. Therefore, all GM crops should undergo a critical assessment of food safety before being released into the market. The safety of GM crops is determined by the substantial equivalence between the GM crop and its non-transgenic control. In 1993, the term ‘substantial equivalence’ was proposed by the Organization for Economic Co-operation and Development (OECD) and further covered by the Food and Agriculture Organization and World Health Organization (FAO/WHO) [14,15]. It has been utilized on a global scale for the risk assessment of GM crops. The substantial equivalence advocates that a current organism that has been used as food or feed and has a history of being used safely can be utilized as a comparator for evaluating the safety of food or feed from GM crops [16]. The comparator is typically the parent crop that has been historically grown. The GM crop is deemed to be as safe as its comparator if there are no significant differences between them, or if there are differences that may reasonably be considered not to have a negative effect on health. The nutritional assessment of GM crops used as food and feed is an important step in determining substantial equivalence. The first step in evaluating the nutritional value of GM crops is compositional analysis [17]. Acute toxicity testing was initially warranted because of the Cry protein’s insecticidal acute mode of action. While studies on the acute oral toxicity of proteins from GM crops have lost popularity in some parts of the globe (such as in the EU), they are still frequently carried out as part of the safety evaluation in other parts of the world, such as China.
In this study, the nutritional safety of transgenic maize ZDAB3 with cry1Ab, cry2Ab, and g10evo-epsps was evaluated in the acute oral toxicity study and compositional analysis. The safety evaluation of transgenic maize ZDAB3 in this research may meet the regulatory data requirements in China.

2. Materials and Methods

2.1. Plant Materials

A hybrid that carried event ZDAB3 and its non-transgenic control maize were used in this research. Event ZDAB3 was produced by transforming the inbred corn Hi-II. A homozygous state was achieved by backcrossing the event to the inbred Ruifeng-1 plants. The hybrid of ZDAB3 employed in this research was made by mating this homozygote with an inbred PH4CV. The non-transgenic control maize was a hybrid created by mating Ruifeng-1 and PH4CV. ZDAB3 maize and non-transgenic control maize were planted together during three planting seasons at the same locations (Changxing: 30°53′9″ N longitude, 119°37′57″ E latitude). In a single field, plants were cultivated in the same climatic conditions. At physiological maturity, the grains were collected. The safety assessment process of ZDAB3 corn is shown in Figure 1.

2.2. RNA Extraction and RT-PCR Analysis

Through utilizing the RNA prep Pure Plant Plus Kit, the total RNA from the grains was isolated (DP441, Tiangen Biotech, Beijing, China). An HiScript II Q RT SuperMix for a qPCR Kit with a gDNA wiper was used to create the cDNA by following the manufacturer’s instructions (R223, Vazyme, Nanjing, China). In a 20 µL total volume, RT-PCR was performed with the PCR reaction cycles conducted as follows: 95 °C for 30 s, then 34 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s, followed by a final extension lasting 5 min at 72 °C. On 1% agarose gels, PCR products underwent electrophoresis analysis. Table 1 lists the primer sequences and the size of the amplified DNA fragments.

2.3. Protein Quantification of Cry1Ab, Cry2Ab, and G10evo-EPSPS

Target proteins were detected through an Enzyme-Linked Immunosorbent Assay (ELISA) by using the ELISA kits that were available for purchase (Cry1Ab: AP003, Envirologix, Portland, ME; Cry2Ab: AP005, Envirologix, Portland, ME; G10evo-EPSPS: AA1141, Youlong, Shanghai, China). Grain proteins were extracted using the sample extract solution provided in the kit. The standard protein sample in the kit was used to create a standard curve. The OD450 value and standard curve were used to calculate the protein content per nanogram/mL (ng/mL) of each extract. The content of the proteins in the grain was then calculated from the concentration of each sample extract.

2.4. Acute Oral Toxicity Testing of G10evo-EPSPS

2.4.1. Bioethics

To evaluate any possible consequences of consuming G10evo-EPSPS, mice research on acute oral toxicity was conducted. The experiment was conducted at the Supervision and Testing Center for GMOs Food Safety at the Ministry of Agriculture in compliance with the guidelines published by the Ministry of Agriculture in China (Chinese Standard Bulletin No.2031-16-2013). Officials from the Chinese government certified and oversaw the performing laboratory tests.

2.4.2. Test and Control Substances

The level of G10evo-EPSPS in ZDAB3 maize was too low to make it possible to extract it in sufficient quantities from transformed plants for acute oral toxicity tests in mice. As a result, by utilizing anion-exchange chromatography, desalting, and lyophilization, recombinant G10evo-EPSPS protein was generated in Escherichia coli as a soluble protein. It was found that the molecular weight of the resulting substance produced by the microorganisms was the same as that of the protein expressed in maize, and these proteins from different sources had the same biological activity (data not shown).

2.4.3. Animal Experiment

A total of 24 CD-1 mice, weighing an average of 18–22 g (12 males, 12 females), were bought from the Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China). Before the trial began, the animals spent at least 3 days becoming accustomed to the laboratory surroundings. In all acute toxicity studies, each animal had fasted overnight before the dose was administered. The total dose volume was administered as three individual volumes of 20 mL/kg of body weight and separated by approximately 6 h. Mice used as a control were administered normal saline, while the G10evo-EPSPS group mice were individually administered a single-dose gavage at a dose of 85 mg/mL. These doses corresponded to 5100 mg/ kg of body weight of G10evo-EPSPS protein. Before exposure, at least twice on exposure day, and every day after, a thorough clinical observation was performed on every mouse. On test days 7 and 15, as well as before exposure, all animals were weighed.

