Sustained Surface ICAM-1 Expression and Transient PDGF-B Production by Phorbol Myristate Acetate-Activated THP-1 Cells Harboring Blau Syndrome-Associated NOD2 Mutations
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Reagents and Antibodies
2.3. Transfection
2.4. RT-PCR Analysis
2.5. Flow Cytometry
2.6. Immunohistochemistry
2.7. Double Immunofluorescence Staining
3. Results
3.1. No Altered mRNA Expression of Proinflammatory Cytokines in Mutant NOD2-Expressing THP-1 Derivatives
3.2. Long-Term Attachment of Mutant NOD2-Expressing THP-1 Derivatives after PMA Stimulation
3.3. Sustained Surface Expression of ICAM-1 on Mutant NOD2-Expressing THP-1 Derivatives
3.4. No Remarkable Alteration of ICAM-1 or ADAM-17 mRNA Expression Underlies Sustained Surface Expression of ICAM-1
3.5. Transient PDGF-B mRNA Expression in PMA-Stimulated Mutant NOD2-Expressing THP-1 Derivatives
3.6. ICAM-1 and PDGF-B Protein Expression in NOD2-Expressing Giant Cells in the Lesional Skin of a Blau Syndrome Patient
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kanazawa, N.; Furukawa, F. Autoinflammatory syndromes with a dermatological perspective. J. Derm. 2007, 34, 601–618. [Google Scholar] [CrossRef] [PubMed]
- Masters, S.L.; Simon, A.; Aksentijevich, I.; Kastner, D.L. Horror autoinflammaticus: The molecular pathophysiology of autoinflamatory disease. Annu. Rev. Immunol. 2009, 27, 621–668. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kanazawa, N.; Okafuji, I.; Kambe, N.; Nishikomori, R.; Nakata-Hizume, M.; Nagai, S.; Fugi, A.; Yuasa, T.; Manki, A.; Sakurai, Y.; et al. Early-onset sarcoidosis and CARD15 mutations with constitutive nuclear factor-κB activation: Common genetic etiology with Blau syndrome. Blood 2005, 205, 1195–1197. [Google Scholar]
- Kambe, N.; Nishikomori, R.; Kanazawa, N. The cytosolic pattern-recognition receptor Nod2 and inflammatory granulomatous disease. J. Dermal. Sci. 2005, 39, 71–80. [Google Scholar] [CrossRef] [PubMed]
- Rose, C.D.; Martin, T.M.; Wouters, C.H. Blau syndrome revisited. Curr. Opin. Rheumatol. 2011, 23, 411–418. [Google Scholar] [CrossRef]
- Miceli-Richard, C.; Lesage, S.; Rybojad, M.; Prieur, A.M.; Manouvrier-Hanu, S.; Hafner, R.; Chamaillard, M.; Zouali, H.; Thomas, G.; Hugot, J.-P. CARD15 mutations in Blau syndrome. Nat. Genet. 2001, 29, 19–20. [Google Scholar] [CrossRef]
- Inohara, N.; Nunez, G. NODs: Intracellular proteins involved in inflammation and apoptosis. Nat. Rev. Immunol. 2003, 3, 371–382. [Google Scholar] [CrossRef]
- Hayden, M.S.; Ghosh, S. NF-κB in immunobiology. Cell Res. 2011, 21, 223–244. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hugot, J.-P.; Chamaillard, M.; Zouali, H.; Lesage, S.; Cézard, J.-P.; Belaiche, J.; Almer, S.; Tysk, C.; O’Morain, C.A.; Gassull, M.; et al. Association of NOD2 leucine-rich repeat variants with susceptibility to Crohn’s disease. Nature 2001, 411, 599–603. [Google Scholar] [CrossRef]
- Ogura, Y.; Bonen, D.K.; Inohara, N.; Nicolae, D.L.; Chen, F.F.; Ramos, R.; Britton, H.; Moran, T.; Karaliuskas, R.; Duerr, R.H.; et al. A frameshift mutation in NOD2 associated with susceptibility to Crohn’s disease. Nature 2001, 411, 603–606. [Google Scholar] [CrossRef] [PubMed]