2.5. Nutritional Composition Analysis

Compositional analyses were carried out to analyze proximates (moisture, protein, crude fat, crude fiber, ash, and starch), fatty acids, amino acids, vitamins, minerals, and anti-nutrients. Three biological replicates from each planting season were harvested at physiological maturity to determine the chemical components. All compositional analyses were performed at the designated institution by the Chinese government, which was the Supervision & Testing Center for Agricultural Product Quality at the Ministry of Agriculture and Rural Affairs.

2.5.1. Proximates

The moisture content could be determined by weighing the sample before and after it had been dried at 101~105 °C [18].
The amount of total nitrogen was calculated with the Kjeldahl technique. The protein content was 6.25 times the total nitrogen content [19].
To test the crude fat, the Soxhlet extraction technique was used [20].
GB/T 5009.10-2003, a Chinese standard, was used to evaluate the crude fiber [21].
Gravimetric analysis of the sample residue after burning was used to quantify the ash content [22].
Following the removal of fat and soluble sugar, amylase was used to hydrolyze the starch into tiny molecular sugars, which were then hydrolyzed into monosaccharides with hydrochloric acid. Finally, it was identified as reduced sugar and converted to starch content [23].

2.5.2. Fatty Acids

Through the use of gas–liquid chromatography following the Chinese standard GB 5009.168-2016, individual fatty acids were examined [24].

2.5.3. Amino Acids

The amino acids were determined by the acid hydrolysis method following the method provided by the Chinese Standard GB 5009.124-2016 [25].

2.5.4. Vitamins

By following the Chinese standards, GB 5009.84-2016 [26] and GB 5009.85-2016 [27], the amounts of vitamin B1 (thiamin) and vitamin B2 (riboflavin) were measured using a fluorometric technique. In accordance with the GB 5009.82-2016 protocol, high-performance liquid chromatography was used to evaluate the value of vitamin E [28].

2.5.5. Minerals

In accordance with the guidelines outlined in GB 5009.268-2016, the values of phosphorus, calcium, copper, zinc, iron, potassium, magnesium, sodium, and manganese were examined by inductively coupled plasma optical emission spectrometry (ICPOES) [29].

2.5.6. Anti-Nutrients

Ion exchange was used to assess the amount of phytic acid. The trypsin inhibitor value was detected based on the guideline of the international standard 65.020.99 [30].

2.6. Statistical Analysis

GraphPad Prism 9.0.0 was used in the statistical analysis. The composition values of the ZDAB3 maize and non-transgenic control maize were presented as mean ± SD (standard deviation). A significant difference (p < 0.05) in the means was determined by estimating and comparing the means of the ZDAB3 and control maize. The false discovery rate (FDR) method was used to control for false positives. The difference was likely a false positive in situations when a raw p-value suggested a significant difference but the FDR-adjusted p-value was more than 0.05. When the difference was statistically significant (adjusted p < 0.05), the values of the ZDAB3 maize were compared to the literature range. The ranges in the literature were created based on the published crop composition data [31,32,33,34].

3. Results

3.1. Molecular Character Detection of ZDAB3

The cry1Ab, cry2Ab, and g10evo-epsps genes from the transgenic maize ZDAB3 were amplified using reverse transcription PCR (RT-PCR) (Figure 2a–c).
The expression of target proteins in the grain was displayed as μg/g of fresh weight and represented a range of 20 individual samples. The Cry1Ab, Cry2Ab, and G10evo-EPSPS expression levels in the grain were 2.88 μg/g, 1.57 μg/g, and 1.84 μg/g, respectively (Figure 2d).
The results demonstrated that the exogenous genes successfully expressed themselves at the RNA and protein levels.

3.2. Lack of Acute Toxicity of G10evo-EPSPS Protein

As part of the evaluation of the safety of the ZDAB3 maize, the acute toxicity test of the G10evo-EPSPS protein was administered orally as a single dose to mice. The G10evo-EPSPS was gavaged into the mice, and none of the mice died throughout the observation period of 15 days. No macroscopic lesions related to treatment with G10evo-EPSPS were identified. When compared to their respective controls, neither the mean body weights of males nor females in either treatment group showed any treatment-related or statistically significant differences (Table 2). These results suggest that there was no sign of acute toxicity after oral administration of the G10evo-EPSPS protein at a limited dose of 5100 mg/kg of body weight, which supports the conclusion that the G10evo-EPSPS protein represents a negligible risk to humans or livestock that consume the corn products.

3.3. Nutritional Compositions of ZDAB3 Grain

The nutritional assessment of GM crops used as food and feed is an important step in determining substantial equivalence. In this study, ZDAB3 maize and non-transgenic control maize with a comparable genetic background to ZDAB3 were cultivated at the same location during three growing seasons, and their nutritional compositions were compared. The influence of genetic modification was evaluated by subjecting the nutrient composition data from the ZDAB3 and non-transgenic control to the t-test and FDR analysis. Taking into account the natural variation of values across different lines, the composition values for the ZDAB3 and non-transgenic control were compared with the values displayed in the literature to ascertain if the differences in treatment fell outside the range of natural variation.

3.3.1. Proximates

The proximate values of the ZDAB3 and non-transgenic control maize are listed in Table 3. No significant differences were found for moisture, protein, crude fat, ash, crude fiber, and starch between the ZDAB3 and non-transgenic control maize grains. All values measured in the ZDAB3 and non-transgenic control maize were within the literature range.

3.3.2. Fatty Acids

The values of fatty acids in the grains of the ZDAB3 and non-transgenic control are presented in Table 4. There were no statistically significant differences in the values of myristic (C14:0), heptadecanoic (C17:0), stearic (18:0), linolenic (C18:3), and behenic (C22:0) between the ZDAB3 and non-transgenic control maize. The values of palmitic (C16:0), palmitoleic (16:1), oleic (C18:1), linoleic (C18:2), and arachidic (C20:0) were statistically different between the ZDAB3 and non-transgenic control maize. However, the palmitic (C16:0) and palmitoleic (16:1) values did not differ significantly between groups when false positives were corrected through the FDR approach. The values of oleic (C18:1), linoleic (C18:2), and arachidic (C20:0) were not outside of the reference range of natural variation. Therefore, these differences between the ZDAB3 and control maize may not be biologically relevant.

3.3.3. Amino Acids

The composition of the 14 amino acids was measured in ZDAB3 grain (Table 5). The results showed that the amino acid values of the ZDAB3 were comparable to those of its non-transgenic control. The levels of alanine, glycine, histidine, isoleucine, leucine, phenylalanine, and valine between the ZDAB3 and non-transgenic control showed no difference after the raw p-value was adjusted by the FDR method. These differences were not seen to be biologically significant, because all amino acid values fell within the parameters of other reported commercial varieties.

3.3.4. Vitamins

The current study examined three vitamins (Table 6). The values of vitamin B2 and vitamin E in the ZDAB3 were similar to those of the non-transgenic control. The ZDAB3 had a higher vitamin B1 value than the non-transgenic control. When the p-value of vitamin B1 was adjusted by FDR and compared the content to other reported commercial lines, the level of vitamin B1 in the ZDAB3 was within the normal range and did not differ with the non-transgenic control maize.

3.3.5. Minerals

The OECD consensus documents state that factors, including soil, fertilizers, herbicides, fungicides, and insecticides, have a notable impact on the mineral content of commercial maize [35,36]. Except for zinc, none of the minerals differed significantly between the ZDAB3 and non-transgenic control. The mean values of the minerals measured in the ZDAB3 and non-transgenic control were in close alliance with the reference ranges supplied by the literature. The value of zinc in the ZDAB3 was lower than that in the non-transgenic control, but they were all within the acceptable limits according to the reference ranges (Table 7).

3.3.6. Anti-Nutrients

The OECD consensus guidelines advocate for measuring the quantities of phytic acid and trypsin inhibitors in maize grain [31]. Between the ZDAB3 maize and non-transgenic control maize, there were no phytic acid or trypsin inhibitor levels that were statistically different (Table 8).

4. Discussion

Crops that have been genetically engineered have great promise for addressing issues in modern agriculture, such as increasing population, changing climate, pests, weeds, and a scarcity of arable land [8,37,38]. The majority of GM crops are produced by expressing the herbicide tolerance proteins (e.g., CP4 EPSPS) from Agrobacterium tumefaciens strain CP4 or insecticidal (Cry) proteins from Bacillus thuringiensis bacterium. These GM crops generated new proteins that are distinct from their wild types. Therefore, GM crop safety issues have been brought up by growers, consumers, and relevant health agencies. One concern is that consumers believe that GM crops pose a threat to the environment, animals, and human health. Another issue that the general public is concerned about is whether GM crops are submitted to strict food safety inspection. Because maize is a significant staple food and a key raw component in food, the safety evaluation of transgenic maize is important before commercial application. Therefore, using recognized techniques, this study was carried out to examine the nutritional composition and potential toxicity of transgenic maize ZDAB3 that expressed the Cry1Ab, Cry2Ab, and G10evo-EPSPS proteins.
Both Cry1Ab and Cry2Ab proteins are expressed in many GM crops that are currently on the market. GM crops that express the insecticidal Cry proteins (Cry1Ab and Cry2Ab) have received extensive study over the past few decades to determine their environmental, animal, and human biosafety [39,40,41,42,43,44]. The Cry1Ab and Cry2Ab proteins are easily degraded by digestive enzymes or heat and are not hazardous to mammals. Due to the presence of Cry proteins in the plant matrix, there is no risk of exposure through the skin, eyes, or lungs [45,46]. Additionally, Cry1Ab and Cry2Ab proteins have been used broadly and safely in corn, soybean, rice, and cotton products. In a sub-chronic toxicity study, Wistar rats were given GM rice that expressed the Cry1Ab protein, and no adverse effects on the animal’s behavior or weight gain were observed [40]. In a different investigation on acute toxicity study, mice that were gavaged with a dose of the protein Cry1Ab (4000 mg/kg) or Cry2Ab protein (1450 mg/kg) did not exhibit any negative effects [47].
The glyphosate tolerance gene g10evo-epsps was isolated from Deinococcus radiodurans, a microbe widely found in nature with high levels of contact with humans. G10evo-EPSPS protein is not a typical class I and class II EPSPS protein; it is a new kind of EPSPS protein with similar functions to those naturally present in the plant. The g10evo-epsps gene has been successfully applied in the development of GM crops, such as the transgenic maize Ruifeng 125, and the herbicide-tolerant soybean SHZD3201. The G10evo-EPSPS protein rapidly degrades when it is treated with a digestive enzyme in vitro, and it is not structurally or functionally similar to any recognized allergies or toxins. During the acute oral toxicity study, groups of mice who were fed a high dose of G10evo-EPSPS protein had similar body weights when compared to groups of mice who were fed normal saline. Throughout the entire test, every mouse lived and remained healthy. These comparable results support the safety of consuming G10evo-EPSPS. Published research has supported our observations of the absence of risk connected to the EPSPS proteins in mammals [48,49].
The evaluation of foods derived from GM crops relies on using a product that is generally accepted to be safe as a comparator. This approach of comparative evaluation is known as the assessment of substantial equivalence. The term ‘substantial equivalence’ was first proposed by the OECD. It is widely applied by authorities and agencies as the latest professional guidance for evaluating the safety of new GM crops. When determining substantial equivalence, nutritional composition is the crucial factor to be considered. Additionally, according to the OECD guidelines, the composition of the transgenic plant should be compared to the non-transgenic variety with a sufficient history of safe use. The data for the non-transgenic varieties should come from the naturally occurring ranges that have been reported in the literature for commercial varieties or other edible varieties of the species. The ILSI Crop Composition Database is the most comprehensive and current source of crop composition data for most nutritional components. Therefore, the composition of the ZDAB3 grains was not only compared to the non-transgenic control used in the experiment, but also to the OECD, the ILSI Crop Composition Database, and the literature range to investigate if the differences fell outside the range of natural variation.
The composition analysis examined the main nutritional contents and anti-nutrients of ZDAB3 and its non-transgenic control. ZDAB3 maize and non-transgenic control maize were planted during three growing seasons in Zhejiang province, which belongs to the southern China corn region. Although some differences were statistically significant in oleic, linoleic, arachidic, and zinc between ZDAB3 maize and non-transgenic control maize, they had no biological significance, because the values were within the normal range of the literature. These findings suggested the nutritional compositions of the ZDAB3 maize were comparable to those of its non-transgenic control maize, and thus confirm that the insertion of cry1Ab, cry2Ab, and g10evo-epsps genes did not result in an adverse effect on the composition of the GM maize grain. As previously noted, it is unlikely that the insertion of well-characterized genes into a genome would have an unintended impact on crop composition [50]. Random genetic changes in a crop with a long history of safe usage, like maize, are improbable to have an unintended effect on food safety [51]. This will give crucial information for the safety evaluation of ZDAB3. Next, multipoint tests will be set up in the main maize production regions of China to further confirm whether the insertion of the target genes would alter the nutritional composition of ZDAB3 corn.