- Chamaillard, M.; Philpott, D.; Girardin, S.E.; Zouali, H.; Lesage, S.; Chareyre, F.; Bui, T.H.; Giovannini, M.; Zaehringer, U.; Penard-Lacronique, V.; et al. Gene-environment interaction modulated by allelic heterogeneity in inflammatory deseases. Proc. Natl. Acad. Sci. USA 2003, 100, 3455–3460. [Google Scholar] [CrossRef] [Green Version]
- Okafuji, I.; Nishikomori, R.; Kanazawa, N.; Kambe, N.; Fujisawa, A.; Yamazaki, S.; Saito, M.; Yoshioka, T.; Kawai, T.; Sakai, H.; et al. Role of the NOD2 genotype in the clinical phenotype of Blau syndrome and early-onset sarcoidosis. Arthritis Rheum. 2009, 60, 242–250. [Google Scholar] [CrossRef] [Green Version]
- Yasui, K.; Yashiro, M.; Tsuge, M.; Manki, A.; Takemoto, K.; Yamamoto, M.; Morishima, T. Thalidomide dramatically improves the symptoms of early-onset sarcoidosis/Blau syndrome: Its possible action and mechanism. Arthritis Rheum. 2010, 62, 250–257. [Google Scholar] [CrossRef]
- Ackerman, A.B. Histologic Diagnosis of Inflammatory Skin Diseases.; Ardor Scribendi: New York, NY, USA, 2005; pp. 142–143. [Google Scholar]
- Chen, E.S.; Moller, D.R. Etiologies of sarcoidosis. Clin. Rev. Allergy Immunol. 2015, 49, 6–18. [Google Scholar] [CrossRef]
- Inaoka, P.; Shono, M.; Kamada, M.; Espinoza, J.L. Host-microbe interactions in the pathogenesis and clinical course of sarcoidosis. J. Miomed. Sci. 2019, 26, 45. [Google Scholar] [CrossRef]
- Okamoto, H.; Mizuno, K.; Horio, T. Langhans-type and foreign-body-type multinucleated giant cells in cutaneous lesions of sarcoidosis. Acta Derm. Venereol. 2003, 83, 171–174. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fujisawa, A.; Kambe, N.; Saito, M.; Nishikomori, R.; Tanizaki, H.; Kanazawa, N.; Adachi, S.; Heike, T.; Sagara, J.; Suda, T.; et al. Disease-associated mutations in CIAS1 induce cathepsin B-dependent rapid cell death of human THP-1 monocytic cells. Blood 2007, 109, 2903–2911. [Google Scholar] [CrossRef] [Green Version]
- Tsuchiya, S.; Kobayashi, Y.; Goto, Y.; Okumura, H.; Nakae, S.; Konno, T.; Tada, K. Induction of maturation in cultured human monocytic cells by a phorbol diester. Cancer Res. 1982, 42, 1530–1536. [Google Scholar] [PubMed]
- Asseffa, A.; A Dickson, L.; Mohla, S.; A Bremner, T. Phorbol myristate acetate-differentiated THP-1 cells display increased levels of MHC class II mRNA and interferon-γ-inducible tumoricidal activity. Oncol. Res. 1993, 5, 11–18. [Google Scholar] [PubMed]
- Tsakadze, N.L.; Sithu, S.D.; Sen, U.; English, W.R.; Murphy, G.; D’Souza, S.E. Tumor necrosis factor-α-converting enzyme (TACE/ADAM-17) mediates the ectodomain cleavage of intercellular adhesion molecule-1 (ICAM-1). J. Biol. Chem. 2006, 281, 3157–3164. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Masumoto, J.; Yamazaki, T.; Ohta, K.; Nakayama, J.; Agematsu, K. Interleukin-1β suppression in Blau syndrome: Comment on the article by Martin et al. Arthritis Rheum. 2009, 60, 2544–2545. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.S.; Paik, S.H.; Lim, C.M.; Lee, S.D.; Koh, Y.; Kim, W.S.; Kim, W.D. Value of ICAM-1 expression and soluble ICAM-1 level as a marker of activity in sarcoidosis. Chest 1999, 115, 1059–1065. [Google Scholar] [CrossRef] [Green Version]
- Van De Stolpe, A.; Caldenhoven, E.; Stade, B.G.; Koenderman, L.; A Raaijmakers, J.; Johnson, J.P.; Van Der Saag, P.T. 12-O-tetradecanoylphorbol-13-acetate- and tumor necrosis factor alpha-mediated induction of intercellular adhesion molecule-1 is inhibited by dexamethasone. Functional analysis of the human intercellular adhesion molecular-1 promoter. J. Biol. Chem. 1994, 269, 6185–6192. [Google Scholar] [CrossRef]