5. Conclusions

The findings in this study provide credence to the statement that ZDAB3 maize is just as nutritious as non-GM maize, and no adverse effects related to the G10evo-EPSPS protein in mammals were observed.

Author Contributions

Conceived and designed the experiments: X.Y., Y.J. and P.W. Performed the experiments: X.Y., G.C. and Z.Z. Analyzed the data: P.W. and X.C. Contributed reagents/materials/analysis tools: X.Y. and Z.Z. Wrote the manuscript: X.Y. Read and gave suggestions on the manuscript: P.W., X.C., X.H. and Y.J. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by a major project for breeding new genetically modified organisms (2018ZX08003-02B).

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

References

  1. ISAAA. Global Status of Commercialized Biotech/GM Crops in 2019: Biotech Crops Drive Socio-Economic Development and Sustainable Environment in the New Frontier. 2019. Available online: https://www.isaaa.org (accessed on 2 May 2022).
  2. Kramer, K.J.; Morgan, T.D.; Throne, J.E.; Dowell, F.E.; Bailey, M.; Howard, J.A. Transgenic avidin maize is resistant to storage insect pests. Nat. Biotechnol. 2000, 18, 670–674. [Google Scholar] [CrossRef] [PubMed]
  3. Cao, M.; Sato, S.J.; Behrens, M.; Jiang, W.Z.; Clemente, T.E.; Weeks, D.P. Genetic engineering of maize (Zea mays) for high-level tolerance to treatment with the herbicide dicamba. J. Agric. Food Chem. 2011, 59, 5830–5834. [Google Scholar] [CrossRef] [PubMed]
  4. Murry, L.E.; Elliott, L.G.; Capitant, S.A.; West, J.A.; Hanson, K.K.; Scarafia, L.; Johnston, S.; Deluca-Flaherty, C.; Nichols, S.; Cunanan, D. Transgenic corn plants expressing MDMV strain B coat protein are resistant to mixed infections of maize dwarf mosaic virus and maize chlorotic mottle virus. Bio/technology 1993, 11, 1559–1564. [Google Scholar] [CrossRef] [PubMed]
  5. El-Shemy, H.A.; Khalafalla, M.M.; Fujita, K.; Ishimoto, M. Improvement of protein quality in transgenic soybean plants. Biol. Plantarum 2007, 51, 277–284. [Google Scholar] [CrossRef]
  6. Mclaren, J.S. Crop biotechnology provides an opportunity to develop a sustainable future. Trends Biotechnol. 2005, 23, 339–342. [Google Scholar] [CrossRef]
  7. Soltani, N.; Dille, A.J.; Burke, I.C.; Everman, W.J.; Vangessel, M.J.; Davis, V.M.; Sikkema, P.H. Potential corn yield losses due to weeds in North America. Weed Technol. 2016, 30, 979–984. [Google Scholar] [CrossRef]
  8. Oerke, E.-C. Crop losses to pests. J. Agric. Sci. 2006, 144, 31–43. [Google Scholar] [CrossRef]
  9. Christensen, A.H.; Sharrock, R.A.; Quail, P.H. Maize polyubiquitin genes: Structure, thermal perturbation of expression and transcript splicing, and promoter activity following transfer to protoplasts by electroporation. Plant Mol. Biol. 1992, 18, 675–689. [Google Scholar] [CrossRef]
  10. Bandyopadhyay, A.; Datta, K.; Zhang, J.; Yang, W.; Raychaudhuri, S.; Miyao, M.; Datta, S.K. Enhanced photosynthesis rate in genetically engineered indica rice expressing pepc gene cloned from maize. Plant Sci. 2007, 172, 1204–1209. [Google Scholar] [CrossRef]
  11. Odell, J.T.; Nagy, F.; Chua, N.H. Identification of DNA sequences required for activity of the cauliflower mosaic virus 35S promoter. Nature 1985, 313, 810–812. [Google Scholar] [CrossRef]
  12. Hirt, H.; Kögl, M.; Murbacher, T.; Heberle-Bors, E. Evolutionary conservation of transcriptional machinery between yeast and plants as shown by the efficient expression from the CaMV 35S promoter and 35S terminator. Curr. Genet. 1990, 17, 473–479. [Google Scholar] [CrossRef] [PubMed]
  13. Xu, X.L.; Jiang, Y.Y.; Wang, P.F.; Lai, Y.M.; Chen, X.Y.; Xu, J.F. Resistance evaluation of genetically modified maize GAB-3 expressing Cry1Ab and Cry2Ab against four major lepidopteran pests. J. Agri. Sci. Technol.-Iran 2020, 22, 97–104. [Google Scholar]
  14. Schauzu, M. The concept of substantial equivalence in safety assessment of foods derived from genetically modified organisms. AgBiotechNet 2000, 2, ABN044. [Google Scholar]
  15. World Health Organization. Regional Office for Europe. European Centre for Environment and Health, Rome Division WHO/EURO/ECEH. In Safety Aspects of Genetically Modified Foods of Plant Origin: Report of a Joint FAO/WHO Expert Consultation on Foods Derived from Biotechnology: WHO Headquarters, Geneva, Switzerland, 29 May–2 June 2000|Clc; World Health Organization: Geneva, Switzerland, 2000. [Google Scholar]
  16. Rothamsted, A. Review of the strategies for the comprehensive food and feed safety and nutritional assessment of GM plants per se. EFSA Support. Publ. 2013, 10, EN-480. [Google Scholar]
  17. Flachowsky, H.G. Proposals for nutritional assessments of feeds from genetically modified plants. J. Anim. Feed Sci. 2005, 14, 49–70. [Google Scholar] [CrossRef]
  18. Chinese Standard GB 5009.3-2016; Methods for Determination of Moisture in Foods. Standards Press of China: Beijing, China, 2017.
  19. Chinese Standard GB 5009.5-2016; Methods for Determination of Protein in Foods. Standards Press of China: Beijing, China, 2017.
  20. Chinese Standard GB 5009.6-2016; Methods for Determination of Fat in Foods. Standards Press of China: Beijing, China, 2017.
  21. Chinese Standard GB/T 5009.10-2003; Methods for Determination of Crude Fiber in Vegetable Foods. Standards Press of China: Beijing, China, 2004.
  22. Chinese Standard GB 5009.4-2016; Methods for Determination of Ash in Foods. Standards Press of China: Beijing, China, 2017.
  23. Chinese Standard GB 5009.9-2016; Methods for Determination of Starch in Foods. Standards Press of China: Beijing, China, 2017.
  24. Chinese Standard GB 5009.168-2016; Methods for Determination of Fatty Acids in Foods. Standards Press of China: Beijing, China, 2017.
  25. Chinese Standard GB 5009.124-2016; Methods for Determination of Amino Acids in Foods. Standards Press of China: Beijing, China, 2017.
  26. Chinese Standard GB 5009.84-2016; Methods for Determination of Thiamine (Vitamin B1) in Foods. Standards Press of China: Beijing, China, 2017.
  27. Chinese Standard GB 5009.85-2016; Methods for Determination of Riboflavin (Vitamin B2) in Foods. Standards Press of China: Beijing, China, 2017.
  28. Chinese Standard GB 5009.82-2016; Methods for Determination of Tocopherol (Vitamin E) in Foods. Standards Press of China: Beijing, China, 2017.
  29. Chinese Standard GB 5009.268-2016; Methods for Determination of Minerals in Foods. Standards Press of China: Beijing, China, 2017.
  30. International Standard: 65.020.99; Safety Assessment of Genetically Modified Plant and Derived Products Parts 2: Assay of Anti-nutrients Pancreatic Trypsin Inhibiter. Standards Press of China: Beijing, China, 2006.
  31. OECD. Consensus document on compositional considerations for new varieties of maize (Zea mays): Key food and feed nutrients, anti-nutrients and secondary plant metabolites. Ser. Saf. Nov. Food Feeds 2002, 6, 1–42. [Google Scholar]
  32. ILSI. Crop Composition Database; International Life Sciences Institute: Washington, DC, USA, 2014. [Google Scholar]
  33. Anderson, J.A.; Hong, B.; Moellring, E.; Teronde, S.; Walker, C.; Wang, Y.W.; Maxwell, M. Composition of forage and grain from genetically modified DP202216 maize is equivalent to non-modified conventional maize (Zea mays L.). GM Crops Food 2019, 10, 77–89. [Google Scholar] [CrossRef]
  34. Lundry, D.R.; Burns, J.A.; Nemeth, M.A.; Riordan, S.G. Composition of grain and forage from insect-protected and herbicide-tolerant corn, MON 89034 × TC1507 × MON 88017 × DAS-59122-7 (SmartStax), is equivalent to that of conventional corn (Zea mays L.). J. Agric. Food Chem. 2013, 61, 1991–1998. [Google Scholar] [CrossRef]
  35. Heinemann, R.J.B.; Fagundes, P.D.L.; Pinto, E.A.; Penteado, M.D.V.C.; Lanfer-Marquez, U. Comparative study of nutrient composition of commercial brown, parboiled and milled rice from Brazil. J. Food Compos. Anal. 2005, 18, 287–296. [Google Scholar] [CrossRef]
  36. Parengam, M.; Judprasong, K.; Srianujata, S.; Jittinandana, S.; Laoharojanaphand, S.; Busamongko, A. Study of nutrients and toxic minerals in rice and legumes by instrumental neutron activation analysis and graphite furnace atomic absorption spectrophotometry. J. Food Compos. Anal. 2010, 23, 340–345. [Google Scholar] [CrossRef]