- Khachigian, L.M.; Resnick, N.; Gimbrone, M.A., Jr.; Collins, T. Nuclear factor-kappa B interacts functionally with the platelet-derived growth factor B-chain shear-stress response element in vascular endothelial cells exposed to fluid shear stress. J. Clin. Investig. 1995, 96, 1169–1175. [Google Scholar] [CrossRef] [PubMed]
- Marshall, B.G.; Wangoo, A.; Cook, H.T.; Shaw, R.J. Increased inflammatory cytokines and new collagen formation in cutaneous tuberculosis and sarcoidosis. Thorax 1996, 51, 1253–1261. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hoyle, G.W.; Li, J.; Finkelstein, J.B.; Eisenberg, T.; Liu, J.-Y.; Lasky, J.A.; Athas, G.; Morris, G.F.; Brody, A.R. Emphysematous lesions, inflammation, and fibrosis in the lungs of transgenic mice overexpressing platelet-derived growth factor. Am. J. Pathol. 1999, 154, 1763–1775. [Google Scholar] [CrossRef] [Green Version]
- Janssen, C.E.; Rose, C.D.; De Hertogh, G.; Martin, T.M.; Meunier, B.B.; Cimaz, R.; Harjacek, M.; Quartier, P.; Cate, R.T.; Thomee, C.; et al. Morphologic and immunohistochemical characterization of granulomas in the nucleotide oligomerization domain 2-related disorders Blau syndrome and Crohn disease. J. Allergy Clin. Immunol. 2012, 129, 1076–1084. [Google Scholar] [CrossRef] [PubMed]
Forward | Reverse | |
---|---|---|
NOD2 | AGACTCAGCTTCCCAAGGTCTG | AGAACACGTAGCAGCACATGCC |
IL-8 | AAGGAATAGCATCAATAGTGAGTTTG | GGACACAAGCTTAAACCCAGA |
ICAM-1 | CCTTCCTCACCGTGTACTGG | AGCGTAGGGTAAGGTTCTTGC |
ADAM17 | CCTTTCTGCGAGAGGGAAC | CACCTTGCAGGAGTTGTCAG |
PDGF-B | CCTTTGATGATCTCCAACGC | GATCTTTCTCACCTGGACAG |
HPRT | AATTATGGACAGGACTGAACGTC | CGTGGGGTCCTTTTCACCAGCAAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nishiyama, M.; Li, H.-j.; Okafuji, I.; Fujisawa, A.; Ehara, M.; Kambe, N.; Furukawa, F.; Kanazawa, N. Sustained Surface ICAM-1 Expression and Transient PDGF-B Production by Phorbol Myristate Acetate-Activated THP-1 Cells Harboring Blau Syndrome-Associated NOD2 Mutations. Children 2021, 8, 335. https://doi.org/10.3390/children8050335
Nishiyama M, Li H-j, Okafuji I, Fujisawa A, Ehara M, Kambe N, Furukawa F, Kanazawa N. Sustained Surface ICAM-1 Expression and Transient PDGF-B Production by Phorbol Myristate Acetate-Activated THP-1 Cells Harboring Blau Syndrome-Associated NOD2 Mutations. Children. 2021; 8(5):335. https://doi.org/10.3390/children8050335
Chicago/Turabian StyleNishiyama, Mizuho, Hong-jin Li, Ikuo Okafuji, Akihiko Fujisawa, Mizue Ehara, Naotomo Kambe, Fukumi Furukawa, and Nobuo Kanazawa. 2021. "Sustained Surface ICAM-1 Expression and Transient PDGF-B Production by Phorbol Myristate Acetate-Activated THP-1 Cells Harboring Blau Syndrome-Associated NOD2 Mutations" Children 8, no. 5: 335. https://doi.org/10.3390/children8050335
APA StyleNishiyama, M., Li, H.-j., Okafuji, I., Fujisawa, A., Ehara, M., Kambe, N., Furukawa, F., & Kanazawa, N. (2021). Sustained Surface ICAM-1 Expression and Transient PDGF-B Production by Phorbol Myristate Acetate-Activated THP-1 Cells Harboring Blau Syndrome-Associated NOD2 Mutations. Children, 8(5), 335. https://doi.org/10.3390/children8050335