  37. Ray, D.K.; Mueller, N.D.; West, P.C.; Foley, J.A.; Hart, J.P. Yield trends are insufficient to double global crop production by 2050. PLoS ONE 2013, 8, e66428. [Google Scholar] [CrossRef] [PubMed]
  38. Abou-Hussein, S.D. Climate change and its impact on the productivity and quality of vegetable crops. J. Appl. Sci. Res. 2012, 8, 4359–4383. [Google Scholar]
  39. Yin, Y.; Xu, Y.D.; Cao, K.L.; Qin, Z.F.; Zhao, X.X.; Dong, X.H.; Shi, W.P. Impact assessment of Bt maize expressing the Cry1Ab and Cry2Ab protein simultaneously on non-target arthropods. Environ. Sci. Pollut. Res. 2020, 27, 21552–21559. [Google Scholar] [CrossRef] [PubMed]
  40. Schrøder, M.; Poulsen, M.; Wilcks, A.; Kroghsbo, S.; Miller, A.; Frenzel, T.; Danier, J.; Rychlik, M.; Emami, K.; Gatehouse, A. A 90-day safety study of genetically modified rice expressing Cry1Ab protein (Bacillus thuringiensis toxin) in Wistar rats. Food Chem. Toxicol. 2007, 45, 339–349. [Google Scholar] [CrossRef] [PubMed]
  41. Onose, J.-i.; Imai, T.; Hasumura, M.; Ueda, M.; Ozeki, Y.; Hirose, M. Evaluation of subchronic toxicity of dietary administered Cry1Ab protein from Bacillus thuringiensis var. Kurustaki HD-1 in F344 male rats with chemically induced gastrointestinal impairment. Food Chem. Toxicol. 2008, 46, 2184–2189. [Google Scholar] [CrossRef]
  42. Singhal, K.; Tyagi, A.; Rajput, Y.; Singh, M.; Kaur, H.; Perez, T.; Hartnell, G. Feed intake, milk production and composition of crossbred cows fed with insect-protected Bollgard II® cottonseed containing Cry1Ac and Cry2Ab proteins. Animal 2011, 5, 1769–1773. [Google Scholar] [CrossRef]
  43. Rahman, M.; Zaman, M.; Shaheen, T.; Irem, S.; Zafar, Y. Safe use of Cry genes in genetically modified crops. Environ. Chem. Lett. 2015, 13, 239–249. [Google Scholar] [CrossRef]
  44. Koch, M.S.; Ward, J.M.; Levine, S.L.; Baum, J.A.; Vicini, J.L.; Hammond, B.G. The food and environmental safety of Bt crops. Front. Plant Sci. 2015, 6, 283. [Google Scholar] [CrossRef]
  45. Gómez, I.; Pardo-López, L.; Muoz-Garay, C.; Fernandez, L.E.; Bravo, A. Role of receptor interaction in the mode of action of insecticidal Cry and Cyt toxins produced by Bacillus thuringiensis. Peptides 2007, 28, 169–173. [Google Scholar] [CrossRef]
  46. Rubio-Infante, N.; Moreno-Fierros, L. An overview of the safety and biological effects of Bacillus thuringiensis Cry toxins in mammals. J. Appl. Toxicol. 2016, 36, 630–648. [Google Scholar] [CrossRef]
  47. Hammond, B.G.; Koch, M.S. A Review of the Food Safety of Bt Crops. In Bacillus thuringiensis Biotechnology; Sansinenea, E., Ed.; Springer: Dordrecht, Netherlands, 2012; pp. 305–325. [Google Scholar]
  48. Harrison, L.A.; Bailey, M.R.; Naylor, M.W.; Ream, J.E.; Hammond, B.G.; Nida, D.L.; Burnette, B.L.; Nickson, T.E.; Mitsky, T.A.; Taylor, M.L. The expressed protein in glyphosate-tolerant soybean, 5-enolypyruvylshikimate-3-phosphate synthase from Agrobacterium sp. strain CP4, is rapidly digested in vitro and is not toxic to acutely gavaged mice. J. Nutr. 1996, 126, 728–740. [Google Scholar] [CrossRef] [PubMed]
  49. Matthews, B.A.; Launis, K.L.; Bauman, P.A.; Juba, N.C. Double-mutated 5-Enol Pyruvylshikimate-3-phosphate synthase protein expressed in MZHG0JG corn (Zea mays L.) has no impact on toxicological safety and nutritional composition. J. Agric. Food Chem. 2017, 65, 8459–8465. [Google Scholar] [CrossRef] [PubMed]
  50. Herman, R.A.; Phillips, A.M.; Collins, R.A.; Tagliani, L.A.; Prochaska, L.M. Compositional equivalency of Cry1F corn event TC6275 and conventional corn (Zea mays L.). J. Agric. Food Chem. 2004, 52, 2726. [Google Scholar] [CrossRef] [PubMed]
  51. Herman, R.A.; Storer, N.P.; Phillips, A.M.; Prochaska, L.M.; Windels, P. Compositional assessment of event DAS-59122-7 maize using substantial equivalence. Regul. Toxicol. Pharm. 2007, 47, 37–47. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Safety assessment process of ZDAB3 in this study.
Figure 1. Safety assessment process of ZDAB3 in this study.
Processes 10 02739 g001
Figure 2. Identification of exogenous genes in GM maize ZDAB3 grain. (a) RT-PCR detection of the exogenous gene cry1Ab. Lane M: DL 5000 DNA Marker; Lane 1–2: non-GM maize; Lane 3–4: GM maize ZDAB3. (b) RT-PCR detection of the exogenous gene cry2Ab. Lane M: DL 5000 DNA Marker; Lane 1–2: non-GM maize; Lane 3–4: GM maize ZDAB3. (c) RT-PCR detection of the exogenous gene g10evo-epsps. Lane M: DL 5000 DNA Marker; Lane 1–2: non-GM maize; Lane 3–4: GM maize ZDAB3. (d) Protein levels of Cry1Ab, Cry2Ab, and G10evo-EPSPS in ZDAB3 grains.
Figure 2. Identification of exogenous genes in GM maize ZDAB3 grain. (a) RT-PCR detection of the exogenous gene cry1Ab. Lane M: DL 5000 DNA Marker; Lane 1–2: non-GM maize; Lane 3–4: GM maize ZDAB3. (b) RT-PCR detection of the exogenous gene cry2Ab. Lane M: DL 5000 DNA Marker; Lane 1–2: non-GM maize; Lane 3–4: GM maize ZDAB3. (c) RT-PCR detection of the exogenous gene g10evo-epsps. Lane M: DL 5000 DNA Marker; Lane 1–2: non-GM maize; Lane 3–4: GM maize ZDAB3. (d) Protein levels of Cry1Ab, Cry2Ab, and G10evo-EPSPS in ZDAB3 grains.
Processes 10 02739 g002
Table 1. Primers used for RT-PCR analysis.
Table 1. Primers used for RT-PCR analysis.
Target FragmentPrimer NameSequence (5′- 3′)Size (bp)
cry1Abcry1Ab-RT-FGCTGGACATCGTGAGCCTGTTC207
cry1Ab-RT-RGCGTCGGTGTAGATGGTGATGC
cry2Abcry2Ab-RT-FGCACAACCGCAAGAACAACATCC271
cry2Ab-RT-RGATGGTGGAGTTGCCGATGGAAG
g10evo-epspsG10-RT-FCGCTCAGCCATCCAAGAACTACAC285
G10-RT-RGTCACGAAAGTGGTGCCAGAGG
Table 2. Body weight of mice fed with G10evo-EPSPS Protein.
Table 2. Body weight of mice fed with G10evo-EPSPS Protein.
TreatmentAnimal Day 0 BW 1 (g)Day 7 BW (g)Day 15 BW (g)BW (g) Increase
ControlMale 117.6 29.1 33.7 16.1
Male 216.5 28.9 34.3 17.8
Male 316.8 27.0 31.7 14.9
Male 418.8 31.7 34.4 15.6
Male 518.0 29.1 36.0 18.0
Male 616.7 29.2 31.8 15.1
Average17.40 ± 0.9029.17 ± 1.5033.65 ± 1.6616.25 ± 1.35
G10evo-EPSPSMale 715.4 28.2 32.7 17.3
Male 816.6 27.6 32.3 15.7
Male 916.6 28.0 34.1 17.5
Male 1015.7 28.3 34.0 18.3
Male 1117.6 29.9 35.0 17.4
Male 1216.7 31.5 34.0 17.3
Average16.43 ± 0.7928.92 ± 1.4933.68 ± 1.0017.25 ± 0.85
ControlFemale 117.9 23.6 25.3 7.4
Female 218.0 22.6 24.4 6.4
Female 318.3 23.6 24.6 6.3
Female 419.2 24.7 26.1 6.9
Female 518.5 25.0 25.4 6.9
Female 618.8 25.3 26.6 7.8
Average18.45 ± 0.4924.13 ± 1.0325.40 ± 0.856.95 ± 0.58
G10evo-EPSPSFemale 717.7 23.2 22.9 5.2
Female 817.4 21.7 25.5 8.1
Female 916.6 21.9 24.3 7.7
Female 1017.6 22.6 25.8 8.2
Female 1117.3 24.3 25.7 8.4
Female 1218.3 26.6 28.4 10.1
Average17.48 ± 0.5623.38 ± 1.8425.43 ± 1.837.95 ± 1.58
1 BW = body weight.
Table 3. Proximate values in maize samples.
Table 3. Proximate values in maize samples.
Proximatep-Value 1Content (g/100 g)
ZDAB3Control 2Literature Range 3
Moisture (fw) 40.809.14 ± 0.169.17 ± 0.207.00–23.00
Protein (dw) 50.097.46 ± 0.568.20 ± 0.185.72–17.26
Crude fat (dw)0.063.17 ± 0.063.37 ± 0.121.36–7.83
Ash (dw)0.771.43 ± 0.151.40 ± 0.100.62–6.28
Crude fiber (dw)0.122.00 ± 0.101.87 ± 0.120.49–5.50
Starch (dw)0.2169.20 ± 0.2668.47 ± 0.59na
1 No significant differences were observed between ZDAB3 and control; 2 Control: non-transgenic control maize; 3 Literature range: reference [31,32,33,34]; 4 fw: fresh weight; 5 dw: dry weight. na: not available.
Table 4. Fatty acid values in maize samples.
Table 4. Fatty acid values in maize samples.
Fatty Acidp-Value
(Adjusted p-Value) 1
Content (%)
ZDAB3Control 2Literature Range 3
Myristic (C14:0)0.160.05 ± 0.0020.05 ± 0.001ND-0.29
Heptadecanoic (C17:0)0.060.09 ± 0.0030.10 ± 0.001ND-0.20
Stearic (C18:0)0.202.33 ± 0.032.37 ± 0.04ND-4.90
Linolenic (C18:3)0.341.56 ± 0.061.52 ± 0.05ND-2.33
Behenic (C22:0)0.530.33 ± 0.040.31 ± 0.003ND-0.50
Palmitic (C16:0)0.01 (0.07)14.73 ± 0.1214.27 ± 0.156.81–39.00
Palmitoleic (C16:1)0.01 (0.06)0.14 ± 0.0020.13 ± 0.002ND-0.67
Oleic (C18:1)0.002 (0.02) *25.77 ± 0.1524.53 ± 0.2516.38–42.81
Linoleic (C18:2)0.000 (0.002) *53.77 ± 0.1255.53 ± 0.1513.10–67.68
Arachidic (C20:0)0.000 (0.002) *0.65 ± 0.0040.61 ± 0.0020.27–1.20
1 A significant difference (adjusted p < 0.05 *) was observed between ZDAB3 and control; 2 Control: non-transgenic control maize; 3 Literature range: reference [32,33,34]. ND: not detectable: some test values in the published studies were less than the lower limit of quantification and were not quantified.
Table 5. Amino acid values in maize samples.
Table 5. Amino acid values in maize samples.
Amino Acidp-Value
(Adjusted p-Value) 1
Content (g/100 g)
ZDAB3Control 2Literature Range 3
Arginine0.050.31 ± 0.040.37 ± 0.020.12–0.71
Aspartic acid0.190.53 ± 0.080.61 ± 0.030.33–1.21
Glutamic acid0.051.69 ± 0.181.99 ± 0.030.97–3.54
Lysine0.090.26 ± 0.030.30 ± 0.010.05–0.67
Methionine0.080.08 ± 0.010.09 ± 0.0030.10–0.47
Proline0.110.57 ± 0.090.68 ± 0.030.46–1.75
Tyrosine0.490.12 ± 0.000.11 ± 0.020.10–0.79
Alanine0.04 (0.09)0.59 ± 0.060.69 ± 0.020.44–1.48
Glycine0.02 (0.08)0.32 ± 0.030.38 ± 0.010.18–0.69
Histidine0.01 (0.06)0.16 ± 0.020.22 ± 0.020.14–0.46
Isoleucine0.04 (0.09)0.22 ± 0.020.25 ± 0.000.18–0.71
Leucine0.04 (0.09)0.71 ± 0.070.84 ± 0.030.64–2.49
Phenylalanine0.02 (0.07)0.30 ± 0.020.36 ± 0.020.24–0.93
Valine0.02 (0.08)0.31 ± 0.030.37 ± 0.010.21–0.86
1 No significant differences were observed between ZDAB3 and control; 2 Control: non-transgenic control maize; 3 Literature range: reference [31,32,33,34].
Table 6. Vitamin values in maize samples.
Table 6. Vitamin values in maize samples.
Vitaminp-Value
(Adjusted p-Value) 1
Content (mg/100 g)
ZDAB3Control 2Literature Range 3
Vitamin B20.120.13 ± 0.010.11 ± 0.01ND-0.74
Vitamin E0.263.35 ± 0.413.67 ± 0.06ND-8.99
Vitamin B10.04 (0.09)0.09 ± 0.0040.08 ± 0.01ND-4.00
1 No significant differences were observed between ZDAB3 and control; 2 Control: non-transgenic control maize; 3 Literature range: reference [31,32,33,34]. ND: not detectable: some test values in the published studies were less than the lower limit of quantification and were not quantified.
Table 7. Mineral values in maize samples.
Table 7. Mineral values in maize samples.
Mineralp-Value
(Adjusted p-Value) 1
Content (mg/kg)
ZDAB3Control 2Literature Range 3
Calcium0.32192.00 ± 67.44146.33 ± 15.0421.50–1000.00
Copper0.873.26 ± 0.513.33 ± 0.390.73–18.50
Iron0.6723.40 ± 2.2622.80 ± 0.101.00–100.00
Kalium0.053086.67 ± 335.013640.00 ± 91.652730.00–7200.00
Magnesium0.74745.33 ± 110.55768.67 ± 25.7782.00–1940.00
Sodium0.0798.90 ± 6.6688.17 ± 3.770.00–150.00
Phosphorus0.162406.67 ± 361.162780.00 ± 105.361470.00–7500.00
Selenium0.580.02 ± 0.0030.02 ± 0.0050.01–1.00
Zinc0.001 (0.02) *14.80 ± 0.4418.23 ± 0.556.50–39.60
1 A significant difference (adjusted p < 0.05 *) was observed between ZDAB3 and control; 2 Control: non-transgenic control maize; 3 Literature range: reference [31,32,34].
Table 8. Anti-nutrient values in maize samples.
Table 8. Anti-nutrient values in maize samples.
Anti-Nutrientp-Value 1Content
ZDAB3Control 2Literature Range 3
Phytic acid (g/kg)0.7714.20 ± 2.8514.83 ± 2.14ND-19.40
Trypsin inhibitors (TIU/g)0.072176.67 ± 469.181430.00 ± 223.38ND-8420.00
1 No significant differences were observed between ZDAB3 and control; 2 Control: non-transgenic control maize; 3 Literature range: reference [33,34]. ND: not detectable: some test values in the published studies were less than the lower limit of quantification and were not quantified.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Yu, X.; Chen, G.; Zhou, Z.; Chen, X.; He, X.; Jiao, Y.; Wang, P. Bt and G10evo-EPSPS Protein Expressed in ZDAB3 Corn Has No Impact on Nutritional Composition and Toxicological Safety. Processes 2022, 10, 2739. https://doi.org/10.3390/pr10122739

AMA Style

Yu X, Chen G, Zhou Z, Chen X, He X, Jiao Y, Wang P. Bt and G10evo-EPSPS Protein Expressed in ZDAB3 Corn Has No Impact on Nutritional Composition and Toxicological Safety. Processes. 2022; 10(12):2739. https://doi.org/10.3390/pr10122739

Chicago/Turabian Style

Yu, Xiaoxing, Guo Chen, Ziying Zhou, Xiaoyun Chen, Xiaoyun He, Yue Jiao, and Pengfei Wang. 2022. "Bt and G10evo-EPSPS Protein Expressed in ZDAB3 Corn Has No Impact on Nutritional Composition and Toxicological Safety" Processes 10, no. 12: 2739. https://doi.org/10.3390/pr10122739

APA Style

Yu, X., Chen, G., Zhou, Z., Chen, X., He, X., Jiao, Y., & Wang, P. (2022). Bt and G10evo-EPSPS Protein Expressed in ZDAB3 Corn Has No Impact on Nutritional Composition and Toxicological Safety. Processes, 10(12), 2739. https://doi.org/10.3390/pr10122739

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop